Homologs in group_1708

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11900 FBDBKF_11900 100.0 Morganella morganii S1 mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB
NLDBIP_15500 NLDBIP_15500 100.0 Morganella morganii S4 mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB
LHKJJB_15110 LHKJJB_15110 100.0 Morganella morganii S3 mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB
HKOGLL_14230 HKOGLL_14230 100.0 Morganella morganii S5 mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB
F4V73_RS19520 F4V73_RS19520 86.7 Morganella psychrotolerans mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB
PMI_RS13990 PMI_RS13990 64.0 Proteus mirabilis HI4320 mobB molybdopterin-guanine dinucleotide biosynthesis protein MobB

Distribution of the homologs in the orthogroup group_1708

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1708

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8GLJ4 1.85e-71 224 54 0 194 3 mobA Molybdenum cofactor guanylyltransferase Serratia proteamaculans (strain 568)
B1JR17 4.58e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FCP0 4.58e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TSH1 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pestis (strain Pestoides F)
Q1CN57 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYH5 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJS4 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pestis
B2JYK0 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C231 5.5e-65 207 52 0 193 3 mobA Molybdenum cofactor guanylyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
P32125 1.35e-61 198 61 2 168 1 mobB Molybdopterin-guanine dinucleotide biosynthesis adapter protein Escherichia coli (strain K12)
P32173 1.88e-52 175 42 0 191 1 mobA Molybdenum cofactor guanylyltransferase Escherichia coli (strain K12)
P44899 4.49e-52 174 47 2 189 3 mobA Molybdenum cofactor guanylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZKU9 1.15e-51 173 43 0 187 3 mobA Molybdenum cofactor guanylyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4QM57 1.24e-51 173 47 2 189 3 mobA Molybdenum cofactor guanylyltransferase Haemophilus influenzae (strain 86-028NP)
P58221 4.96e-51 171 42 0 191 3 mobA Molybdenum cofactor guanylyltransferase Escherichia coli O157:H7
Q8FBH7 5.88e-51 171 42 0 191 3 mobA Molybdenum cofactor guanylyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z2R9 8.41e-50 168 42 0 187 3 mobA Molybdenum cofactor guanylyltransferase Salmonella typhi
B0UVP3 2.27e-49 167 45 1 192 3 mobA Molybdenum cofactor guanylyltransferase Histophilus somni (strain 2336)
Q0I1I3 1.29e-48 165 45 1 191 3 mobA Molybdenum cofactor guanylyltransferase Histophilus somni (strain 129Pt)
P57971 3.06e-47 161 47 1 186 3 mobA Molybdenum cofactor guanylyltransferase Pasteurella multocida (strain Pm70)
Q87PK5 1.2e-45 157 45 3 188 3 mobA Molybdenum cofactor guanylyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N0T3 1.2e-45 157 45 3 188 3 mobA Molybdenum cofactor guanylyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q9KRV8 6.02e-44 154 44 3 190 3 mobA Molybdenum cofactor guanylyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65QU6 1.31e-43 152 45 1 186 3 mobA Molybdenum cofactor guanylyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B7VNT9 3.24e-43 151 45 2 186 3 mobA Molybdenum cofactor guanylyltransferase Vibrio atlanticus (strain LGP32)
P44902 3.5e-43 150 47 4 167 1 mobB Molybdopterin-guanine dinucleotide biosynthesis adapter protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MKR2 1.98e-42 149 43 3 186 3 mobA Molybdenum cofactor guanylyltransferase Vibrio vulnificus (strain YJ016)
Q8D9M4 7.48e-42 148 43 3 186 3 mobA Molybdenum cofactor guanylyltransferase Vibrio vulnificus (strain CMCP6)
A4YCA5 2.17e-41 147 41 2 191 3 mobA Molybdenum cofactor guanylyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q6LQY0 3.7e-41 146 41 2 186 3 mobA Molybdenum cofactor guanylyltransferase Photobacterium profundum (strain SS9)
Q1LKK7 2.28e-39 142 42 3 196 3 mobA Molybdenum cofactor guanylyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q46YZ3 2.98e-39 141 44 4 192 3 mobA Molybdenum cofactor guanylyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B5FEE3 1.36e-38 139 40 2 186 3 mobA Molybdenum cofactor guanylyltransferase Aliivibrio fischeri (strain MJ11)
Q0K8K6 1.03e-37 137 41 3 194 3 mobA Molybdenum cofactor guanylyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7VY88 4.07e-37 135 42 3 192 3 mobA Molybdenum cofactor guanylyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B9MA54 7.28e-37 135 41 4 201 3 mobA Molybdenum cofactor guanylyltransferase Acidovorax ebreus (strain TPSY)
Q0HPK8 1.03e-36 134 39 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella sp. (strain MR-7)
