Homologs in group_251

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05755 FBDBKF_05755 100.0 Morganella morganii S1 punR DNA-binding transcriptional activator PunR
NLDBIP_12175 NLDBIP_12175 100.0 Morganella morganii S4 punR DNA-binding transcriptional activator PunR
LHKJJB_12035 LHKJJB_12035 100.0 Morganella morganii S3 punR DNA-binding transcriptional activator PunR
HKOGLL_10650 HKOGLL_10650 100.0 Morganella morganii S5 punR DNA-binding transcriptional activator PunR
F4V73_RS03570 F4V73_RS03570 93.7 Morganella psychrotolerans punR DNA-binding transcriptional activator PunR
PMI_RS06760 PMI_RS06760 77.0 Proteus mirabilis HI4320 punR DNA-binding transcriptional activator PunR
PMI_RS10825 PMI_RS10825 32.5 Proteus mirabilis HI4320 allS HTH-type transcriptional activator AllS

Distribution of the homologs in the orthogroup group_251

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_251

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACR2 7.27e-149 422 65 0 300 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 7.27e-149 422 65 0 300 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
P77700 2.19e-46 161 29 1 285 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P0ACR0 2.9e-46 160 32 1 273 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 2.9e-46 160 32 1 273 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q8FK66 5.93e-46 160 32 1 273 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 5.93e-46 160 32 1 273 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RF30 7.58e-46 160 32 1 273 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 7.58e-46 160 32 1 273 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
Q765S2 7.06e-45 156 34 1 252 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
Q9S4Y7 1.33e-44 156 32 1 273 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 1.33e-44 156 32 1 273 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57S50 3.73e-44 155 31 1 273 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q8Z8R3 6.51e-44 155 31 1 273 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P76369 6.92e-35 131 27 0 277 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
P67660 1.57e-30 119 29 3 287 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 1.57e-30 119 29 3 287 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
Q8X4M5 2.29e-15 78 31 4 189 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P27111 3.74e-15 77 35 0 136 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q8KA72 4.27e-14 74 24 7 263 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9JXW7 2.83e-13 72 26 8 292 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JPU9 5.19e-13 71 27 10 294 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P45105 6.44e-13 71 30 6 192 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P20668 6.72e-13 71 25 6 239 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P0DUU5 1.38e-12 70 28 1 182 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
P0A9G1 2.04e-12 70 26 3 192 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 2.04e-12 70 26 3 192 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 2.04e-12 70 26 3 192 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P30864 2.92e-12 69 25 11 302 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P0A2Q4 4.61e-12 68 27 3 192 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 4.61e-12 68 27 3 192 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P94678 7.4e-12 68 26 0 184 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
P52696 9.93e-12 67 25 7 241 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
O35038 1.32e-11 67 28 6 200 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P0ACQ9 1.48e-11 67 26 0 145 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 1.48e-11 67 26 0 145 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 1.48e-11 67 26 0 145 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
P77744 1.63e-11 67 23 5 239 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
Q9X725 2.18e-11 67 24 4 238 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P77309 2.42e-11 66 27 1 140 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
P71318 2.52e-11 66 24 5 243 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P94387 6.44e-11 65 30 0 113 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
Q55459 6.84e-11 65 23 6 289 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45349 8.15e-11 65 26 3 197 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39592 8.8e-11 65 27 2 168 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
A0T0G2 1.09e-10 64 20 5 263 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P0A9F3 1.63e-10 64 25 9 252 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 1.63e-10 64 25 9 252 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 1.63e-10 64 25 9 252 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
P55576 1.76e-10 63 30 2 136 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P42427 2.9e-10 62 26 1 145 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P0ACQ4 3.37e-10 63 26 3 195 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 3.37e-10 63 26 3 195 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 3.37e-10 63 26 3 195 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
Q06610 4.45e-10 63 30 2 136 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
P74422 5.36e-10 62 25 7 249 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73123 6.6e-10 62 25 6 207 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P25544 8.44e-10 62 32 4 178 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q5N5I5 9.58e-10 62 27 2 176 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 9.58e-10 62 27 2 176 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45600 1.3e-09 61 25 9 252 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P06614 1.78e-09 61 25 9 252 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7Z5E4 2.13e-09 60 39 0 78 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A0T0V5 2.17e-09 60 24 2 175 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P44418 2.57e-09 60 27 0 143 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q85G62 2.67e-09 60 25 2 179 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P96194 3.77e-09 57 33 0 102 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q9HWH8 5.6e-09 59 25 6 245 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34685 5.74e-09 59 25 6 244 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
Q05840 6.14e-09 59 38 0 86 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
Q46M57 9.48e-09 58 31 1 120 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6B936 9.87e-09 58 25 1 145 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
Q46M54 1e-08 58 31 1 120 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P56885 1.09e-08 58 24 9 310 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
Q47141 1.1e-08 58 22 6 275 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
Q6HPH4 1.15e-08 58 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VJ1 1.17e-08 58 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P0A9F6 1.23e-08 58 29 3 146 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 1.23e-08 58 29 3 146 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 1.23e-08 58 29 3 146 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
Q63H01 1.39e-08 58 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 1.39e-08 58 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
A0R8S0 1.92e-08 58 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
Q3MCB5 2.01e-08 58 26 1 145 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQ82 2.11e-08 58 26 1 145 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P42722 2.15e-08 58 28 3 176 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q81IX0 2.7e-08 57 20 4 253 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O19892 3.5e-08 57 24 2 179 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P46068 4.13e-08 57 47 0 61 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
