Homologs in group_1801

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12265 FBDBKF_12265 100.0 Morganella morganii S1 zapB Cell division protein ZapB, interacts with FtsZ
NLDBIP_15135 NLDBIP_15135 100.0 Morganella morganii S4 zapB Cell division protein ZapB, interacts with FtsZ
LHKJJB_15475 LHKJJB_15475 100.0 Morganella morganii S3 zapB Cell division protein ZapB, interacts with FtsZ
HKOGLL_14595 HKOGLL_14595 100.0 Morganella morganii S5 zapB Cell division protein ZapB, interacts with FtsZ
F4V73_RS17095 F4V73_RS17095 90.0 Morganella psychrotolerans zapB cell division protein ZapB
PMI_RS15885 PMI_RS15885 80.0 Proteus mirabilis HI4320 zapB cell division protein ZapB

Distribution of the homologs in the orthogroup group_1801

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1801

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6CZ88 1.83e-40 130 83 0 79 3 zapB Cell division protein ZapB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JQ83 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G93 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TS94 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pestis (strain Pestoides F)
Q1CD47 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6B7 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pestis bv. Antiqua (strain Angola)
Q7CLC9 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pestis
B2JZB8 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2B1 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCX5 5.79e-40 129 82 0 79 3 zapB Cell division protein ZapB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q7MYB8 1.39e-39 128 81 0 80 3 zapB Cell division protein ZapB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DHM3 1.41e-39 128 82 0 79 3 zapB Cell division protein ZapB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JI05 1.61e-39 128 82 0 79 3 zapB Cell division protein ZapB Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B4F168 3.27e-39 127 80 0 80 3 zapB Cell division protein ZapB Proteus mirabilis (strain HI4320)
C5BB78 6.97e-39 126 82 0 79 3 zapB Cell division protein ZapB Edwardsiella ictaluri (strain 93-146)
B2VES1 2.4e-37 122 78 0 79 3 zapB Cell division protein ZapB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8GL99 4.74e-37 122 77 0 79 3 zapB Cell division protein ZapB Serratia proteamaculans (strain 568)
Q2NQX9 7.05e-36 119 78 0 79 3 zapB Cell division protein ZapB Sodalis glossinidius (strain morsitans)
A7ML67 6.12e-35 116 73 0 79 3 zapB Cell division protein ZapB Cronobacter sakazakii (strain ATCC BAA-894)
Q3YV50 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella sonnei (strain Ss046)
P0AF39 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella flexneri
Q0SY61 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella flexneri serotype 5b (strain 8401)
Q32A94 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella dysenteriae serotype 1 (strain Sd197)
Q31U62 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella boydii serotype 4 (strain Sb227)
B7LUS6 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R3Z0 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain UTI89 / UPEC)
B1LNN1 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain SMS-3-5 / SECEC)
B7NFM5 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AF36 1.58e-34 115 74 0 79 1 zapB Cell division protein ZapB Escherichia coli (strain K12)
P0AF37 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAD6 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A734 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O9:H4 (strain HS)
B1XB94 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain K12 / DH10B)
C5A095 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6X9 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O8 (strain IAI1)
B7N2R9 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O81 (strain ED1a)
B7NU79 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P0AF38 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O157:H7
B7LA21 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain 55989 / EAEC)
B7MI60 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UNP8 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZUE3 1.58e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TWC4 1.59e-34 115 74 0 79 3 zapB Cell division protein ZapB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I4S1 1.59e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain SE11)
B1IVF1 1.59e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5YZ66 1.59e-34 115 74 0 79 3 zapB Cell division protein ZapB Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8ZKP1 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPU9 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella schwarzengrund (strain CVM19633)
B5BJK5 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella paratyphi A (strain AKU_12601)
C0Q438 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella paratyphi C (strain RKS4594)
A9MZH7 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIS1 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0T4 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella newport (strain SL254)
B4TCM4 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella heidelberg (strain SL476)
B5RF83 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXL7 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella enteritidis PT4 (strain P125109)
