Homologs in group_3273

Help

4 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07710 FBDBKF_07710 100.0 Morganella morganii S1 mntH Nramp family divalent metal transporter
NLDBIP_13985 NLDBIP_13985 100.0 Morganella morganii S4 mntH Nramp family divalent metal transporter
LHKJJB_08865 LHKJJB_08865 100.0 Morganella morganii S3 mntH Nramp family divalent metal transporter
HKOGLL_08415 HKOGLL_08415 100.0 Morganella morganii S5 mntH Nramp family divalent metal transporter

Distribution of the homologs in the orthogroup group_3273

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3273

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q38UX8 0.0 533 63 3 441 3 mntH Divalent metal cation transporter MntH Latilactobacillus sakei subsp. sakei (strain 23K)
Q2YX69 6.85e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A166 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain MW2)
Q6GAA9 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain MSSA476)
Q99UZ7 8.52e-176 503 59 2 441 1 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain N315)
A6QFW1 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain Newman)
Q5HGX9 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain COL)
A5IRZ2 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain JH9)
Q2G2G3 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHX5 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain USA300)
A6U0S3 8.52e-176 503 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain JH1)
Q931T9 3.48e-175 501 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X111 3.48e-175 501 59 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5HQ64 2.94e-170 488 58 2 440 3 mntH Divalent metal cation transporter MntH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GHY0 3.93e-170 488 58 2 441 3 mntH Divalent metal cation transporter MntH Staphylococcus aureus (strain MRSA252)
Q8CPM6 1.35e-169 487 58 2 440 3 mntH Divalent metal cation transporter MntH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4L5B9 2.02e-169 486 56 2 442 3 mntH Divalent metal cation transporter MntH Staphylococcus haemolyticus (strain JCSC1435)
Q49WM9 9.74e-168 482 60 2 419 3 mntH Divalent metal cation transporter MntH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B3W6P3 2.4e-166 479 57 3 445 3 mntH Divalent metal cation transporter MntH Lacticaseibacillus casei (strain BL23)
Q03D26 4.37e-165 476 57 3 445 3 mntH Divalent metal cation transporter MntH Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03TH5 1.38e-164 474 60 3 422 3 mntH Divalent metal cation transporter MntH Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q93V04 3.49e-163 471 56 3 442 2 mntH Divalent metal cation transporter MntH Levilactobacillus brevis
Q03DK0 2.98e-161 465 62 5 413 3 mntH Divalent metal cation transporter MntH Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8GH68 3.85e-153 446 59 5 413 3 mntH Divalent metal cation transporter MntH Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q92BT1 1.1e-138 408 52 7 440 3 mntH Divalent metal cation transporter MntH Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AIM7 1.83e-138 407 52 7 440 3 mntH Divalent metal cation transporter MntH Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y773 2.91e-138 407 51 7 440 3 mntH Divalent metal cation transporter MntH Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DE85 2.91e-138 407 51 7 440 3 mntH Divalent metal cation transporter MntH Listeria monocytogenes serotype 4a (strain HCC23)
Q71ZP6 2.91e-138 407 51 7 440 3 mntH Divalent metal cation transporter MntH Listeria monocytogenes serotype 4b (strain F2365)
C1L2Y0 2.91e-138 407 51 7 440 3 mntH Divalent metal cation transporter MntH Listeria monocytogenes serotype 4b (strain CLIP80459)
Q89K67 1.64e-131 390 51 7 439 3 mntH Divalent metal cation transporter MntH Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q98I99 1.7e-129 385 48 7 440 3 mntH Divalent metal cation transporter MntH Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8ZSB0 4.61e-127 378 46 8 442 3 mntH Divalent metal cation transporter MntH Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8PKX1 9.84e-121 362 49 6 432 3 mntH Divalent metal cation transporter MntH Xanthomonas axonopodis pv. citri (strain 306)
