Homologs in group_2070

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15485 FBDBKF_15485 100.0 Morganella morganii S1 atpA F0F1 ATP synthase subunit alpha
NLDBIP_16525 NLDBIP_16525 100.0 Morganella morganii S4 atpA F0F1 ATP synthase subunit alpha
LHKJJB_16280 LHKJJB_16280 100.0 Morganella morganii S3 atpA F0F1 ATP synthase subunit alpha
HKOGLL_16050 HKOGLL_16050 100.0 Morganella morganii S5 atpA F0F1 ATP synthase subunit alpha
F4V73_RS17660 F4V73_RS17660 97.5 Morganella psychrotolerans atpA F0F1 ATP synthase subunit alpha
PMI_RS15165 PMI_RS15165 94.7 Proteus mirabilis HI4320 atpA F0F1 ATP synthase subunit alpha

Distribution of the homologs in the orthogroup group_2070

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2070

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F0E5 0 998 94 0 513 3 atpA ATP synthase subunit alpha Proteus mirabilis (strain HI4320)
Q7NA92 0 994 93 0 513 3 atpA ATP synthase subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JRN0 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q6 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSJ1 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pestis (strain Pestoides F)
Q1CCH3 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5U1 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pestis bv. Antiqua (strain Angola)
Q8Z9S4 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pestis
B2K845 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C093 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE2 0 982 92 0 513 3 atpA ATP synthase subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JTC8 0 978 92 0 513 3 atpA ATP synthase subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C5BF38 0 977 92 0 513 3 atpA ATP synthase subunit alpha Edwardsiella ictaluri (strain 93-146)
C6DJH0 0 974 92 0 513 3 atpA ATP synthase subunit alpha Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8G7M6 0 974 91 0 513 3 atpA ATP synthase subunit alpha Serratia proteamaculans (strain 568)
Q6CYJ3 0 973 92 0 513 3 atpA ATP synthase subunit alpha Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YVN8 0 969 91 0 513 3 atpA ATP synthase subunit alpha Shigella sonnei (strain Ss046)
P0ABB3 0 969 91 0 513 3 atpA ATP synthase subunit alpha Shigella flexneri
Q0SYU2 0 969 91 0 513 1 atpA ATP synthase subunit alpha Shigella flexneri serotype 5b (strain 8401)
Q329S3 0 969 91 0 513 3 atpA ATP synthase subunit alpha Shigella dysenteriae serotype 1 (strain Sd197)
Q31UN4 0 969 91 0 513 3 atpA ATP synthase subunit alpha Shigella boydii serotype 4 (strain Sb227)
B5XZM2 0 969 91 0 513 3 atpA ATP synthase subunit alpha Klebsiella pneumoniae (strain 342)
B7LK79 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4K0 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain UTI89 / UPEC)
B1LL61 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain SMS-3-5 / SECEC)
B6I3X1 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain SE11)
B7NF50 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABB0 0 969 91 0 513 1 atpA ATP synthase subunit alpha Escherichia coli (strain K12)
B1IX04 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABB1 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX5 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6J7 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O9:H4 (strain HS)
B1X9W2 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain K12 / DH10B)
C4ZZ12 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain K12 / MC4100 / BW2952)
B7M590 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O8 (strain IAI1)
B7N2H3 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O81 (strain ED1a)
B7NR36 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXD8 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABB2 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O157:H7
B7L884 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli (strain 55989 / EAEC)
B7MGF4 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMJ9 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTU6 0 969 91 0 513 3 atpA ATP synthase subunit alpha Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TG38 0 968 91 0 513 3 atpA ATP synthase subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2TUP1 0 966 91 0 513 3 atpA ATP synthase subunit alpha Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q7CPE1 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XG95 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella typhi
B4TN33 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella schwarzengrund (strain CVM19633)
B5BIN8 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella paratyphi A (strain AKU_12601)
A9MXA8 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKX0 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYD3 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella newport (strain SL254)
B4TAX4 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella heidelberg (strain SL476)
B5RFW1 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QUS6 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella enteritidis PT4 (strain P125109)
B5FN35 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella dublin (strain CT_02021853)
B5EYZ8 0 966 91 0 513 3 atpA ATP synthase subunit alpha Salmonella agona (strain SL483)
A7MMX1 0 966 90 0 513 3 atpA ATP synthase subunit alpha Cronobacter sakazakii (strain ATCC BAA-894)
C0Q2N4 0 965 91 0 513 3 atpA ATP synthase subunit alpha Salmonella paratyphi C (strain RKS4594)
Q57HX7 0 965 91 0 513 3 atpA ATP synthase subunit alpha Salmonella choleraesuis (strain SC-B67)
A9MJR7 0 964 91 0 513 3 atpA ATP synthase subunit alpha Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ACN8 0 962 90 0 513 3 atpA ATP synthase subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q2NQ88 0 960 91 0 513 3 atpA ATP synthase subunit alpha Sodalis glossinidius (strain morsitans)
A4WGF3 0 956 89 0 513 3 atpA ATP synthase subunit alpha Enterobacter sp. (strain 638)
B2VCA6 0 951 88 0 513 3 atpA ATP synthase subunit alpha Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9CKW2 0 922 85 0 513 3 atpA ATP synthase subunit alpha Pasteurella multocida (strain Pm70)
C4LDW2 0 917 85 0 513 3 atpA ATP synthase subunit alpha Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A3QJR2 0 909 84 0 513 3 atpA ATP synthase subunit alpha Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B8F772 0 909 84 0 513 3 atpA ATP synthase subunit alpha Glaesserella parasuis serovar 5 (strain SH0165)