Q5E4Z6 1.2e-36 134 39 2 186 3 mobA Molybdenum cofactor guanylyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1W6R1 1.21e-36 135 41 4 201 3 mobA Molybdenum cofactor guanylyltransferase Acidovorax sp. (strain JS42)
B3R5L0 1.31e-36 134 40 3 194 3 mobA Molybdenum cofactor guanylyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0HDC7 1.42e-36 134 39 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella sp. (strain MR-4)
B6EKR0 1.45e-36 134 40 2 186 3 mobA Molybdenum cofactor guanylyltransferase Aliivibrio salmonicida (strain LFI1238)
B2U956 5.1e-36 133 39 2 199 3 mobA Molybdenum cofactor guanylyltransferase Ralstonia pickettii (strain 12J)
A8FPG1 6.03e-36 132 38 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella sediminis (strain HAW-EB3)
B0TN10 9.55e-36 132 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella halifaxensis (strain HAW-EB4)
A0L2M8 9.76e-36 132 38 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella sp. (strain ANA-3)
B8CVC1 1.25e-35 132 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A2SIT7 1.85e-35 131 41 3 199 3 mobA Molybdenum cofactor guanylyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A8HA20 4.59e-35 130 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1KL44 1.67e-34 129 39 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q8E8E3 3.97e-34 127 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9KW43 1.15e-33 126 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella baltica (strain OS195)
A3CYQ1 1.15e-33 126 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDQ5 9.31e-33 124 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella baltica (strain OS223)
A6WUE5 1.21e-32 124 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella baltica (strain OS185)
A1RE29 2.2e-32 123 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella sp. (strain W3-18-1)
A9IFD9 2.27e-32 123 44 2 157 3 mobA Molybdenum cofactor guanylyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B1YVJ8 4.68e-32 122 42 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia ambifaria (strain MC40-6)
A3QJA4 5.09e-32 122 37 1 183 3 mobA Molybdenum cofactor guanylyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q39I98 5.77e-32 122 42 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BH30 7.11e-32 122 41 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q07W69 1.04e-31 121 37 2 185 3 mobA Molybdenum cofactor guanylyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q8Y0K5 1.3e-31 121 39 2 199 3 mobA Molybdenum cofactor guanylyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1JY88 4.12e-31 120 41 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia orbicola (strain MC0-3)
A4SVU3 4.75e-31 119 39 3 192 3 mobA Molybdenum cofactor guanylyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A1S1S7 9.31e-31 119 36 1 192 3 mobA Molybdenum cofactor guanylyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1BXW6 1.03e-30 119 40 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia orbicola (strain AU 1054)
A0K5T4 1.03e-30 119 40 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia cenocepacia (strain HI2424)
B1Y5U2 7.16e-30 116 41 3 194 3 mobA Molybdenum cofactor guanylyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A4JCN6 9.54e-29 114 40 4 192 3 mobA Molybdenum cofactor guanylyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1QIS8 3.79e-26 107 37 4 193 3 mobA Molybdenum cofactor guanylyltransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q21YF3 1.44e-24 102 35 4 203 3 mobA Molybdenum cofactor guanylyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A6V365 1.98e-24 102 40 2 176 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas aeruginosa (strain PA7)
O68799 2.75e-24 101 38 3 172 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PJ4 8.93e-24 100 38 3 172 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UXN9 8.93e-24 100 38 3 172 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas aeruginosa (strain LESB58)
Q133M2 4.62e-23 99 38 5 193 3 mobA Molybdenum cofactor guanylyltransferase Rhodopseudomonas palustris (strain BisB5)
P95645 1.88e-22 96 38 5 183 3 mobA Molybdenum cofactor guanylyltransferase Cereibacter sphaeroides
C3MDF9 2.38e-21 94 36 8 198 3 mobA Molybdenum cofactor guanylyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3IZX0 7.21e-21 92 37 5 183 3 mobA Molybdenum cofactor guanylyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PMC8 7.35e-21 92 37 5 183 3 mobA Molybdenum cofactor guanylyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B0KQW4 8.77e-21 92 39 1 148 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas putida (strain GB-1)
A4Z027 8.95e-21 92 35 5 200 3 mobA Molybdenum cofactor guanylyltransferase Bradyrhizobium sp. (strain ORS 278)