P65545 2.58e-119 359 47 6 439 3 mntH Divalent metal cation transporter MntH Brucella suis biovar 1 (strain 1330)
P65544 2.58e-119 359 47 6 439 3 mntH Divalent metal cation transporter MntH Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8P8R8 1.14e-117 354 49 6 440 3 mntH Divalent metal cation transporter MntH Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8UEM1 1.87e-117 354 45 6 445 3 mntH Divalent metal cation transporter MntH Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9RPF2 1.67e-109 333 49 5 445 3 mntH2 Divalent metal cation transporter MntH 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9PEL3 2.47e-105 323 47 7 440 3 mntH Divalent metal cation transporter MntH Xylella fastidiosa (strain 9a5c)
Q8XSF6 2.48e-104 320 44 5 419 3 mntH Divalent metal cation transporter MntH Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q87EJ9 4.96e-104 320 47 7 440 3 mntH Divalent metal cation transporter MntH Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9RPF3 2.56e-101 312 44 8 412 3 mntH1 Divalent metal cation transporter MntH 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q553K4 3.84e-93 297 43 10 413 3 nramp2 Natural resistance-associated macrophage protein 2 homolog Dictyostelium discoideum
Q9SAH8 1.79e-90 287 41 10 432 1 NRAMP1 Metal transporter Nramp1 Arabidopsis thaliana
Q9S9N8 5.66e-90 286 41 7 420 2 NRAMP6 Metal transporter Nramp6 Arabidopsis thaliana
B9N9Y7 2.77e-88 282 41 10 415 3 NRAMP1 Metal transporter Nramp1 Populus trichocarpa
Q869V1 2.9e-86 276 41 10 402 2 nramp1 Metal transporter nramp1 homolog Dictyostelium discoideum
Q9RTP8 7.05e-85 270 39 8 423 1 mntH Divalent metal cation transporter MntH Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q653V6 1.3e-84 273 41 7 399 2 NRAMP3 Metal transporter Nramp3 Oryza sativa subsp. japonica
P49279 3.16e-80 261 36 9 454 1 SLC11A1 Natural resistance-associated macrophage protein 1 Homo sapiens
Q10Q65 3.25e-80 260 38 8 435 2 NRAMP2 Metal transporter Nramp2 Oryza sativa subsp. japonica
P41251 6.41e-79 258 36 11 454 1 Slc11a1 Natural resistance-associated macrophage protein 1 Mus musculus
Q0BW85 7.79e-79 254 36 8 430 3 mntH Divalent metal cation transporter MntH Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9SNV9 8.75e-79 256 35 6 448 1 NRAMP3 Metal transporter Nramp3 Arabidopsis thaliana
P49283 1.03e-78 258 36 11 446 2 Mvl Protein Malvolio Drosophila melanogaster
P56436 1.69e-78 256 36 12 455 2 SLC11A1 Natural resistance-associated macrophage protein 1 Cervus elaphus
O77741 1.81e-78 256 37 10 438 2 SLC11A1 Natural resistance-associated macrophage protein 1 Sus scrofa
Q27946 4.38e-78 255 36 12 455 2 SLC11A1 Natural resistance-associated macrophage protein 1 Bubalus bubalis
Q27981 5.53e-78 255 36 12 455 2 SLC11A1 Natural resistance-associated macrophage protein 1 Bos taurus
P49280 6.7e-78 255 36 10 454 2 SLC11A1 Natural resistance-associated macrophage protein 1 Ovis aries
Q8R7S2 7.63e-78 251 39 9 403 3 mntH Divalent metal cation transporter MntH Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9FN18 9.82e-78 253 36 6 394 2 NRAMP4 Metal transporter Nramp4 Arabidopsis thaliana
Q95102 1.29e-77 254 36 12 455 2 SLC11A1 Natural resistance-associated macrophage protein 1 Bison bison
Q0B8F7 6.19e-77 249 36 11 449 3 mntH Divalent metal cation transporter MntH Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
P96593 1.52e-76 248 36 8 426 1 mntH Divalent metal cation transporter MntH Bacillus subtilis (strain 168)
A1WR47 4.51e-76 247 36 7 420 3 mntH Divalent metal cation transporter MntH Verminephrobacter eiseniae (strain EF01-2)
Q21433 4.78e-76 250 35 8 417 1 smf-2 NRAMP-like transporter smf-2 Caenorhabditis elegans
P49282 5.21e-76 251 39 9 417 1 Slc11a2 Natural resistance-associated macrophage protein 2 Mus musculus
O54902 1.34e-75 249 38 9 417 1 Slc11a2 Natural resistance-associated macrophage protein 2 Rattus norvegicus
Q9XT74 1.43e-75 249 34 9 465 2 SLC11A1 Natural resistance-associated macrophage protein 1 Canis lupus familiaris
A0A2K2BF92 3.71e-75 248 38 10 427 3 NRAMP6.1 Metal transporter Nramp6.1 Populus trichocarpa