A8G1W7 0 908 84 0 513 3 atpA ATP synthase subunit alpha Shewanella sediminis (strain HAW-EB3)
Q7VPP2 0 908 84 0 513 3 atpA ATP synthase subunit alpha Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8E8B8 0 907 85 0 513 3 atpA ATP synthase subunit alpha Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0UWG7 0 907 84 0 513 3 atpA ATP synthase subunit alpha Histophilus somni (strain 2336)
Q0I5X1 0 907 84 0 513 3 atpA ATP synthase subunit alpha Histophilus somni (strain 129Pt)
Q0HPF9 0 906 85 0 513 3 atpA ATP synthase subunit alpha Shewanella sp. (strain MR-7)
Q0HD77 0 906 85 0 513 3 atpA ATP synthase subunit alpha Shewanella sp. (strain MR-4)
A0L2T0 0 906 85 0 513 3 atpA ATP synthase subunit alpha Shewanella sp. (strain ANA-3)
B0TQF6 0 906 84 0 513 3 atpA ATP synthase subunit alpha Shewanella halifaxensis (strain HAW-EB4)
A5UA09 0 905 85 0 513 3 atpA ATP synthase subunit alpha Haemophilus influenzae (strain PittEE)
A6VL59 0 905 84 0 513 3 atpA ATP synthase subunit alpha Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8CVU7 0 905 84 0 513 3 atpA ATP synthase subunit alpha Shewanella piezotolerans (strain WP3 / JCM 13877)
B0BRX4 0 905 84 0 513 3 atpA ATP synthase subunit alpha Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2P5 0 905 84 0 513 3 atpA ATP synthase subunit alpha Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B1KQ36 0 904 84 0 513 3 atpA ATP synthase subunit alpha Shewanella woodyi (strain ATCC 51908 / MS32)
A3N2U6 0 904 84 0 513 3 atpA ATP synthase subunit alpha Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UGZ1 0 903 84 0 513 3 atpA ATP synthase subunit alpha Haemophilus influenzae (strain PittGG)
A8HAG5 0 902 84 0 513 3 atpA ATP synthase subunit alpha Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
P43714 0 902 84 0 513 3 atpA ATP synthase subunit alpha Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1RQB2 0 902 84 0 513 3 atpA ATP synthase subunit alpha Shewanella sp. (strain W3-18-1)
A4YCI0 0 902 84 0 513 3 atpA ATP synthase subunit alpha Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q4QN62 0 900 84 0 513 3 atpA ATP synthase subunit alpha Haemophilus influenzae (strain 86-028NP)
A9KX08 0 898 84 0 513 3 atpA ATP synthase subunit alpha Shewanella baltica (strain OS195)
A6WUJ2 0 898 84 0 513 3 atpA ATP synthase subunit alpha Shewanella baltica (strain OS185)
A3DAR6 0 898 84 0 513 3 atpA ATP synthase subunit alpha Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDV2 0 898 84 0 513 3 atpA ATP synthase subunit alpha Shewanella baltica (strain OS223)
Q8DDH0 0 894 84 0 513 3 atpA ATP synthase subunit alpha Vibrio vulnificus (strain CMCP6)
Q7MGH8 0 894 84 0 513 3 atpA ATP synthase subunit alpha Vibrio vulnificus (strain YJ016)
Q9KNH3 0 892 84 0 513 3 atpA ATP synthase subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F457 0 892 84 0 513 3 atpA ATP synthase subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q65Q05 0 890 84 0 513 3 atpA ATP synthase subunit alpha Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q6LKZ8 0 889 82 0 513 3 atpA2 ATP synthase subunit alpha 2 Photobacterium profundum (strain SS9)
P12985 0 888 84 0 513 1 atpA ATP synthase subunit alpha Vibrio alginolyticus
Q3IK48 0 888 83 0 513 3 atpA ATP synthase subunit alpha Pseudoalteromonas translucida (strain TAC 125)
Q87KA6 0 887 84 0 513 3 atpA ATP synthase subunit alpha Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q12HP9 0 887 83 0 513 3 atpA ATP synthase subunit alpha Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A7N0Y3 0 882 83 0 513 3 atpA1 ATP synthase subunit alpha 1 Vibrio campbellii (strain ATCC BAA-1116)
A1SBU2 0 880 84 0 513 3 atpA ATP synthase subunit alpha Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A4STP5 0 877 84 0 513 3 atpA ATP synthase subunit alpha Aeromonas salmonicida (strain A449)
A0KQY0 0 877 84 0 513 3 atpA ATP synthase subunit alpha Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5FCZ3 0 872 82 0 513 3 atpA ATP synthase subunit alpha Aliivibrio fischeri (strain MJ11)
Q5E1N5 0 872 82 0 513 3 atpA ATP synthase subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q15MU2 0 868 83 0 513 3 atpA2 ATP synthase subunit alpha 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B6EHT9 0 863 81 0 513 3 atpA ATP synthase subunit alpha Aliivibrio salmonicida (strain LFI1238)
A1T0Z1 0 858 79 0 513 3 atpA2 ATP synthase subunit alpha 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B4RS83 0 857 81 0 513 3 atpA ATP synthase subunit alpha Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q07VU2 0 857 82 0 513 3 atpA2 ATP synthase subunit alpha 2 Shewanella frigidimarina (strain NCIMB 400)
Q48AW2 0 854 82 0 513 3 atpA ATP synthase subunit alpha Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QZI4 0 852 80 0 513 3 atpA ATP synthase subunit alpha Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q6LLG6 0 851 81 0 513 3 atpA1 ATP synthase subunit alpha 1 Photobacterium profundum (strain SS9)
A7N6Q6 0 832 79 0 512 3 atpA2 ATP synthase subunit alpha 2 Vibrio campbellii (strain ATCC BAA-1116)
Q1LTV2 0 828 76 0 513 3 atpA ATP synthase subunit alpha Baumannia cicadellinicola subsp. Homalodisca coagulata
Q494C5 0 824 75 0 513 3 atpA ATP synthase subunit alpha Blochmanniella pennsylvanica (strain BPEN)
C3K1E8 0 823 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas fluorescens (strain SBW25)
B0KRB0 0 823 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas putida (strain GB-1)
B1JFU3 0 822 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas putida (strain W619)
Q88BX2 0 821 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HT18 0 820 79 0 512 3 atpA ATP synthase subunit alpha Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF2 0 820 79 0 512 3 atpA ATP synthase subunit alpha Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V793 0 820 79 0 512 3 atpA ATP synthase subunit alpha Pseudomonas aeruginosa (strain LESB58)
A6VF34 0 820 79 0 512 3 atpA ATP synthase subunit alpha Pseudomonas aeruginosa (strain PA7)
A5WBA5 0 819 76 0 512 3 atpA ATP synthase subunit alpha Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A4Y189 0 819 78 0 512 3 atpA ATP synthase subunit alpha Pseudomonas mendocina (strain ymp)
Q4K3A7 0 815 78 0 512 3 atpA ATP synthase subunit alpha Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K439 0 813 78 0 512 3 atpA ATP synthase subunit alpha Pseudomonas fluorescens (strain Pf0-1)
