Homologs in group_2019

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15155 FBDBKF_15155 100.0 Morganella morganii S1 nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
NLDBIP_11435 NLDBIP_11435 100.0 Morganella morganii S4 nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
LHKJJB_11295 LHKJJB_11295 100.0 Morganella morganii S3 nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
HKOGLL_09905 HKOGLL_09905 100.0 Morganella morganii S5 nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
F4V73_RS12290 F4V73_RS12290 95.6 Morganella psychrotolerans nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
PMI_RS01710 PMI_RS01710 89.2 Proteus mirabilis HI4320 nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F

Distribution of the homologs in the orthogroup group_2019

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2019

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JNZ2 0.0 697 88 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4TPL2 0.0 691 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis (strain Pestoides F)
Q1CLD8 0.0 691 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZBZ5 0.0 691 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis
Q1C4D5 0.0 691 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLJ3 0.0 691 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66E01 0.0 689 87 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Yersinia pseudotuberculosis serotype I (strain IP32953)
A8GAC4 0.0 682 86 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Serratia proteamaculans (strain 568)
A6T526 0.0 665 83 0 405 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7MID2 0.0 654 81 1 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio vulnificus (strain YJ016)
Q8DBJ1 0.0 654 81 1 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio vulnificus (strain CMCP6)
Q9RFV6 0.0 652 80 1 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio campbellii (strain ATCC BAA-1116)
Q9LCJ0 0.0 649 82 1 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5UFX3 0.0 647 81 0 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain PittGG)
O05012 0.0 645 81 0 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UAX6 0.0 645 81 0 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain PittEE)
Q5F6X5 0.0 645 80 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4QP19 0.0 644 81 0 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus influenzae (strain 86-028NP)
Q56584 0.0 640 81 1 408 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio alginolyticus
A1KSH3 0.0 640 80 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JVQ3 0.0 640 80 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M2A6 0.0 640 80 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup C (strain 053442)
Q0I5Y1 0.0 640 80 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Histophilus somni (strain 129Pt)
Q9K0M8 0.0 640 80 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9CLA6 0.0 638 80 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pasteurella multocida (strain Pm70)
Q75R59 0.0 635 81 1 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio anguillarum
A6VLY1 0.0 634 79 0 404 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65VU9 0.0 633 79 0 404 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3MYM7 0.0 629 78 0 404 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9X4Q8 0.0 628 79 0 408 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5Y4 0.0 628 79 0 408 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7VNU4 0.0 625 79 0 404 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q15YQ1 0.0 620 76 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A6VW13 0.0 620 70 1 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Marinomonas sp. (strain MWYL1)
Q12QK1 0.0 616 78 0 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q9HZL1 0.0 614 70 2 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PF8 0.0 614 70 2 405 1 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V3A2 0.0 612 69 2 405 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Pseudomonas aeruginosa (strain PA7)
Q1Q7Z7 0.0 607 70 1 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5QYQ8 0.0 602 73 0 408 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q4FPV2 0.0 599 69 1 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q605A0 0.0 598 70 2 406 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9LCJ1 0.0 530 81 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Photobacterium phosphoreum
Q9LCJ4 0.0 513 79 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Pseudoalteromonas haloplanktis
Q9LCI8 2.7e-178 501 77 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Shewanella hanedai
Q9LCJ3 5.14e-178 501 76 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Alteromonas macleodii
Q9K3E1 2.86e-174 491 75 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Colwellia maris
Q9LCI7 3.03e-174 491 75 1 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Shewanella putrefaciens
Q9LCI9 1.68e-173 489 76 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Moritella marina
Q9LCJ2 2.14e-173 489 74 0 303 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F (Fragment) Colwellia psychrerythraea
Q821Q3 2.95e-106 323 40 5 422 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9Z723 1.3e-104 319 39 6 423 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia pneumoniae
Q3KKV3 1.71e-104 318 40 6 422 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
O84745 2.53e-104 318 39 6 422 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q255Y6 1.02e-103 317 39 4 421 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia felis (strain Fe/C-56)
Q9PLI3 4.8e-103 315 38 6 422 3 nqrF Na(+)-translocating NADH-quinone reductase subunit F Chlamydia muridarum (strain MoPn / Nigg)
Q7WTJ2 2.04e-36 139 29 12 363 1 mphP Phenol hydroxylase P5 protein Acinetobacter pittii (strain PHEA-2)
P19734 8.14e-34 132 28 11 381 1 dmpP Phenol 2-monooxygenase, reductase component DmpP Pseudomonas sp. (strain CF600)
P21394 3.68e-27 114 25 13 366 1 xylA Xylene/toluene monooxygenase electron transfer component XylA Pseudomonas putida
Q3C1E0 5.76e-23 102 24 13 383 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
Q3C1D2 1.25e-22 101 25 12 378 1 tphA1II Terephthalate 1,2-dioxygenase, reductase component 2 Comamonas sp.
