Homologs in group_1689

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11780 FBDBKF_11780 100.0 Morganella morganii S1 slyD peptidylprolyl isomerase
NLDBIP_15620 NLDBIP_15620 100.0 Morganella morganii S4 slyD peptidylprolyl isomerase
LHKJJB_14990 LHKJJB_14990 100.0 Morganella morganii S3 slyD peptidylprolyl isomerase
HKOGLL_19295 HKOGLL_19295 100.0 Morganella morganii S5 slyD peptidylprolyl isomerase
F4V73_RS14875 F4V73_RS14875 93.3 Morganella psychrotolerans slyD peptidylprolyl isomerase
PMI_RS13845 PMI_RS13845 86.0 Proteus mirabilis HI4320 slyD peptidylprolyl isomerase

Distribution of the homologs in the orthogroup group_1689

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1689

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9L2 7.33e-84 249 83 0 147 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Shigella flexneri
P0A9K9 7.33e-84 249 83 0 147 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Escherichia coli (strain K12)
P0A9L0 7.33e-84 249 83 0 147 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9L1 7.33e-84 249 83 0 147 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Escherichia coli O157:H7
Q7CFU4 5.66e-79 237 80 0 150 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Yersinia pestis
Q9CKP2 3.01e-76 230 63 3 198 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Pasteurella multocida (strain Pm70)
P44830 3.72e-71 217 69 0 154 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KNX6 1.43e-69 214 66 0 153 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O07046 7.98e-39 135 51 1 152 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Aeromonas hydrophila
O83369 9.11e-28 106 42 0 147 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Treponema pallidum (strain Nichols)
O25748 1.15e-18 82 34 3 139 1 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZK89 3.2e-17 79 33 3 143 3 slyD FKBP-type peptidyl-prolyl cis-trans isomerase SlyD Helicobacter pylori (strain J99 / ATCC 700824)
O52980 5.79e-16 75 40 2 112 1 None Short-type peptidyl-prolyl cis-trans isomerase Methanothermococcus thermolithotrophicus
P21863 4.51e-14 70 31 0 139 3 yaaD Probable FKBP-type 16 kDa peptidyl-prolyl cis-trans isomerase Pseudomonas fluorescens
Q57726 9.92e-14 69 37 2 116 3 MJ0278 Short-type peptidyl-prolyl cis-trans isomerase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0AEM3 4.82e-07 50 30 3 133 3 fkpB FKBP-type 16 kDa peptidyl-prolyl cis-trans isomerase Shigella flexneri
P0AEM0 4.82e-07 50 30 3 133 1 fkpB FKBP-type 16 kDa peptidyl-prolyl cis-trans isomerase Escherichia coli (strain K12)
P0AEM1 4.82e-07 50 30 3 133 3 fkpB FKBP-type 16 kDa peptidyl-prolyl cis-trans isomerase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEM2 4.82e-07 50 30 3 133 3 fkpB FKBP-type 16 kDa peptidyl-prolyl cis-trans isomerase Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14525
Feature type CDS
Gene slyD
Product peptidylprolyl isomerase
Location 127153 - 127782 (strand: 1)
Length 630 (nucleotides) / 209 (amino acids)

Contig

Accession ZDB_224
Length 134704 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1689
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00254 FKBP-type peptidyl-prolyl cis-trans isomerase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1047 Posttranslational modification, protein turnover, chaperones (O) O Peptidyl-prolyl cis-trans isomerase, FKBP type

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03775 FKBP-type peptidyl-prolyl cis-trans isomerase SlyD [EC:5.2.1.8] - -

Protein Sequence

MKVAKDLVVSLAYQVRTEDGVLVDESPASAPLDYLHGRGALISGLESALDGRVAGDVFDVDVGANDAYGQYDENLVQRVPKDVFVGVDELEVGMRFLADTDMGPVPVEITGIEGDEVIVDGNHMLAGQNLKFHVEVIGVREATAEELEHGHVHGEEGGCCGGHDHGEEGGCCGGGHGHDHDHGHEHGEGGCCGGGGHGKGHGNGGCGCH

Flanking regions ( +/- flanking 50bp)

ATCGGCGCGTTAATTAAAATCTTATCCCCCGCGGATGTGTAGGAGATACCATGAAAGTAGCAAAAGACCTGGTAGTGAGCCTGGCTTATCAGGTAAGAACAGAAGACGGTGTATTAGTTGATGAGTCTCCGGCAAGTGCTCCGTTAGACTATCTGCACGGTCGCGGCGCGCTGATCAGCGGGCTGGAAAGTGCACTGGACGGCCGTGTTGCCGGTGATGTGTTCGACGTTGATGTCGGCGCAAACGACGCTTACGGTCAGTATGACGAAAACCTGGTTCAGCGCGTACCGAAAGACGTTTTCGTCGGTGTTGATGAGCTGGAAGTCGGCATGCGTTTCCTGGCAGACACCGATATGGGTCCTGTGCCGGTTGAAATCACCGGTATCGAAGGTGACGAAGTGATCGTTGACGGCAACCATATGCTGGCCGGTCAGAACCTGAAATTCCACGTCGAAGTTATCGGTGTGCGTGAAGCAACAGCAGAAGAGCTGGAGCACGGTCACGTTCACGGTGAAGAAGGCGGCTGCTGCGGTGGTCACGACCACGGCGAAGAAGGCGGTTGCTGCGGCGGCGGTCACGGCCACGATCACGACCATGGTCACGAACACGGTGAAGGCGGCTGCTGCGGCGGTGGCGGTCACGGTAAAGGCCACGGTAACGGCGGCTGCGGTTGTCACTGATAACCCGCATCTGAACCGGACAAAAAAAGCGCATTCTGACGGATGCGCTT