A4VS64 0 812 78 0 512 3 atpA ATP synthase subunit alpha Stutzerimonas stutzeri (strain A1501)
Q87TT2 0 810 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZL22 0 809 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas syringae pv. syringae (strain B728a)
Q48BG3 0 809 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1I2I5 0 807 77 0 512 3 atpA ATP synthase subunit alpha Pseudomonas entomophila (strain L48)
Q2S6N9 0 805 75 0 512 3 atpA2 ATP synthase subunit alpha 2 Hahella chejuensis (strain KCTC 2396)
B8GRC0 0 801 73 0 513 3 atpA ATP synthase subunit alpha Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
P57122 0 794 73 0 511 3 atpA ATP synthase subunit alpha Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8H1 0 794 73 0 511 3 atpA ATP synthase subunit alpha Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q5ZR99 0 794 73 0 511 3 atpA2 ATP synthase subunit alpha 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X0P1 0 794 73 0 511 3 atpA2 ATP synthase subunit alpha 2 Legionella pneumophila (strain Paris)
Q5WSG6 0 793 72 0 511 3 atpA ATP synthase subunit alpha Legionella pneumophila (strain Lens)
A6W3T0 0 793 74 0 512 3 atpA2 ATP synthase subunit alpha 2 Marinomonas sp. (strain MWYL1)
B8D6S5 0 792 73 0 511 3 atpA ATP synthase subunit alpha Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A5III5 0 790 72 0 511 3 atpA2 ATP synthase subunit alpha 2 Legionella pneumophila (strain Corby)
O51874 0 789 73 0 508 3 atpA ATP synthase subunit alpha Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B3PIS9 0 789 73 0 512 3 atpA ATP synthase subunit alpha Cellvibrio japonicus (strain Ueda107)
Q21DK6 0 788 74 1 512 3 atpA ATP synthase subunit alpha Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VKX2 0 786 73 0 512 3 atpA ATP synthase subunit alpha Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B0VBP5 0 786 75 0 512 3 atpA ATP synthase subunit alpha Acinetobacter baumannii (strain AYE)
A3M142 0 786 75 0 512 1 atpA ATP synthase subunit alpha Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I100 0 786 75 0 512 3 atpA ATP synthase subunit alpha Acinetobacter baumannii (strain ACICU)
B7I1W2 0 786 75 0 512 3 atpA ATP synthase subunit alpha Acinetobacter baumannii (strain AB0057)
B7H296 0 786 75 0 512 3 atpA ATP synthase subunit alpha Acinetobacter baumannii (strain AB307-0294)
Q60CR6 0 785 74 0 513 3 atpA1 ATP synthase subunit alpha 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
C5BKJ7 0 783 73 1 512 3 atpA ATP synthase subunit alpha Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q1Q897 0 782 75 0 512 3 atpA ATP synthase subunit alpha Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FQ35 0 782 75 0 512 3 atpA ATP synthase subunit alpha Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6FFK2 0 782 74 0 512 3 atpA ATP synthase subunit alpha Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3BP13 0 781 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGG5 0 781 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas axonopodis pv. citri (strain 306)
B2FHZ0 0 781 73 0 511 3 atpA ATP synthase subunit alpha Stenotrophomonas maltophilia (strain K279a)
B4SJS1 0 780 73 0 511 3 atpA ATP synthase subunit alpha Stenotrophomonas maltophilia (strain R551-3)
Q8PCZ7 0 780 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWC4 0 780 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas campestris pv. campestris (strain B100)
Q4UQF2 0 780 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas campestris pv. campestris (strain 8004)
Q1QSC8 0 780 72 0 512 3 atpA ATP synthase subunit alpha Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0A4M6 0 779 73 0 513 3 atpA ATP synthase subunit alpha Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5H4Y6 0 778 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB2 0 778 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q6 0 778 73 0 511 3 atpA ATP synthase subunit alpha Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B0U5A0 0 778 73 0 511 3 atpA ATP synthase subunit alpha Xylella fastidiosa (strain M12)
Q9PE83 0 778 73 0 511 3 atpA ATP synthase subunit alpha Xylella fastidiosa (strain 9a5c)
Q7VQV8 0 778 72 0 511 3 atpA ATP synthase subunit alpha Blochmanniella floridana
Q87E88 0 775 73 0 511 3 atpA ATP synthase subunit alpha Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I862 0 775 73 0 511 3 atpA ATP synthase subunit alpha Xylella fastidiosa (strain M23)
Q3J6M9 0 775 72 0 513 3 atpA ATP synthase subunit alpha Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A5WBV9 0 772 74 0 512 3 atpA ATP synthase subunit alpha Psychrobacter sp. (strain PRwf-1)
A1WZT3 0 771 70 0 513 3 atpA ATP synthase subunit alpha Halorhodospira halophila (strain DSM 244 / SL1)
A1U7H6 0 771 73 0 512 3 atpA ATP synthase subunit alpha Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B2SEX9 0 768 72 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. mediasiatica (strain FSC147)
A0Q8E1 0 767 72 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. novicida (strain U112)
A4IW22 0 765 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK5 0 765 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K08 0 765 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BK82 0 761 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1I0 0 761 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. holarctica (strain LVS)
A7NEH6 0 761 71 0 513 3 atpA ATP synthase subunit alpha Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0TWS5 0 761 71 0 513 3 atpA ATP synthase subunit alpha Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A4GAH1 0 759 71 0 510 3 atpA ATP synthase subunit alpha Herminiimonas arsenicoxydans
A5EXJ7 0 759 71 0 512 3 atpA ATP synthase subunit alpha Dichelobacter nodosus (strain VCS1703A)
Q3SF64 0 758 70 0 510 3 atpA ATP synthase subunit alpha Thiobacillus denitrificans (strain ATCC 25259)
A6T472 0 757 70 0 510 3 atpA ATP synthase subunit alpha Janthinobacterium sp. (strain Marseille)
C1D5G4 0 754 70 0 513 3 atpA ATP synthase subunit alpha Laribacter hongkongensis (strain HLHK9)
Q0AJB2 0 752 71 0 508 3 atpA1 ATP synthase subunit alpha 1 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q5P4E4 0 748 70 1 513 3 atpA ATP synthase subunit alpha Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q1LHK8 0 747 69 0 513 3 atpA ATP synthase subunit alpha Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1K1S0 0 746 70 1 513 3 atpA ATP synthase subunit alpha Azoarcus sp. (strain BH72)