Q2QN30 5.69e-75 247 35 8 442 2 NRAMP6 Metal transporter Nramp6 Oryza sativa subsp. japonica
A0A2K1ZPK4 1.37e-74 245 36 7 432 1 NRAMP3.2 Metal transporter Nramp3.2 Populus trichocarpa
Q6ZG85 8.12e-74 244 36 8 416 2 NRAT1 Metal transporter NRAT1 Oryza sativa subsp. japonica
Q9C6B2 1.38e-73 243 35 7 431 2 NRAMP2 Metal transporter Nramp2 Arabidopsis thaliana
Q95XG8 1.44e-73 244 35 9 450 1 smf-3 NRAMP-like transporter smf-3 Caenorhabditis elegans
Q1QZ83 6.86e-73 238 37 8 413 3 mntH Divalent metal cation transporter MntH Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B9NAE4 9.03e-73 240 37 5 395 1 NRAMP3.1 Metal transporter Nramp3.1 Populus trichocarpa
P51027 1.86e-72 241 35 10 447 2 SLC11A1 Natural resistance-associated macrophage protein 1 Gallus gallus
Q12078 2.48e-72 238 39 9 411 1 SMF3 Iron transporter SMF3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P49281 3.42e-72 241 37 9 440 1 SLC11A2 Natural resistance-associated macrophage protein 2 Homo sapiens
P38925 1.25e-71 239 35 12 444 1 SMF1 Manganese transporter SMF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q10177 1.31e-71 238 36 8 421 1 pdt1 Manganese transporter pdt1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B9GNS0 3.37e-71 237 35 7 433 3 NRAMP2 Metal transporter Nramp2 Populus trichocarpa
B1JFZ6 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668N2 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMF6 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pestis (strain Pestoides F)
Q1CJV0 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCK2 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pestis
B2K911 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5Y6 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGC8 3.7e-71 233 34 9 421 3 mntH Divalent metal cation transporter MntH Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
U5GKY6 1.43e-70 236 37 8 408 3 NRAMP6.2 Metal transporter Nramp6.2 Populus trichocarpa
Q9SN36 1.64e-70 235 35 6 393 2 NRAMP5 Metal transporter Nramp5 Arabidopsis thaliana
B9H7I1 4.09e-70 234 35 10 427 3 NRAMP7.2 Metal transporter Nramp7.2 Populus trichocarpa
Q21434 6.59e-70 234 33 10 454 1 smf-1 NRAMP-like transporter smf-1 Caenorhabditis elegans
Q97TN5 7.5e-70 231 36 8 403 3 mntH Divalent metal cation transporter MntH Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A4WD10 1.24e-69 229 33 8 433 3 mntH Divalent metal cation transporter MntH Enterobacter sp. (strain 638)
A1JLC3 2.36e-69 229 34 9 412 3 mntH Divalent metal cation transporter MntH Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0T2A8 3.49e-69 228 33 8 420 3 mntH Divalent metal cation transporter MntH Shigella flexneri serotype 5b (strain 8401)
P38778 4.85e-69 232 37 9 426 1 SMF2 Manganese transporter SMF2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C6D9J9 4.17e-68 226 34 9 412 3 mntH Divalent metal cation transporter MntH Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5XVU3 7.44e-68 225 33 8 427 3 mntH Divalent metal cation transporter MntH Klebsiella pneumoniae (strain 342)
Q492G8 2.64e-67 223 34 8 421 3 mntH Divalent metal cation transporter MntH Blochmanniella pennsylvanica (strain BPEN)
A8ADJ8 4.46e-67 223 32 9 434 3 mntH Divalent metal cation transporter MntH Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TC38 4.63e-67 223 33 8 427 3 mntH Divalent metal cation transporter MntH Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8H4H5 1.15e-66 225 37 9 409 2 NRAMP5 Metal transporter Nramp5 Oryza sativa subsp. japonica
Q0D7E4 1.38e-66 224 37 10 407 2 NRAMP1 Metal transporter Nramp1 Oryza sativa subsp. japonica
Q3YZE0 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Shigella sonnei (strain Ss046)
Q31Y80 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Shigella boydii serotype 4 (strain Sb227)
B2TWY8 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LL85 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R8X4 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain UTI89 / UPEC)
B1LMI9 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain SMS-3-5 / SECEC)
B6I6U2 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain SE11)