B5FPT6 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella dublin (strain CT_02021853)
Q57HC9 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella choleraesuis (strain SC-B67)
B5F0R9 3.96e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella agona (strain SL483)
A6TFR0 6.86e-34 114 73 0 79 3 zapB Cell division protein ZapB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MI38 7.56e-34 114 73 0 79 3 zapB Cell division protein ZapB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z2Y8 1.59e-33 113 73 0 79 3 zapB Cell division protein ZapB Salmonella typhi
B5XTD6 3.02e-33 112 72 0 79 3 zapB Cell division protein ZapB Klebsiella pneumoniae (strain 342)
A8AKZ7 8.19e-33 111 70 0 79 3 zapB Cell division protein ZapB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WG70 5.17e-32 109 69 0 79 3 zapB Cell division protein ZapB Enterobacter sp. (strain 638)
C3LSB5 6.78e-27 96 60 0 80 3 zapB Cell division protein ZapB Vibrio cholerae serotype O1 (strain M66-2)
Q9KNP5 6.78e-27 96 60 0 80 3 zapB Cell division protein ZapB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4W4 6.78e-27 96 60 0 80 3 zapB Cell division protein ZapB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MH53 1.38e-25 93 60 0 80 3 zapB Cell division protein ZapB Vibrio vulnificus (strain YJ016)
Q8DCP7 1.38e-25 93 60 0 80 3 zapB Cell division protein ZapB Vibrio vulnificus (strain CMCP6)
Q6LVI6 1.39e-25 93 57 0 80 3 zapB Cell division protein ZapB Photobacterium profundum (strain SS9)
A7MWJ1 1.09e-24 90 57 0 80 3 zapB Cell division protein ZapB Vibrio campbellii (strain ATCC BAA-1116)
B7VLN0 3.39e-23 87 52 0 80 3 zapB Cell division protein ZapB Vibrio atlanticus (strain LGP32)
Q9CKW8 2.45e-21 82 54 1 79 3 zapB Cell division protein ZapB Pasteurella multocida (strain Pm70)
Q5E8E1 4.16e-21 81 51 0 80 3 zapB Cell division protein ZapB Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EPL9 1.31e-20 80 50 0 80 3 zapB Cell division protein ZapB Aliivibrio salmonicida (strain LFI1238)
A0KER2 2.02e-20 79 55 1 77 3 zapB Cell division protein ZapB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VLH3 1.44e-19 77 51 1 79 3 zapB Cell division protein ZapB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q65QA0 2.6e-19 77 51 1 79 3 zapB Cell division protein ZapB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VLC4 9.48e-19 75 50 1 79 3 zapB Cell division protein ZapB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4LBS8 2.68e-18 74 50 1 79 3 zapB Cell division protein ZapB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0UWH5 3.73e-18 73 50 2 79 3 zapB Cell division protein ZapB Histophilus somni (strain 2336)
Q0I5W2 3.73e-18 73 50 2 79 3 zapB Cell division protein ZapB Histophilus somni (strain 129Pt)
P44812 4.16e-18 73 49 1 79 1 zapB Cell division protein ZapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHF7 4.16e-18 73 49 1 79 3 zapB Cell division protein ZapB Haemophilus influenzae (strain PittGG)
A5UE63 4.16e-18 73 49 1 79 3 zapB Cell division protein ZapB Haemophilus influenzae (strain PittEE)
Q4QMP8 4.16e-18 73 49 1 79 3 zapB Cell division protein ZapB Haemophilus influenzae (strain 86-028NP)
A4STA4 8.82e-18 73 51 1 77 3 zapB Cell division protein ZapB Aeromonas salmonicida (strain A449)
Q87T24 2.24e-17 72 57 0 80 3 zapB Cell division protein ZapB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B3H152 3.12e-17 71 46 1 79 3 zapB Cell division protein ZapB Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZY9 3.12e-17 71 46 1 79 3 zapB Cell division protein ZapB Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C4K415 4.38e-16 68 45 0 79 3 zapB Cell division protein ZapB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A1SZR9 1.02e-12 60 42 2 80 3 zapB Cell division protein ZapB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1QT72 2.47e-09 51 38 1 80 3 zapB Cell division protein ZapB Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q088P1 5.49e-07 45 32 1 78 3 zapB Cell division protein ZapB Shewanella frigidimarina (strain NCIMB 400)
A3Q9J1 0.000108 39 37 1 78 3 zapB Cell division protein ZapB Shewanella loihica (strain ATCC BAA-1088 / PV-4)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_14040
Feature type CDS
Gene zapB
Product Cell division protein ZapB, interacts with FtsZ
Location 20771 - 21013 (strand: 1)
Length 243 (nucleotides) / 80 (amino acids)
In genomic island -

Contig

Accession ZDB_224
Length 134704 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1801
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06005 Cell division protein ZapB

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3074 Cell cycle control, cell division, chromosome partitioning (D) D Cell division protein ZapB, interacts with FtsZ

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09892 cell division protein ZapB - -

Protein Sequence

MSFEVFEKLEAKVQQAIDTITLLQMEIDELKETNNNLNREVQNAAGARESLVRENEQLKQEQAGWQERLRALLGKMDDVQ

Flanking regions ( +/- flanking 50bp)

TTGATAACACCTACTTACAATCAGAGCATCGCTTACAAGGAGGACGCAAGATGTCATTTGAAGTATTTGAAAAGCTGGAAGCAAAAGTCCAGCAGGCTATCGACACCATCACCCTGTTACAGATGGAAATCGACGAATTAAAAGAAACGAACAACAACCTGAACCGCGAAGTGCAGAATGCAGCCGGTGCCCGTGAGTCACTGGTGCGTGAAAACGAGCAGCTGAAGCAGGAACAGGCAGGCTGGCAGGAGCGTCTGCGGGCGTTACTGGGTAAGATGGACGACGTCCAGTAATTACGCGTCATCCTTCGTCCTGTGGCTGTGTTGGTTTCGCTCAGCTCCCC