Q92PB2 1.2e-19 89 34 7 198 3 mobA Molybdenum cofactor guanylyltransferase Rhizobium meliloti (strain 1021)
P58747 1.23e-19 89 33 6 192 5 mobA Putative molybdenum cofactor guanylyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5W2U1 1.8e-19 88 39 2 151 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1KU57 5.02e-19 87 32 6 192 3 mobA Molybdenum cofactor guanylyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JUA5 6.65e-19 87 32 6 192 3 mobA Molybdenum cofactor guanylyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8G0X5 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella suis biovar 1 (strain 1330)
B0CLS9 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VQC8 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57DG4 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella abortus biovar 1 (strain 9-941)
Q2YNR6 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella abortus (strain 2308)
B2S5I0 9.88e-19 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella abortus (strain S19)
Q2IYY0 1.08e-18 87 36 4 190 3 mobA Molybdenum cofactor guanylyltransferase Rhodopseudomonas palustris (strain HaA2)
Q8YGY5 1.27e-18 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RIT3 1.27e-18 87 32 4 174 3 mobA Molybdenum cofactor guanylyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
Q98MK2 5.85e-18 84 32 4 192 3 mobA Molybdenum cofactor guanylyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8UEQ7 9.27e-18 84 33 6 189 3 mobA Molybdenum cofactor guanylyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q88HA3 9.42e-18 83 39 2 151 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3K955 1.13e-17 83 37 2 177 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q9WWW0 2.53e-17 82 38 2 149 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas putida
C3K7L4 6.64e-17 81 33 2 162 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas fluorescens (strain SBW25)
Q3ADR7 1.33e-16 80 28 4 195 3 mobA Probable molybdenum cofactor guanylyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9X7K0 1.94e-16 80 33 8 203 3 mobA Molybdenum cofactor guanylyltransferase Rhodobacter capsulatus
Q1I9D2 1.98e-16 80 33 3 183 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas entomophila (strain L48)
Q1MFQ6 1.37e-15 78 31 7 200 3 mobA Molybdenum cofactor guanylyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B5ZS84 1.39e-15 78 31 8 207 3 mobA Molybdenum cofactor guanylyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3A3H7 2.28e-15 77 30 6 195 3 mobA Molybdenum cofactor guanylyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q4ZUJ4 4e-15 76 32 1 162 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q883K6 1.24e-14 75 31 1 162 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9K8I9 1.76e-14 74 28 6 192 3 mobA Probable molybdenum cofactor guanylyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q11FK9 4.92e-14 73 33 4 191 3 mobA Molybdenum cofactor guanylyltransferase Chelativorans sp. (strain BNC1)
B7H9C3 5.06e-14 73 26 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain B4264)
Q48JU8 6.45e-14 73 30 2 168 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9WX94 1.38e-13 72 25 3 201 3 mobA Probable molybdenum cofactor guanylyltransferase Clostridium perfringens (strain 13 / Type A)
Q65K78 2.07e-13 71 31 7 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q816R1 4.35e-13 70 26 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A4XT41 6.92e-13 70 31 1 160 3 mobA Molybdenum cofactor guanylyltransferase Pseudomonas mendocina (strain ymp)
I3R636 8.42e-13 70 26 5 199 3 nasC Probable molybdenum cofactor guanylyltransferase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q0TPG4 1.33e-12 69 25 3 201 3 mobA Probable molybdenum cofactor guanylyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q58720 2.11e-12 69 30 3 119 3 mobB Putative molybdopterin-guanine dinucleotide biosynthesis adapter protein Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B7IL24 3.46e-12 68 25 5 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain G9842)
Q81KI4 3.74e-12 68 25 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus anthracis
C3LAZ5 3.74e-12 68 25 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCC0 3.74e-12 68 25 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus anthracis (strain A0248)
Q0SS30 3.97e-12 68 25 4 197 3 mobA Probable molybdenum cofactor guanylyltransferase Clostridium perfringens (strain SM101 / Type A)
B2I3G6 4.4e-12 68 26 2 187 3 mobA Molybdenum cofactor guanylyltransferase Acinetobacter baumannii (strain ACICU)
A3M684 4.7e-12 68 26 2 187 3 mobA Molybdenum cofactor guanylyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q6HCB8 6.3e-12 67 25 5 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9J1G5 6.3e-12 67 25 5 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain Q1)