Q1GXM8 0 746 69 0 513 3 atpA ATP synthase subunit alpha Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q82XQ0 0 743 69 0 513 3 atpA ATP synthase subunit alpha Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B5ER44 0 742 68 0 512 3 atpA ATP synthase subunit alpha Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JB86 0 742 68 0 512 3 atpA ATP synthase subunit alpha Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q477Z3 0 741 69 1 513 3 atpA ATP synthase subunit alpha Dechloromonas aromatica (strain RCB)
Q0K5M5 0 739 70 0 513 3 atpA ATP synthase subunit alpha Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2YCA5 0 739 68 0 513 3 atpA1 ATP synthase subunit alpha 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A5CVI8 0 739 67 0 513 3 atpA ATP synthase subunit alpha Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1AXU4 0 739 67 0 513 3 atpA ATP synthase subunit alpha Ruthia magnifica subsp. Calyptogena magnifica
A9BPU5 0 737 69 1 515 3 atpA ATP synthase subunit alpha Delftia acidovorans (strain DSM 14801 / SPH-1)
P41167 0 737 67 0 512 3 atpA ATP synthase subunit alpha Acidithiobacillus ferridurans
Q83AF7 0 736 68 0 512 1 atpA ATP synthase subunit alpha Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBC8 0 736 68 0 512 3 atpA ATP synthase subunit alpha Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KBF9 0 736 68 0 512 3 atpA ATP synthase subunit alpha Coxiella burnetii (strain Dugway 5J108-111)
B6J2D8 0 736 68 0 512 3 atpA ATP synthase subunit alpha Coxiella burnetii (strain CbuG_Q212)
B6J961 0 736 68 0 512 3 atpA ATP synthase subunit alpha Coxiella burnetii (strain CbuK_Q154)
Q7P097 0 734 69 0 513 3 atpA ATP synthase subunit alpha Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1KW13 0 734 68 0 513 3 atpA ATP synthase subunit alpha Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M121 0 733 68 0 513 3 atpA ATP synthase subunit alpha Neisseria meningitidis serogroup C (strain 053442)
Q8XU74 0 733 70 0 513 3 atpA ATP synthase subunit alpha Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8D3J5 0 732 67 0 508 3 atpA ATP synthase subunit alpha Wigglesworthia glossinidia brevipalpis
B2UGV1 0 732 70 0 513 3 atpA ATP synthase subunit alpha Ralstonia pickettii (strain 12J)
Q9JXQ0 0 732 68 0 513 3 atpA ATP synthase subunit alpha Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F4Z2 0 732 68 0 513 3 atpA ATP synthase subunit alpha Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q46VX8 0 732 70 0 513 3 atpA ATP synthase subunit alpha Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q89B41 0 732 65 0 513 3 atpA ATP synthase subunit alpha Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9JW72 0 731 68 0 513 3 atpA ATP synthase subunit alpha Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9AJG2 0 729 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia multivorans (strain ATCC 17616 / 249)
Q223D4 0 728 68 1 515 3 atpA1 ATP synthase subunit alpha 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q13SQ0 0 728 69 0 513 3 atpA2 ATP synthase subunit alpha 2 Paraburkholderia xenovorans (strain LB400)
B1Y3S9 0 727 69 0 510 3 atpA ATP synthase subunit alpha Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q0BJL7 0 726 70 0 513 3 atpA ATP synthase subunit alpha Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQL2 0 726 70 0 513 3 atpA ATP synthase subunit alpha Burkholderia ambifaria (strain MC40-6)
B1XSD2 0 726 70 0 513 3 atpA ATP synthase subunit alpha Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4SUT2 0 726 70 0 513 3 atpA ATP synthase subunit alpha Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q1BRA8 0 725 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia orbicola (strain AU 1054)
B1JSV5 0 725 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia orbicola (strain MC0-3)
A0K2Y1 0 725 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia cenocepacia (strain HI2424)
Q31DL8 0 723 70 0 510 3 atpA ATP synthase subunit alpha Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q63PH8 0 723 70 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia pseudomallei (strain K96243)
A3NF42 0 723 70 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia pseudomallei (strain 668)
Q3JXV6 0 723 70 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia pseudomallei (strain 1710b)
A3P0Z2 0 723 70 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia pseudomallei (strain 1106a)
A1VIV0 0 722 69 1 515 3 atpA1 ATP synthase subunit alpha 1 Polaromonas naphthalenivorans (strain CJ2)
A4JA33 0 722 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia vietnamiensis (strain G4 / LMG 22486)
A2S6K0 0 722 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia mallei (strain NCTC 10229)
B4EEY7 0 722 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1V8T3 0 722 69 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia mallei (strain SAVP1)
Q62FR7 0 722 69 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia mallei (strain ATCC 23344)
A3MQJ7 0 722 69 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia mallei (strain NCTC 10247)
Q2STE7 0 721 69 0 513 3 atpA1 ATP synthase subunit alpha 1 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
C5CNB3 0 721 69 1 515 3 atpA ATP synthase subunit alpha Variovorax paradoxus (strain S110)
Q39KX8 0 719 69 0 513 3 atpA ATP synthase subunit alpha Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1TJ39 0 719 69 2 517 3 atpA ATP synthase subunit alpha Paracidovorax citrulli (strain AAC00-1)
A1W2T5 0 719 69 2 517 3 atpA ATP synthase subunit alpha Acidovorax sp. (strain JS42)
B9MBA1 0 719 69 2 517 3 atpA ATP synthase subunit alpha Acidovorax ebreus (strain TPSY)
Q12GQ2 0 718 69 1 507 3 atpA ATP synthase subunit alpha Polaromonas sp. (strain JS666 / ATCC BAA-500)
A2SC68 0 717 68 1 515 3 atpA ATP synthase subunit alpha Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q7W3A8 0 713 68 0 508 3 atpA ATP synthase subunit alpha Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM7 0 713 68 0 508 3 atpA ATP synthase subunit alpha Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9HY40 0 712 69 0 508 3 atpA ATP synthase subunit alpha Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2KU34 0 712 69 0 508 3 atpA ATP synthase subunit alpha Bordetella avium (strain 197N)
A1WF56 0 699 68 1 504 3 atpA ATP synthase subunit alpha Verminephrobacter eiseniae (strain EF01-2)