B7N5Z2 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A769 1.42e-66 221 33 8 420 1 mntH Divalent metal cation transporter MntH Escherichia coli (strain K12)
B1IX71 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A770 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TF69 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADR7 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O1:K1 / APEC
B1X9R3 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain K12 / DH10B)
C4ZVS8 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6R1 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O8 (strain IAI1)
B7MY49 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O81 (strain ED1a)
B7NPS9 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YZU5 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A771 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O157:H7
B7LCE3 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli (strain 55989 / EAEC)
B7MH51 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPK2 1.42e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8Z4X5 1.54e-66 221 32 8 420 3 mntH Divalent metal cation transporter MntH Salmonella typhi
B4TQE4 1.54e-66 221 32 8 420 3 mntH Divalent metal cation transporter MntH Salmonella schwarzengrund (strain CVM19633)
B5BB80 1.54e-66 221 32 8 420 3 mntH Divalent metal cation transporter MntH Salmonella paratyphi A (strain AKU_12601)
Q5PNF0 1.54e-66 221 32 8 420 3 mntH Divalent metal cation transporter MntH Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7UGA0 1.72e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q9RPF4 1.77e-66 221 33 8 420 1 mntH Divalent metal cation transporter MntH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PZC8 1.77e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Salmonella paratyphi C (strain RKS4594)
Q57LU5 1.77e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Salmonella choleraesuis (strain SC-B67)
A7N307 1.94e-66 221 34 13 443 3 mntH Divalent metal cation transporter MntH Vibrio campbellii (strain ATCC BAA-1116)
A8A2P6 2.34e-66 221 33 7 419 3 mntH Divalent metal cation transporter MntH Escherichia coli O9:H4 (strain HS)
B5RCN6 3.14e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3U1 3.14e-66 221 33 8 420 3 mntH Divalent metal cation transporter MntH Salmonella enteritidis PT4 (strain P125109)
B2VDY7 6.06e-66 220 36 13 418 3 mntH Divalent metal cation transporter MntH Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q32DF6 9.12e-66 219 33 8 420 3 mntH Divalent metal cation transporter MntH Shigella dysenteriae serotype 1 (strain Sd197)
A7MP48 1.19e-65 219 32 8 420 3 mntH Divalent metal cation transporter MntH Cronobacter sakazakii (strain ATCC BAA-894)
A5G348 5.85e-65 218 34 9 449 3 mntH Divalent metal cation transporter MntH Acidiphilium cryptum (strain JF-5)
A0A2K2AIF4 1.06e-64 221 34 13 461 3 NRAMP7.1 Metal transporter Nramp7.1 Populus trichocarpa
P70553 9.13e-63 214 36 11 402 2 Slc11a1 Natural resistance-associated macrophage protein 1 Rattus norvegicus
P9WIZ5 1.14e-58 201 34 8 413 1 mntH Divalent metal cation transporter MntH Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIZ4 1.14e-58 201 34 8 413 3 mntH Divalent metal cation transporter MntH Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0KG66 1.41e-57 198 33 9 403 3 mntH Divalent metal cation transporter MntH Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O69443 2.78e-56 201 33 8 413 3 mntH Divalent metal cation transporter MntH Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q50103 5.13e-46 167 30 7 412 3 mntH Divalent metal cation transporter MntH Mycobacterium leprae (strain TN)
Q5QN13 7.99e-45 167 29 8 420 2 NRAMP4 Metal transporter Nramp4 Oryza sativa subsp. japonica
A0A2K2A1B1 3.38e-44 169 29 9 403 3 EIN2.2 Ethylene-insensitive protein 2.2 Populus trichocarpa
Q9S814 1.02e-41 162 30 11 438 1 EIN2 Ethylene-insensitive protein 2 Arabidopsis thaliana
A0A3N7G677 3.05e-41 160 29 9 403 3 EIN2.1 Ethylene-insensitive protein 2.1 Populus trichocarpa
Q0D8I9 1.14e-22 105 26 11 394 2 EIN2 Protein ETHYLENE-INSENSITIVE 2 Oryza sativa subsp. japonica