Q4G384 4.77e-08 57 25 1 152 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
P52595 5.46e-08 56 31 1 117 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
P51205 6.6e-08 56 26 1 145 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
Q1XDT2 6.67e-08 56 26 1 145 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P75836 6.95e-08 56 31 1 128 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P71025 7.14e-08 56 20 7 273 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
P0ACR8 8.36e-08 56 25 1 155 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 8.36e-08 56 25 1 155 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P42507 9.03e-08 55 27 5 183 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P03030 9.91e-08 55 24 5 239 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
P48271 1.04e-07 55 25 0 145 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
Q57083 1.06e-07 55 37 0 72 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P9WMF7 1.09e-07 55 27 6 195 1 Rv0377 Uncharacterized HTH-type transcriptional regulator Rv0377 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF6 1.09e-07 55 27 6 195 3 MT0391 Uncharacterized HTH-type transcriptional regulator MT0391 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q47005 1.1e-07 55 27 2 144 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P58332 1.24e-07 55 24 9 300 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
O32255 1.24e-07 55 25 3 180 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P55181 1.24e-07 55 27 1 147 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
B1JQ39 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 1.39e-07 55 28 1 134 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
O33945 1.68e-07 55 26 0 141 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
O07906 1.95e-07 55 22 2 138 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P96725 2.03e-07 55 22 6 248 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P52665 3.54e-07 52 35 0 87 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P37499 4.06e-07 53 23 2 184 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
P49518 4.64e-07 53 21 1 174 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P94501 6.44e-07 53 22 7 296 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P25545 6.72e-07 53 25 7 297 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
P67662 7.4e-07 53 26 0 117 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 7.4e-07 53 26 0 117 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 7.4e-07 53 26 0 117 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P52689 9.05e-07 53 27 0 107 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
Q04778 9.28e-07 53 25 0 140 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P45099 9.5e-07 53 24 3 143 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O06703 9.51e-07 53 28 1 128 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P52670 1.85e-06 52 29 3 147 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B7LUJ5 2.01e-06 52 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q329U3 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 2.1e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NU32 2.14e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YVK2 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 2.2e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q9X5P2 2.26e-06 52 26 1 139 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
B7NF72 2.26e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P12529 2.29e-06 51 32 3 126 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P94403 2.32e-06 51 22 5 166 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
Q1R4H3 2.37e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 2.37e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 2.37e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 2.37e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 2.37e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
O78432 2.39e-06 52 27 1 120 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
O32186 2.7e-06 51 26 2 153 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
Q8XBK9 2.98e-06 51 27 2 140 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
B4TNR5 3.08e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
B4SYF7 3.22e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P0A2Q0 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 3.44e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B5FN59 3.47e-06 51 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
P52686 3.58e-06 51 23 1 184 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
B2TU26 4.23e-06 50 32 1 88 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P77559 4.8e-06 50 24 5 239 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
Q1R6S1 5.38e-06 50 26 2 147 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 5.38e-06 50 26 2 147 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P52661 5.48e-06 50 22 1 174 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P52678 7.3e-06 50 25 7 263 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
A2CI69 7.35e-06 50 24 1 145 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q57748 7.76e-06 50 22 2 170 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A1JI47 8.25e-06 50 48 0 50 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P33634 8.32e-06 50 20 5 286 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
A4QH19 9.45e-06 50 29 0 117 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P52690 9.47e-06 50 27 4 182 3 cbbR HTH-type transcriptional regulator CbbR Cereibacter sphaeroides
O68014 9.87e-06 50 24 6 198 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B4E8V9 1.02e-05 50 24 8 263 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P52693 1.13e-05 49 24 4 191 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P37641 1.14e-05 49 26 0 119 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P52666 1.33e-05 49 24 2 170 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
P45463 1.39e-05 49 26 2 140 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 1.39e-05 49 26 2 140 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P23841 1.48e-05 49 26 1 130 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
P44821 1.99e-05 48 21 1 146 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52691 3.37e-05 48 25 8 252 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O33812 9.18e-05 46 22 3 153 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
P52667 0.00014 46 22 0 137 3 estR HTH-type transcriptional regulator EstR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P11720 0.000161 46 37 0 74 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44311 0.000162 46 22 6 242 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
P34818 0.000165 46 34 0 72 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P0A2Q2 0.000175 46 25 0 136 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 0.000175 46 25 0 136 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P05827 0.00018 46 25 0 136 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P52676 0.000342 45 36 0 72 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P0C6D1 0.000462 44 21 3 171 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37459 0.000481 44 27 0 113 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P27102 0.000541 44 33 0 74 3 tcbR HTH-type transcriptional regulator TcbR Pseudomonas sp. (strain P51)
Q9I4X0 0.000579 44 25 9 255 1 mvfR Multiple virulence factor regulator MvfR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52044 0.000831 43 24 3 141 3 ygfI Uncharacterized HTH-type transcriptional regulator YgfI Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_11835
Feature type CDS
Gene punR
Product DNA-binding transcriptional activator PunR
Location 26909 - 27811 (strand: 1)
Length 903 (nucleotides) / 300 (amino acids)
In genomic island -