P22868 4.28e-22 99 25 13 371 1 mmoC Methane monooxygenase component C Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P0DPQ8 6.67e-20 93 23 12 373 1 gcoB Aromatic O-demethylase, reductase subunit Amycolatopsis sp. (strain ATCC 39116 / 75iv2)
O85675 1.42e-19 92 22 12 369 1 antC Anthranilate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q52126 1.82e-19 92 22 13 358 1 ndoR Naphthalene 1,2-dioxygenase system ferredoxin--NAD(P)(+), reductase component Pseudomonas putida
Q8GI14 1.95e-19 92 26 14 379 1 carAd Ferredoxin--NAD(P)(+) reductase CarAd Pseudomonas resinovorans
E9RFT0 2.44e-19 92 23 11 391 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium goodii
O52378 5.65e-19 90 23 12 367 1 nagAa Naphthalene 1,2-dioxygenase/salicylate 5-hydroxylase systems, ferredoxin--NAD(P)(+), reductase component Ralstonia sp.
Q0SJK8 2.73e-18 89 23 10 363 1 prmB Propane 2-monooxygenase, reductase component Rhodococcus jostii (strain RHA1)
Q4P7Y8 1.19e-17 87 32 3 148 3 MCR1 NADH-cytochrome b5 reductase 2 Ustilago maydis (strain 521 / FGSC 9021)
Q03304 1.3e-17 86 26 15 357 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
A0QTU9 3.79e-17 85 23 12 385 1 mimB Propane 2-monooxygenase, reductase component Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q66DP5 9.67e-17 84 22 11 365 1 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
P68641 1.04e-16 84 22 11 365 3 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pestis
P26395 1.44e-16 83 24 13 356 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07771 2.03e-16 83 23 14 369 1 benC Benzoate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q45692 3.87e-15 79 25 11 301 1 dntAa 2,4-dinitrotoluene dioxygenase system ferredoxin--NAD(+), reductase component Burkholderia sp. (strain RASC)
Q54NC1 7.22e-15 77 27 5 194 3 cyb5r1 NADH-cytochrome b5 reductase 1 Dictyostelium discoideum
Q768T4 1.38e-14 77 23 12 368 1 prmB Propane 2-monooxygenase, reductase component Gordonia sp. (strain TY-5)
Q9X406 2.54e-14 77 23 14 382 1 msmD Putative methanesulfonate monooxygenase ferredoxin reductase subunit Methylosulfonomonas methylovora
A3LT66 2.54e-14 76 26 6 221 3 MCR1 NADH-cytochrome b5 reductase 2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q9UR35 1.63e-13 74 24 11 264 2 CBR1 NADH-cytochrome b5 reductase 1 Mortierella alpina
Q6C9G8 1.82e-13 73 28 7 196 3 MCR1 NADH-cytochrome b5 reductase 2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q4PGW7 2.3e-13 73 30 7 193 3 CBR1 NADH-cytochrome b5 reductase 1 Ustilago maydis (strain 521 / FGSC 9021)
Q9RC40 6.04e-13 73 26 7 204 3 hmp Flavohemoprotein Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P83291 6.78e-13 72 27 6 209 1 CBR2 NADH-cytochrome b5 reductase-like protein Arabidopsis thaliana
Q6BQ54 7.83e-13 72 28 5 175 3 MCR1 NADH-cytochrome b5 reductase 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q502I6 1.26e-12 72 24 3 163 2 cyb5r4 Cytochrome b5 reductase 4 Danio rerio
Q04516 5.98e-12 69 26 4 191 1 AIM33 Uncharacterized oxidoreductase AIM33 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8U2E4 6.63e-12 69 26 6 196 1 hydG Sulfhydrogenase 1 subunit gamma Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q73B49 7.01e-12 70 27 6 204 3 hmp Flavohemoprotein Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HLA6 9.7e-12 69 27 7 204 3 hmp Flavohemoprotein Bacillus thuringiensis subsp. konkukian (strain 97-27)
A7IPX7 9.83e-12 69 21 14 371 1 xamoF Alkene monooxygenase system, ferredoxin--NAD(+) reductase component Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q81T23 1.06e-11 69 27 7 204 3 hmp Flavohemoprotein Bacillus anthracis
Q81FW4 1.18e-11 69 28 7 204 3 hmp Flavohemoprotein Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9KMY3 1.19e-11 69 27 7 207 1 hmp Flavohemoprotein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q54D73 1.22e-11 69 25 13 315 1 fhbB Flavohemoprotein B Dictyostelium discoideum