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_13540
Feature type CDS
Gene mntH
Product Nramp family divalent metal transporter
Location 34215 - 35573 (strand: -1)
Length 1359 (nucleotides) / 452 (amino acids)

Contig

Accession ZDB_223
Length 138954 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3273
Orthogroup size 5
N. genomes 5

Actions

Genomic region

Domains

PF01566 Natural resistance-associated macrophage protein-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1914 Inorganic ion transport and metabolism (P) P Mn2+ or Fe2+ transporter, NRAMP family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03322 manganese transport protein - -

Protein Sequence

MLNTPQLSLAEINNTVPVAGAKSGFLRKLFAFSGPGALVAVGYMDPGNWITSIQGGALYSYLLLSVILLSSLIAMLLQAMCAKLGIVTGQDLAQATRARVGPKLAALLWITTELAIMATEIAEVIGSAVALNLLFGIPLMAGVLLTVLDVFLLLVLMKLGFRKIEAFVFVLILTIFLIFAYEVMLSDPDMSAVLRGFIPSEKIFTATLAGQDSALLIGLGIVGATVMPHNLYLHSSIVQSRQYDRRSEAGLREAIRFATIDSNIQLGFSFIINCLLLVLGAALFFGNDPSDLGRFTQLYDALQNPGIVGGIASATLSTLFAVALLASGQNATITGTLTGQIVMEGFIHLRLPMWLRRVITRGLAVIPVIICIYLWGDREDVVESLLIYTQVFLSIALPFSMIPLLLMTSSKKIMGVFVNSQLTIILGTVSTVALVILNLQLIREVAGMLFRA

Flanking regions ( +/- flanking 50bp)

TAAGGGATATAGTGATAATAGTTCTCATTACGATCAAGGACGGATTTATCATGCTGAATACACCGCAACTCAGTCTGGCTGAAATCAATAATACCGTGCCGGTTGCCGGGGCAAAATCCGGTTTTCTGCGCAAGCTGTTTGCCTTTTCCGGCCCGGGTGCACTGGTGGCGGTGGGATATATGGATCCCGGAAACTGGATCACCTCGATTCAGGGCGGTGCGCTGTACAGTTATCTGCTGCTGTCGGTGATTTTGCTGTCCAGCCTGATTGCGATGCTGTTACAGGCAATGTGCGCAAAACTCGGGATCGTCACCGGTCAGGATCTGGCGCAGGCTACCCGGGCACGGGTCGGGCCGAAGCTGGCGGCGCTGTTGTGGATCACCACGGAACTGGCGATTATGGCGACCGAGATTGCGGAGGTGATCGGCAGTGCGGTGGCACTGAACCTGCTGTTCGGCATTCCGCTGATGGCCGGTGTGCTGCTGACAGTTCTGGATGTATTTCTGCTGCTGGTGCTGATGAAACTCGGTTTCCGCAAAATTGAAGCCTTTGTGTTTGTCCTGATCTTAACGATTTTCCTGATTTTTGCCTACGAGGTGATGCTGTCGGACCCGGACATGAGTGCAGTATTGCGCGGCTTTATTCCGTCGGAGAAAATCTTCACCGCCACACTGGCCGGGCAGGATTCCGCCCTGCTGATCGGGCTGGGGATTGTCGGGGCAACGGTGATGCCGCATAACCTCTATCTTCACTCTTCTATTGTGCAGAGCCGTCAGTATGACCGCCGCAGTGAGGCCGGGCTGCGCGAGGCGATCCGCTTTGCAACAATTGATTCCAATATCCAGCTCGGGTTTTCATTTATTATCAACTGTCTGCTGCTGGTGCTCGGTGCAGCGCTGTTTTTCGGTAACGATCCGTCTGACCTCGGACGTTTCACCCAGCTGTATGACGCGCTGCAGAATCCGGGTATCGTCGGTGGTATCGCCAGTGCCACGCTCTCCACACTGTTCGCGGTGGCGCTGCTCGCCTCCGGGCAGAACGCCACAATCACCGGTACACTGACCGGGCAGATTGTGATGGAAGGCTTTATTCATCTGCGGCTGCCGATGTGGCTGCGCCGGGTGATCACCCGTGGTCTGGCCGTGATCCCGGTGATTATCTGTATTTACCTGTGGGGGGATCGCGAGGATGTGGTGGAAAGTCTGCTGATTTATACCCAGGTGTTTCTGAGTATCGCCCTGCCGTTCTCCATGATCCCGCTGCTGCTGATGACCTCGAGCAAAAAAATCATGGGGGTGTTTGTGAACTCGCAGCTGACGATCATACTCGGGACTGTTTCCACTGTGGCACTGGTGATCCTCAATTTACAGTTGATCCGGGAAGTGGCCGGGATGCTGTTCCGTGCCTGAATAATCCGGGTACGGTGCCGTACCCGGAAAATCCGTGATCAGCACTTCGG