Contig

Accession ZDB_221
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_251
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MWSEYTLDVVDAVARTGSFSAAAEELHRVPSAISYSVRQLEEWLAVPLFERRHRDVELTPAGALFVKEARDVIKKMKSTRHQCQMIANGWRGQFSIAVDCIVKPERITRLLLDFYHHFPDIELYIYPEVFNGVWDALVDRRVDVAIGATRASPIGERYNFRDMGFMPWRAVVSPDHPLASAGHVLTNEEMVPYPSLCLEDTSRSLPKRDTWALDNQRRLVVPDWDRGIACVESGLCVAMMPAHRADPLIKVGRLAALKIEQPLPDSPCCITWVDKDTSPALSWLLDYLGDSNTLNAEWLR

Flanking regions ( +/- flanking 50bp)

AAAACGTTATTATTTGCACACTGCTGTGAAATTTTTTGAAAGGAAGGATTATGTGGTCAGAATATACGCTGGATGTGGTGGATGCTGTGGCGCGGACAGGCAGTTTCAGTGCGGCGGCAGAGGAACTGCACCGGGTGCCTTCCGCCATCAGCTACAGTGTCCGCCAGCTGGAAGAGTGGCTGGCGGTTCCGCTGTTTGAACGGCGTCACCGCGATGTTGAACTGACACCCGCCGGGGCGCTGTTTGTCAAAGAAGCGCGTGATGTCATCAAAAAAATGAAATCCACACGTCATCAGTGTCAGATGATAGCCAACGGCTGGCGCGGACAATTCAGCATCGCCGTTGACTGTATCGTAAAACCGGAACGGATAACGCGACTTCTGCTGGATTTTTATCATCATTTCCCGGATATCGAGTTGTATATTTACCCGGAAGTATTTAACGGGGTGTGGGATGCGCTGGTGGACAGACGGGTGGACGTGGCAATCGGTGCTACACGCGCATCTCCTATCGGTGAGCGCTACAATTTCCGCGATATGGGCTTTATGCCGTGGCGTGCGGTAGTCAGTCCGGATCATCCGCTGGCCTCTGCCGGTCATGTCCTGACCAATGAGGAGATGGTGCCGTACCCGAGTTTGTGTCTGGAAGATACCTCACGTTCTCTGCCGAAACGCGATACGTGGGCACTGGATAATCAGCGCCGCCTGGTGGTGCCGGACTGGGATCGCGGAATTGCCTGTGTGGAATCGGGATTGTGTGTGGCAATGATGCCGGCGCACCGCGCCGATCCGCTGATTAAAGTGGGGCGGCTGGCAGCACTGAAGATAGAGCAGCCATTGCCGGACAGCCCGTGCTGTATCACCTGGGTGGATAAAGACACCTCTCCGGCACTGAGCTGGCTGCTCGATTATCTCGGGGACAGCAACACGCTCAATGCCGAATGGCTGCGCTGATCCTCAGCGGCGGTAATCGATAAACGGACCATCCGCCACGGAGCGGCGTT