Q7VU46 0 698 68 0 508 3 atpA ATP synthase subunit alpha Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B0THN4 0 631 60 1 510 3 atpA ATP synthase subunit alpha Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q3A944 0 619 59 1 510 3 atpA ATP synthase subunit alpha Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B3EA03 0 614 59 1 508 3 atpA ATP synthase subunit alpha Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A1ALL5 0 613 59 1 508 3 atpA1 ATP synthase subunit alpha Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A8MJW1 0 612 59 2 508 3 atpA ATP synthase subunit alpha Alkaliphilus oremlandii (strain OhILAs)
Q67TB9 0 610 59 2 508 3 atpA ATP synthase subunit alpha Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B9LZ86 0 607 58 2 508 3 atpA ATP synthase subunit alpha Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q2N8Z5 0 607 57 2 515 3 atpA ATP synthase subunit alpha Erythrobacter litoralis (strain HTCC2594)
A4J9A1 0 606 58 1 510 3 atpA ATP synthase subunit alpha Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B8FZ36 0 605 57 1 508 3 atpA ATP synthase subunit alpha Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A0LLG0 0 605 57 2 510 3 atpA ATP synthase subunit alpha Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A9KK94 0 603 58 1 508 3 atpA ATP synthase subunit alpha Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q24MN9 0 603 57 1 508 3 atpA ATP synthase subunit alpha Desulfitobacterium hafniense (strain Y51)
B8CZ12 0 603 57 2 509 3 atpA ATP synthase subunit alpha Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A5G9D6 0 602 57 1 508 3 atpA ATP synthase subunit alpha Geotalea uraniireducens (strain Rf4)
B8H5I2 0 601 59 3 519 3 atpA ATP synthase subunit alpha Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A2V7 0 601 59 3 519 3 atpA ATP synthase subunit alpha Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B0T338 0 601 59 3 519 3 atpA ATP synthase subunit alpha Caulobacter sp. (strain K31)
Q39Q54 0 599 58 2 509 3 atpA ATP synthase subunit alpha Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P50000 0 597 57 2 513 3 atpA ATP synthase subunit alpha, sodium ion specific Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q02BU3 0 597 57 1 507 3 atpA ATP synthase subunit alpha Solibacter usitatus (strain Ellin6076)
Q2RFX7 0 597 57 2 511 1 atpA ATP synthase subunit alpha Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A6TK63 0 597 57 2 508 3 atpA ATP synthase subunit alpha Alkaliphilus metalliredigens (strain QYMF)
Q39ZT9 0 597 58 1 507 3 atpA1 ATP synthase subunit alpha 1/3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q0SQZ3 0 596 56 1 508 3 atpA ATP synthase subunit alpha Clostridium perfringens (strain SM101 / Type A)
Q8XID2 0 595 56 1 508 3 atpA ATP synthase subunit alpha Clostridium perfringens (strain 13 / Type A)
Q0TNC2 0 595 56 1 508 3 atpA ATP synthase subunit alpha Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A7H1H9 0 595 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q5HX61 0 594 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter jejuni (strain RM1221)
Q9PJ21 0 594 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FJR0 0 594 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1VXI8 0 593 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q1GQS7 0 593 57 2 515 3 atpA ATP synthase subunit alpha Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2G5N7 0 593 57 3 515 3 atpA ATP synthase subunit alpha Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q74GY2 0 593 57 2 509 3 atpA ATP synthase subunit alpha Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B9DX63 0 592 56 1 508 3 atpA ATP synthase subunit alpha Clostridium kluyveri (strain NBRC 12016)
A0RR28 0 592 57 1 512 3 atpA ATP synthase subunit alpha Campylobacter fetus subsp. fetus (strain 82-40)
B8DRD0 0 592 57 1 508 3 atpA ATP synthase subunit alpha Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2LQZ7 0 591 56 1 507 3 atpA1 ATP synthase subunit alpha 1 Syntrophus aciditrophicus (strain SB)
Q30QP9 0 589 56 2 509 3 atpA ATP synthase subunit alpha Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q4UK16 0 589 57 3 515 3 atpA ATP synthase subunit alpha Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q313V8 0 589 55 1 508 3 atpA ATP synthase subunit alpha Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5N3H9 0 589 56 1 508 3 atpA ATP synthase subunit alpha Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
C1FQP3 0 589 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Kyoto / Type A2)
A5HY50 0 589 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KYJ1 0 589 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain 657 / Type Ba4)
A7FQH7 0 589 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain ATCC 19397 / Type A)
O50288 0 588 57 3 515 3 atpA ATP synthase subunit alpha Rickettsia prowazekii (strain Madrid E)
A8F2U2 0 588 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia massiliae (strain Mtu5)
P55987 0 588 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain ATCC 700392 / 26695)
Q1CSD3 0 588 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain HPAG1)
B6JMX4 0 588 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain P12)
B1IE32 0 588 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Okra / Type B1)
B5Z8D2 0 588 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain G27)
B1KSS6 0 588 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Loch Maree / Type A3)
A7G9Q7 0 588 57 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B5EFI9 0 588 56 1 508 3 atpA ATP synthase subunit alpha Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B2UUP2 0 587 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain Shi470)
Q92G86 0 587 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q17Y80 0 587 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter acinonychis (strain Sheeba)
A7I175 0 587 57 1 506 3 atpA ATP synthase subunit alpha Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A6Q4C2 0 586 56 1 511 3 atpA ATP synthase subunit alpha Nitratiruptor sp. (strain SB155-2)
C6E9F3 0 586 56 1 508 3 atpA ATP synthase subunit alpha Geobacter sp. (strain M21)
Q5NQZ1 0 586 57 3 515 3 atpA ATP synthase subunit alpha Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A6LJR3 0 586 56 2 510 3 atpA ATP synthase subunit alpha Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q4FP36 0 586 56 5 516 3 atpA ATP synthase subunit alpha Pelagibacter ubique (strain HTCC1062)
Q8RGE0 0 586 56 2 510 1 atpA ATP synthase subunit alpha Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A8GTS8 0 585 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia rickettsii (strain Sheila Smith)