B7HSV1 7.35e-12 67 24 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain AH187)
B7JT28 7.42e-12 67 24 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain AH820)
Q72YW2 1.34e-11 66 24 5 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q632S8 1.54e-11 66 24 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain ZK / E33L)
C1EW31 1.59e-11 66 24 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cereus (strain 03BB102)
A0RJZ5 1.59e-11 66 24 5 196 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus thuringiensis (strain Al Hakam)
A5FZ90 1.73e-11 66 30 3 172 3 mobA Molybdenum cofactor guanylyltransferase Acidiphilium cryptum (strain JF-5)
A9VLC2 2.67e-11 65 25 5 190 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus mycoides (strain KBAB4)
A7GU36 2.92e-11 65 24 5 193 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A5D369 6.07e-11 64 28 5 198 3 mobA Probable molybdenum cofactor guanylyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5FAX4 6.8e-11 64 21 6 193 3 mobA Probable molybdenum cofactor guanylyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B9JFZ4 7.26e-11 64 31 10 202 3 mobA Molybdenum cofactor guanylyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C5D754 1.23e-10 63 25 4 158 3 mobA Probable molybdenum cofactor guanylyltransferase Geobacillus sp. (strain WCH70)
Q3MFS2 2.15e-10 63 25 4 185 3 mobA Probable molybdenum cofactor guanylyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YY90 2.15e-10 63 25 6 187 3 mobA Probable molybdenum cofactor guanylyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q93SF3 2.21e-10 63 25 5 205 3 mobA Probable molybdenum cofactor guanylyltransferase Peptoclostridium acidaminophilum
A8FN28 2.48e-10 62 24 6 194 3 mobA Molybdenum cofactor guanylyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q3IRT2 2.86e-10 62 31 2 118 3 mobA Probable molybdenum cofactor guanylyltransferase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A1W0W6 8.47e-10 61 23 6 192 3 mobA Molybdenum cofactor guanylyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
B8G8K0 1.41e-09 60 31 8 193 3 mobA Probable molybdenum cofactor guanylyltransferase Chloroflexus aggregans (strain MD-66 / DSM 9485)
A8FCN9 1.54e-09 60 29 7 193 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus pumilus (strain SAFR-032)
Q5HT61 1.74e-09 60 23 6 192 3 mobA Molybdenum cofactor guanylyltransferase Campylobacter jejuni (strain RM1221)
Q9PMU9 1.74e-09 60 23 6 192 3 mobA Molybdenum cofactor guanylyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O31704 3.15e-09 58 29 2 126 3 mobB Probable molybdopterin-guanine dinucleotide biosynthesis adapter protein Bacillus subtilis (strain 168)
Q5N568 1.66e-08 57 25 6 187 3 mobA Probable molybdenum cofactor guanylyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O06866 1.66e-08 57 25 6 187 3 mobA Probable molybdenum cofactor guanylyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q59057 1.19e-07 55 23 6 206 3 mobA Probable molybdenum cofactor guanylyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A9A059 3.33e-07 53 25 4 195 3 mobA Molybdenum cofactor guanylyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C5A3C9 7.31e-07 52 27 8 185 3 mobA Probable molybdenum cofactor guanylyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q9RWM1 7.73e-07 52 28 5 193 3 mobA Probable molybdenum cofactor guanylyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q3BTU8 1.1e-06 52 30 9 183 3 mobA Molybdenum cofactor guanylyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
O26246 1.56e-06 51 31 5 122 3 mobA Probable molybdenum cofactor guanylyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8U354 3.34e-06 50 30 7 155 3 mobA Probable molybdenum cofactor guanylyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O31701 1.79e-05 48 28 7 189 3 mobA Probable molybdenum cofactor guanylyltransferase Bacillus subtilis (strain 168)
Q55370 5.14e-05 48 31 8 148 3 moaC/mobA Molybdenum cofactor biosynthesis bifunctional protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WJQ9 0.001 43 28 10 188 1 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJQ8 0.001 43 28 10 188 3 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5E9 0.001 43 28 10 188 3 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AES0 0.001 43 28 10 188 3 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLE9 0.001 43 28 10 188 3 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65403 0.001 43 28 10 188 3 mobA Probable molybdenum cofactor guanylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14405
Feature type CDS
Gene mobB
Product molybdopterin-guanine dinucleotide biosynthesis protein MobB
Location 102887 - 103984 (strand: -1)
Length 1098 (nucleotides) / 365 (amino acids)