Q51603 1.59e-11 68 22 11 344 1 cbdC 2-halobenzoate 1,2-dioxygenase electron transfer component Burkholderia cepacia
A9FRJ0 1.73e-11 67 23 12 282 1 sce5135 Ferredoxin--NADP reductase B Sorangium cellulosum (strain So ce56)
P49852 2.12e-11 68 23 10 304 2 hmp Flavohemoprotein Bacillus subtilis (strain 168)
A1DHW1 2.16e-11 67 26 6 194 3 cbr1 NADH-cytochrome b5 reductase 1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A3GF86 2.71e-11 67 31 5 155 3 CBR1 NADH-cytochrome b5 reductase 1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6CA86 2.79e-11 67 29 5 159 3 CBR1 NADH-cytochrome b5 reductase 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
A6ZVM6 2.81e-11 67 28 4 163 3 CBR1 NADH-cytochrome b5 reductase 1 Saccharomyces cerevisiae (strain YJM789)
P36841 2.82e-11 68 25 7 224 2 NITA Nitrate reductase [NADH] Volvox carteri
P38626 3e-11 67 28 4 163 1 CBR1 NADH-cytochrome b5 reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4X0B5 3.21e-11 67 26 6 195 3 cbr1 NADH-cytochrome b5 reductase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P23101 3.99e-11 67 21 13 384 3 xylZ Toluate 1,2-dioxygenase electron transfer component Pseudomonas putida
Q6FUX5 4.55e-11 67 23 7 224 3 MCR1 NADH-cytochrome b5 reductase 2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P0CP14 5.54e-11 66 27 5 162 3 CBR1 NADH-cytochrome b5 reductase 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP15 5.54e-11 66 27 5 162 3 CBR1 NADH-cytochrome b5 reductase 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q00598 7.08e-11 67 26 7 209 1 PETH Ferredoxin--NADP reductase, cyanelle Cyanophora paradoxa
Q6FLT3 1e-10 65 26 6 193 3 CBR1 NADH-cytochrome b5 reductase 1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9HTF3 1.18e-10 66 25 8 209 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A0H2ZJB2 1.18e-10 66 25 8 209 2 gbcB Glycine betaine monooxygenase reductase subunit Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3TDX8 1.34e-10 66 25 3 163 2 Cyb5r4 Cytochrome b5 reductase 4 Mus musculus
A4R935 1.35e-10 65 24 7 204 3 CBR1 NADH-cytochrome b5 reductase 1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q1DWN4 1.35e-10 65 26 5 173 3 CBR1 NADH-cytochrome b5 reductase 1 Coccidioides immitis (strain RS)
A1C7E9 1.37e-10 65 26 7 195 3 cbr1 NADH-cytochrome b5 reductase 1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q68EJ0 1.42e-10 66 25 3 163 1 Cyb5r4 Cytochrome b5 reductase 4 Rattus norvegicus
A7THS1 1.43e-10 65 24 6 191 3 MCR1A NADH-cytochrome b5 reductase 2-A Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A7TNL7 1.45e-10 65 29 4 155 3 CBR1 NADH-cytochrome b5 reductase 1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q0UEY4 1.49e-10 65 26 7 193 3 CBR1 NADH-cytochrome b5 reductase 1 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q9RYR5 1.59e-10 65 26 3 166 3 hmp Flavohemoprotein Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A5E5C5 2.01e-10 65 24 9 223 3 MCR1 NADH-cytochrome b5 reductase 2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A2Y8E0 2.31e-10 65 27 5 165 3 OsI_21320 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. indica
A5DQ25 2.52e-10 64 29 5 155 3 CBR1 NADH-cytochrome b5 reductase 1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A6SI59 3.53e-10 64 22 6 214 3 mcr1 NADH-cytochrome b5 reductase 2 Botryotinia fuckeliana (strain B05.10)
Q3KNK3 4.15e-10 63 22 6 218 2 Cyb5r2 NADH-cytochrome b5 reductase 2 Mus musculus
P41344 4.26e-10 64 27 5 165 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Oryza sativa subsp. japonica
Q2UFN3 4.89e-10 63 25 6 194 3 cbr1 NADH-cytochrome b5 reductase 1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A5DQE4 5.65e-10 63 27 6 177 3 MCR1 NADH-cytochrome b5 reductase 2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
B0CQN7 5.8e-10 63 27 5 167 3 MCR1.1 NADH-cytochrome b5 reductase 1 Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q6ZFJ3 6.29e-10 63 27 5 171 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. japonica