B0BVB8 0 585 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia rickettsii (strain Iowa)
C4K229 0 585 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia peacockii (strain Rustic)
B9K7T9 0 585 56 2 511 3 atpA ATP synthase subunit alpha Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A8GPZ6 0 585 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia akari (strain Hartford)
A0Q2Z6 0 585 56 1 508 3 atpA ATP synthase subunit alpha Clostridium novyi (strain NT)
Q9Z689 0 585 57 1 508 3 atpA ATP synthase subunit alpha Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7H019 0 585 57 1 511 3 atpA ATP synthase subunit alpha Campylobacter curvus (strain 525.92)
Q68VU6 0 584 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A5CYE4 0 583 57 2 508 3 atpA ATP synthase subunit alpha Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q9ZK79 0 583 56 2 511 3 atpA ATP synthase subunit alpha Helicobacter pylori (strain J99 / ATCC 700824)
Q7VJ23 0 583 56 1 507 3 atpA ATP synthase subunit alpha Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q3Z8Z4 0 583 57 2 509 3 atpA ATP synthase subunit alpha Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B1LBC1 0 583 55 2 511 3 atpA ATP synthase subunit alpha Thermotoga sp. (strain RQ2)
A5ILX0 0 583 55 2 511 3 atpA ATP synthase subunit alpha Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1U7 0 583 55 2 511 1 atpA ATP synthase subunit alpha Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2VZN0 0 583 57 3 518 3 atpA ATP synthase subunit alpha Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B3EL39 0 583 56 1 511 3 atpA ATP synthase subunit alpha Chlorobium phaeobacteroides (strain BS1)
B9KES1 0 583 56 1 511 3 atpA ATP synthase subunit alpha Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
C0Z778 0 582 56 2 502 3 atpA ATP synthase subunit alpha Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
C1F3N8 0 582 56 2 507 3 atpA ATP synthase subunit alpha Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q3ZZT9 0 582 57 2 509 3 atpA ATP synthase subunit alpha Dehalococcoides mccartyi (strain CBDB1)
A5FRQ3 0 582 57 2 509 3 atpA ATP synthase subunit alpha Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A7ZC35 0 581 56 2 509 3 atpA ATP synthase subunit alpha Campylobacter concisus (strain 13826)
C5CIV6 0 581 57 1 508 3 atpA ATP synthase subunit alpha Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
A6QB61 0 580 56 1 510 3 atpA ATP synthase subunit alpha Sulfurovum sp. (strain NBC37-1)
A6LQH4 0 580 55 1 508 3 atpA ATP synthase subunit alpha Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q65DX2 0 580 57 3 510 3 atpA ATP synthase subunit alpha Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8EM81 0 580 55 3 510 3 atpA ATP synthase subunit alpha Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8RC17 0 579 56 1 508 3 atpA ATP synthase subunit alpha Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7HJV9 0 579 56 3 510 3 atpA ATP synthase subunit alpha Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A5V3X3 0 578 57 3 518 3 atpA ATP synthase subunit alpha Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q0AUD1 0 577 56 3 512 3 atpA ATP synthase subunit alpha Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
A8GY42 0 577 56 3 515 3 atpA ATP synthase subunit alpha Rickettsia bellii (strain OSU 85-389)
B2A3G4 0 577 55 1 508 3 atpA ATP synthase subunit alpha Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B7IG42 0 577 56 2 510 3 atpA ATP synthase subunit alpha Thermosipho africanus (strain TCF52B)
B5YI22 0 576 55 2 510 3 atpA ATP synthase subunit alpha Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A8EV72 0 576 56 2 507 3 atpA ATP synthase subunit alpha Aliarcobacter butzleri (strain RM4018)
Q7MA20 0 575 54 1 506 3 atpA ATP synthase subunit alpha Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1VFJ3 0 575 55 1 508 3 atpA ATP synthase subunit alpha Nitratidesulfovibrio vulgaris (strain DP4)
Q72E02 0 575 55 1 508 1 atpA ATP synthase subunit alpha Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B2TJZ8 0 575 54 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Eklund 17B / Type B)
P29706 0 575 55 2 508 1 atpA ATP synthase subunit alpha, sodium ion specific Propionigenium modestum
B2UZJ8 0 575 54 1 508 3 atpA ATP synthase subunit alpha Clostridium botulinum (strain Alaska E43 / Type E3)
A5FZ52 0 575 55 3 519 3 atpA ATP synthase subunit alpha Acidiphilium cryptum (strain JF-5)
B0UE41 0 575 56 3 520 3 atpA ATP synthase subunit alpha Methylobacterium sp. (strain 4-46)
B9L1H1 0 574 55 2 510 3 atpA ATP synthase subunit alpha Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q1MRB9 0 574 54 1 510 3 atpA ATP synthase subunit alpha Lawsonia intracellularis (strain PHE/MN1-00)
Q3AUA7 0 574 55 3 513 3 atpA ATP synthase subunit alpha Chlorobium chlorochromatii (strain CaD3)
A5E948 0 574 56 4 520 3 atpA ATP synthase subunit alpha Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B2J058 0 573 58 2 504 3 atpA ATP synthase subunit alpha Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A4YKD8 0 573 56 4 520 3 atpA ATP synthase subunit alpha Bradyrhizobium sp. (strain ORS 278)
A8HS15 0 573 56 2 516 3 atpA ATP synthase subunit alpha Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B4RD45 0 573 57 5 517 3 atpA ATP synthase subunit alpha Phenylobacterium zucineum (strain HLK1)
B8IN03 0 573 56 3 515 3 atpA ATP synthase subunit alpha Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q1IIG6 0 573 55 1 507 3 atpA ATP synthase subunit alpha Koribacter versatilis (strain Ellin345)
Q3B1F4 0 572 55 3 513 3 atpA2 ATP synthase subunit alpha 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A9BFX5 0 571 54 3 511 3 atpA ATP synthase subunit alpha Petrotoga mobilis (strain DSM 10674 / SJ95)
Q0AKV8 0 571 56 5 518 3 atpA ATP synthase subunit alpha Maricaulis maris (strain MCS10)
B8J437 0 571 54 2 513 3 atpA ATP synthase subunit alpha Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8KAW8 0 571 55 3 512 3 atpA ATP synthase subunit alpha Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A9BCD9 0 571 56 2 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain MIT 9211)
Q0C0Z8 0 571 56 3 517 3 atpA ATP synthase subunit alpha Hyphomonas neptunium (strain ATCC 15444)
O66907 0 570 55 1 506 3 atpA ATP synthase subunit alpha Aquifex aeolicus (strain VF5)