Contig

Accession ZDB_224
Length 134704 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1708
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03205 Molybdopterin guanine dinucleotide synthesis protein B
PF12804 MobA-like NTP transferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1763 Coenzyme transport and metabolism (H) H Molybdopterin-guanine dinucleotide biosynthesis protein

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13818 molybdopterin-guanine dinucleotide biosynthesis protein [EC:2.7.7.77] Folate biosynthesis
Metabolic pathways		 -

Protein Sequence

MMMQLSGCILAGGRATRMQGQDKGLVLLGGIPLYQHSVKLLAPQTDDIFINANRNTQDYHATGLRVVADTLPDFPGPLAGMLAGLENALHDWVLFVPCDVPQFPADLAEKLWQQKGDALCAYACDHQRAHPAFALCHRSLITPLTEYLTGGDRKLLLFMDKIGAKAVTFDANPGDFINLNTLAECREWEKQHRLPHPVPLLAVTAYSGTGKTTLLKKLIPQLRESGLRIGLVKHTHHDMDVDTPGKDSYELRKAGAYQTLVVSQERFALMTETPGGAEPDLMQLAACFDTRELDLILVEGFKGESVPKIALFRDVTDRPYQTLLDEFVIAFASDKPRQDVTVPQLDINNITAIRDFIVSWLENNP

Flanking regions ( +/- flanking 50bp)

TGTTAAGATAAGTTCAGAATATTTATCAGAGATTGTCAGAGAAACTGAAAATGATGATGCAACTCAGCGGCTGTATTCTTGCCGGCGGCCGGGCCACCCGGATGCAGGGACAGGACAAAGGTCTGGTATTACTGGGCGGGATCCCGCTTTATCAGCACAGTGTAAAACTGCTCGCCCCGCAGACAGACGATATTTTTATCAATGCCAACCGCAATACGCAGGATTATCACGCCACCGGCCTGCGGGTGGTCGCCGATACATTACCGGATTTTCCGGGCCCGCTTGCCGGGATGCTCGCCGGTCTTGAAAATGCCCTGCACGACTGGGTGCTGTTCGTACCCTGTGATGTGCCGCAGTTCCCGGCGGATCTGGCAGAAAAACTCTGGCAGCAGAAAGGTGATGCCCTGTGCGCTTATGCCTGTGATCACCAGCGGGCGCATCCGGCCTTTGCGCTGTGTCACCGCTCGCTGATCACGCCGCTGACAGAGTATCTTACCGGCGGCGATCGCAAACTTCTGCTGTTTATGGATAAAATCGGCGCCAAAGCCGTCACATTTGATGCAAATCCCGGTGATTTTATTAATCTCAATACCCTCGCGGAGTGCCGGGAATGGGAAAAACAGCACCGGCTGCCGCACCCGGTACCGCTGCTGGCCGTCACCGCCTACAGCGGCACCGGCAAAACCACACTGCTGAAAAAGCTGATCCCGCAGTTACGGGAAAGCGGGCTGCGCATCGGCCTGGTCAAACACACGCATCATGATATGGATGTGGACACCCCGGGGAAAGACAGCTACGAGCTGCGTAAAGCTGGTGCTTATCAGACTCTGGTGGTCAGTCAGGAGCGGTTTGCACTGATGACAGAAACCCCGGGCGGCGCGGAGCCTGATCTGATGCAGCTGGCTGCCTGCTTTGATACACGGGAGCTGGATCTTATCCTGGTGGAAGGGTTCAAGGGGGAATCCGTACCGAAAATCGCCCTGTTCCGCGATGTGACTGACCGTCCGTATCAGACACTGCTGGATGAATTTGTTATTGCGTTTGCGTCAGATAAGCCACGGCAGGATGTCACTGTGCCGCAGCTGGATATCAACAATATCACTGCCATCCGCGACTTTATTGTCAGCTGGCTGGAAAATAATCCGTAATCGTCACTCATATCGGGCCTGACATAAAATCATGTTACCCGGCCCGATAT