Q5WB76 0 570 56 2 506 3 atpA ATP synthase subunit alpha Shouchella clausii (strain KSM-K16)
P05036 0 570 56 2 516 1 atpA ATP synthase subunit alpha Rhodospirillum rubrum
Q2RV20 0 570 56 2 516 3 atpA ATP synthase subunit alpha Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A1B8N8 0 570 57 5 521 1 atpA ATP synthase subunit alpha Paracoccus denitrificans (strain Pd 1222)
B9JTR4 0 570 56 3 514 3 atpA ATP synthase subunit alpha Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q318U1 0 570 56 1 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain MIT 9312)
B8EQP9 0 570 55 3 515 3 atpA ATP synthase subunit alpha Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q9K6H3 0 570 57 2 499 3 atpA ATP synthase subunit alpha Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1BJF5 0 570 55 2 512 3 atpA ATP synthase subunit alpha Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A9WWS4 0 570 55 3 515 3 atpA ATP synthase subunit alpha Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M839 0 570 55 3 515 3 atpA ATP synthase subunit alpha Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57B86 0 570 55 3 515 3 atpA ATP synthase subunit alpha Brucella abortus biovar 1 (strain 9-941)
Q2YLI5 0 570 55 3 515 3 atpA ATP synthase subunit alpha Brucella abortus (strain 2308)
B2S7M5 0 570 55 3 515 3 atpA ATP synthase subunit alpha Brucella abortus (strain S19)
Q2JSW1 0 569 57 1 504 3 atpA ATP synthase subunit alpha Synechococcus sp. (strain JA-3-3Ab)
Q8YJ37 0 569 55 3 515 3 atpA ATP synthase subunit alpha Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RF52 0 569 55 3 515 3 atpA ATP synthase subunit alpha Brucella melitensis biotype 2 (strain ATCC 23457)
B1I6J9 0 568 55 2 508 3 atpA ATP synthase subunit alpha Desulforudis audaxviator (strain MP104C)
Q180W8 0 568 56 2 508 3 atpA ATP synthase subunit alpha Clostridioides difficile (strain 630)
Q8FYR3 0 568 55 3 515 3 atpA ATP synthase subunit alpha Brucella suis biovar 1 (strain 1330)
Q2JIG0 0 568 57 1 502 3 atpA ATP synthase subunit alpha Synechococcus sp. (strain JA-2-3B'a(2-13))
A5VSE3 0 568 55 3 515 3 atpA ATP synthase subunit alpha Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A6WXW9 0 568 56 3 515 3 atpA ATP synthase subunit alpha Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B6JD06 0 568 55 2 519 3 atpA ATP synthase subunit alpha Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q5FRC7 0 568 56 4 516 3 atpA1 ATP synthase subunit alpha 1 Gluconobacter oxydans (strain 621H)
B4SGC7 0 567 55 2 509 3 atpA ATP synthase subunit alpha Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A0LDA2 0 567 56 2 505 3 atpA ATP synthase subunit alpha Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B4U989 0 567 54 1 510 3 atpA ATP synthase subunit alpha Hydrogenobaculum sp. (strain Y04AAS1)
Q7V037 0 567 55 1 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q7VA63 0 567 55 2 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8G6V1 0 566 55 2 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain MIT 9215)
Q3M9W0 0 566 57 2 504 3 atpA ATP synthase subunit alpha Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A3PET9 0 566 55 2 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain MIT 9301)
A8F006 0 566 55 3 515 3 atpA ATP synthase subunit alpha Rickettsia canadensis (strain McKiel)
C4KYS5 0 566 55 3 512 3 atpA ATP synthase subunit alpha Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
C3M9S3 0 565 55 3 518 3 atpA ATP synthase subunit alpha Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A2BT25 0 565 55 2 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain AS9601)
A8ZU99 0 565 54 1 507 3 atpA ATP synthase subunit alpha Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A7HT50 0 565 55 2 515 3 atpA ATP synthase subunit alpha Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
P37211 0 565 54 2 510 3 atp-1 ATP synthase subunit alpha, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7NCS3 0 565 56 2 514 3 atpA ATP synthase subunit alpha Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A4SGM9 0 565 55 3 513 3 atpA ATP synthase subunit alpha Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A2BYH6 0 565 55 1 504 3 atpA ATP synthase subunit alpha Prochlorococcus marinus (strain MIT 9515)
B2V6N6 0 564 54 2 512 3 atpA ATP synthase subunit alpha Sulfurihydrogenibium sp. (strain YO3AOP1)
Q13DP4 0 564 54 2 519 3 atpA ATP synthase subunit alpha Rhodopseudomonas palustris (strain BisB5)
P12405 0 564 57 2 504 3 atpA ATP synthase subunit alpha Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6G1W7 0 564 55 3 517 3 atpA ATP synthase subunit alpha Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1AVH7 0 564 54 2 510 3 atpA ATP synthase subunit alpha Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q92LK6 0 564 55 4 515 3 atpA ATP synthase subunit alpha Rhizobium meliloti (strain 1021)
B8FGT6 0 564 55 1 507 3 atpA ATP synthase subunit alpha Desulfatibacillum aliphaticivorans
P80021 0 563 56 3 513 1 ATP5F1A ATP synthase subunit alpha, mitochondrial Sus scrofa
A9H9A4 0 563 56 4 517 3 atpA ATP synthase subunit alpha Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B3EHU6 0 563 55 2 509 3 atpA ATP synthase subunit alpha Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A8FIB4 0 563 55 3 510 3 atpA ATP synthase subunit alpha Bacillus pumilus (strain SAFR-032)
A5UQN5 0 563 56 5 510 3 atpA ATP synthase subunit alpha Roseiflexus sp. (strain RS-1)
Q5KUJ1 0 563 55 3 510 1 atpA ATP synthase subunit alpha Geobacillus kaustophilus (strain HTA426)
P19483 0 563 56 3 513 1 ATP5F1A ATP synthase subunit alpha, mitochondrial Bos taurus
Q8Y4C0 0 563 54 2 510 3 atpA2 ATP synthase subunit alpha 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8HPK1 0 562 56 1 504 3 atpA ATP synthase subunit alpha Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q71WP7 0 562 54 2 510 3 atpA2 ATP synthase subunit alpha 2 Listeria monocytogenes serotype 4b (strain F2365)
Q927W2 0 562 54 2 510 3 atpA2 ATP synthase subunit alpha 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q98EV6 0 562 54 3 518 3 atpA ATP synthase subunit alpha Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A7GV58 0 562 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B1LVH1 0 561 54 3 515 3 atpA ATP synthase subunit alpha Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A7Z9Q2 0 561 55 3 509 3 atpA ATP synthase subunit alpha Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P22477 0 561 56 3 508 3 atpA ATP synthase subunit alpha Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
A6UDM3 0 561 55 3 515 3 atpA ATP synthase subunit alpha Sinorhizobium medicae (strain WSM419)
P15999 0 561 55 2 513 1 Atp5f1a ATP synthase subunit alpha, mitochondrial Rattus norvegicus
Q8UC74 0 561 55 3 520 3 atpA ATP synthase subunit alpha Agrobacterium fabrum (strain C58 / ATCC 33970)
Q21CY5 0 561 54 2 519 3 atpA ATP synthase subunit alpha Rhodopseudomonas palustris (strain BisB18)
Q2J3I2 0 561 54 2 519 3 atpA ATP synthase subunit alpha Rhodopseudomonas palustris (strain HaA2)
Q03265 0 561 55 2 513 1 Atp5f1a ATP synthase subunit alpha, mitochondrial Mus musculus
Q6HAX7 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630U1 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ZK / E33L)
B9IRT9 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain Q1)
B7HY67 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain AH187)
C1F0N0 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain 03BB102)
Q72XE6 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JGN2 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain AH820)
Q81JZ3 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus anthracis
A0RL97 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus thuringiensis (strain Al Hakam)
C3LFI1 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P1F6 0 561 55 3 508 3 atpA ATP synthase subunit alpha Bacillus anthracis (strain A0248)
Q6NDD0 0 560 54 2 519 3 atpA ATP synthase subunit alpha Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1MAZ0 0 560 54 3 520 3 atpA ATP synthase subunit alpha Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5R546 0 560 56 3 513 2 ATP5F1A ATP synthase subunit alpha, mitochondrial Pongo abelii
Q1QQS5 0 560 53 2 519 3 atpA ATP synthase subunit alpha Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q11DD7 0 560 55 2 515 3 atpA ATP synthase subunit alpha Chelativorans sp. (strain BNC1)
Q89X72 0 560 54 3 515 3 atpA ATP synthase subunit alpha Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q814W0 0 560 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK4 0 560 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain B4264)
Q2K3G8 0 560 55 4 515 3 atpA ATP synthase subunit alpha Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3SVJ4 0 560 54 3 519 3 atpA ATP synthase subunit alpha Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A5A6H5 0 560 56 3 513 2 ATP5F1A ATP synthase subunit alpha, mitochondrial Pan troglodytes
P25705 0 560 56 3 513 1 ATP5F1A ATP synthase subunit alpha, mitochondrial Homo sapiens
A4ITJ1 0 560 55 3 510 3 atpA ATP synthase subunit alpha Geobacillus thermodenitrificans (strain NG80-2)
C5D992 0 560 54 4 517 3 atpA ATP synthase subunit alpha Geobacillus sp. (strain WCH70)
B7IQW0 0 560 55 3 508 3 atpA ATP synthase subunit alpha Bacillus cereus (strain G9842)
B1ZEE9 0 559 54 3 515 3 atpA ATP synthase subunit alpha Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9IYX0 0 559 54 2 517 3 atpA ATP synthase subunit alpha Bartonella tribocorum (strain CIP 105476 / IBS 506)
A0ALL5 0 559 54 2 510 3 atpA2 ATP synthase subunit alpha 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B5ZSN9 0 559 54 4 520 3 atpA ATP synthase subunit alpha Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B2KEX0 0 559 53 2 511 3 atpA ATP synthase subunit alpha Elusimicrobium minutum (strain Pei191)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_15845
Feature type CDS
Gene atpA
Product F0F1 ATP synthase subunit alpha
Location 20678 - 22219 (strand: 1)
Length 1542 (nucleotides) / 513 (amino acids)

Contig

Accession ZDB_227
Length 79950 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2070
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00006 ATP synthase alpha/beta family, nucleotide-binding domain
PF00306 ATP synthase alpha/beta chain, C terminal domain
PF02874 ATP synthase alpha/beta family, beta-barrel domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0056 Energy production and conversion (C) C FoF1-type ATP synthase, alpha subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02111 F-type H+/Na+-transporting ATPase subunit alpha [EC:7.1.2.2 7.2.2.1] Oxidative phosphorylation
Photosynthesis
Metabolic pathways
F-type ATPase, prokaryotes and chloroplasts

Protein Sequence

MQLNSTEISELIKQRIAQFNVVSEAHNEGTIVSVNDGIIRIHGLAEVMQGEMISLPGNRYAIALNLERDSVGAVVMGPYADLAEGMKVKCTGRILEVPVGRGLLGRVVNTLGEPIDGKGQVEHDGFSPVEVIAPGVIDRQSVDQPVQTGYKSVDAMIPIGRGQRELIIGDRQTGKTALAIDAIINQRDSGIKCIYVAIGQKASTIANVVRKLEEHNALANTIVVVASASESAALQYLAPYSGCAMGEYFRDRGEDALIIYDDLSKQAVAYRQISLLLRRPPGREAYPGDVFYLHSRLLERAARVNAEYVEAFTKGEVKGKTGSLTALPIIETQAGDVSAFVPTNVISITDGQIFLESALFNAGIRPAVNPGISVSRVGGAAQTKIMKKLSGGIRTALAQYRELAAFSQFASDLDDATRKQLDHGQKVTELLKQKQYAPMSVAQQSLSLYAAERGYLEDIEISKVVPFEAALIGYATREHADLLKEIDQTGSYNDDIEAKLKNVLDTFKATQSW

Flanking regions ( +/- flanking 50bp)

CGACTCGAGCGTTTAACCGACGTCTTGCAGTCTTAAGGGGACTGGAGCATATGCAACTGAATTCCACCGAAATCAGCGAACTGATCAAGCAGCGCATTGCTCAGTTCAATGTCGTGAGTGAAGCTCACAACGAAGGTACGATTGTCTCCGTCAACGACGGTATCATTCGTATCCACGGTTTAGCCGAAGTTATGCAGGGTGAGATGATCTCTCTGCCGGGCAACCGTTATGCTATCGCACTGAACCTGGAGCGCGACTCTGTTGGTGCGGTTGTGATGGGTCCTTATGCCGACCTGGCAGAAGGCATGAAAGTCAAATGTACCGGTCGTATTCTGGAAGTGCCGGTTGGCCGTGGCCTGTTAGGCCGTGTGGTCAACACCCTGGGTGAGCCTATCGATGGTAAAGGCCAGGTTGAGCACGATGGTTTCTCACCTGTCGAAGTTATCGCACCGGGTGTTATCGACCGTCAGTCCGTTGATCAGCCTGTACAGACCGGTTATAAGTCTGTCGATGCGATGATTCCAATCGGCCGTGGTCAGCGTGAGCTGATTATCGGTGACCGTCAGACCGGTAAAACCGCACTGGCAATCGATGCAATCATCAACCAGCGTGATTCCGGCATCAAATGTATTTACGTCGCAATTGGTCAGAAAGCGTCCACTATTGCTAACGTTGTCCGTAAATTAGAAGAGCACAATGCGCTGGCCAACACGATTGTTGTGGTCGCGAGTGCGTCTGAATCTGCGGCACTGCAATACCTGGCACCGTATTCCGGTTGTGCTATGGGTGAATACTTCCGTGACCGCGGTGAAGACGCGTTAATCATTTATGATGACCTGTCAAAACAAGCGGTTGCTTACCGTCAGATCTCCCTGCTGCTCCGTCGTCCGCCCGGACGTGAAGCATATCCCGGTGACGTTTTCTATCTGCACTCCCGTCTGCTGGAACGTGCTGCGCGTGTTAACGCGGAATATGTGGAAGCGTTTACCAAGGGTGAAGTGAAAGGCAAAACCGGTTCTCTGACCGCGCTGCCAATCATCGAAACTCAGGCAGGGGACGTATCAGCGTTCGTTCCGACTAACGTTATCTCCATCACTGATGGTCAGATCTTCCTGGAATCCGCGCTGTTCAACGCCGGTATCCGTCCTGCGGTTAACCCGGGGATCTCCGTATCCCGTGTGGGTGGTGCAGCACAGACCAAGATCATGAAAAAACTGTCCGGTGGTATCCGTACCGCTCTGGCACAGTATCGTGAACTGGCGGCGTTCTCACAGTTCGCATCTGACCTTGATGATGCAACCCGTAAACAGCTTGACCACGGTCAGAAAGTTACCGAGTTGCTGAAACAGAAACAGTATGCACCAATGTCAGTGGCACAACAGTCTCTGTCACTGTATGCAGCTGAGCGTGGTTACCTGGAAGATATCGAAATTTCGAAAGTCGTGCCGTTTGAAGCTGCTCTGATTGGCTACGCCACTCGTGAACATGCTGATCTTCTGAAAGAAATCGACCAGACGGGTAGCTATAACGATGATATCGAAGCGAAGTTGAAAAACGTGCTCGATACCTTCAAGGCGACTCAGTCCTGGTAATACTAAACGGCCTGTGTGAACAGTACAGGCCGTCTGGTTCATGAGGAGAG