Q0U9W5 6.36e-10 63 22 4 187 3 MCR1 NADH-cytochrome b5 reductase 2 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q9DB73 7.27e-10 63 29 8 196 1 Cyb5r1 NADH-cytochrome b5 reductase 1 Mus musculus
Q59P03 7.73e-10 63 27 4 157 3 CBR1 NADH-cytochrome b5 reductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q0P487 8.51e-10 63 26 8 214 2 cyb5r2 NADH-cytochrome b5 reductase 2 Danio rerio
Q2HG02 8.59e-10 63 23 6 187 3 MCR1 NADH-cytochrome b5 reductase 2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P40609 8.7e-10 63 26 8 204 3 hmp Flavohemoprotein Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9UAG7 9.2e-10 63 24 7 201 2 fhbA Flavohemoprotein A Dictyostelium discoideum
Q0CY37 1.14e-09 62 25 6 194 3 cbr1 NADH-cytochrome b5 reductase 1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A2WZT1 1.17e-09 63 26 5 171 3 OsI_05475 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Oryza sativa subsp. indica
Q32LH7 1.18e-09 63 23 2 163 2 CYB5R4 Cytochrome b5 reductase 4 Bos taurus
Q7UIY1 1.2e-09 63 24 5 177 3 hmp Flavohemoprotein Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8W493 1.6e-09 62 25 3 163 1 LFNR2 Ferredoxin--NADP reductase, leaf isozyme 2, chloroplastic Arabidopsis thaliana
A7EKT5 1.64e-09 62 23 5 187 3 mcr1 NADH-cytochrome b5 reductase 2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
O74557 1.93e-09 62 28 5 152 3 cbr1 NADH-cytochrome b5 reductase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6BUX2 2.05e-09 61 26 3 156 3 CBR1 NADH-cytochrome b5 reductase 1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q1DXN1 2.33e-09 62 22 5 211 3 MCR1 NADH-cytochrome b5 reductase 2 Coccidioides immitis (strain RS)
Q5AZB4 2.76e-09 61 25 6 194 3 cbr1 NADH-cytochrome b5 reductase 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q12746 2.8e-09 61 24 3 154 1 PGA3 Plasma membrane-associated coenzyme Q6 reductase PGA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6CID0 2.99e-09 61 28 4 157 3 CBR1 NADH-cytochrome b5 reductase 1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q75AL4 3.01e-09 61 25 4 158 3 CBR1 NADH-cytochrome b5 reductase 1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
E7FHW8 3.2e-09 61 24 5 187 1 shyC Sulfhydrogenase 2 subunit gamma Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q28CZ9 3.87e-09 62 25 4 164 2 cyb5r4 Cytochrome b5 reductase 4 Xenopus tropicalis
Q8ETH0 3.89e-09 61 26 7 172 3 hmp Flavohemoprotein Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q59M70 4.17e-09 60 23 3 174 3 MCR1 NADH-cytochrome b5 reductase 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q7RXL1 4.51e-09 60 24 5 161 3 cbr1 NADH-cytochrome b5 reductase 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6AY12 4.89e-09 60 22 6 216 2 Cyb5r2 NADH-cytochrome b5 reductase 2 Rattus norvegicus
Q9ZNT1 6.36e-09 60 27 5 162 1 CBR1 NADH--cytochrome b5 reductase 1 Arabidopsis thaliana
A5E7U2 8.67e-09 60 28 6 158 3 CBR1 NADH-cytochrome b5 reductase 1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
P39662 9.42e-09 60 27 9 206 1 hmp Flavohemoprotein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7TTP0 9.73e-09 60 24 5 210 3 hmp Flavohemoprotein Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7TTP2 9.82e-09 60 24 5 210 3 hmp Flavohemoprotein Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHW5 9.82e-09 60 24 5 210 3 hmp Flavohemoprotein Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5BG98 1.15e-08 59 22 6 187 3 mcr1 NADH-cytochrome b5 reductase 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P49050 1.21e-08 60 24 7 194 1 YNR1 Nitrate reductase [NADPH] Pichia angusta
P17569 1.3e-08 60 25 8 214 2 None Nitrate reductase [NADH] Cucurbita maxima
Q55318 1.35e-08 60 26 7 186 1 petH Ferredoxin--NADP reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q53563 1.85e-08 59 20 9 284 1 mmoC Methane monooxygenase component C Methylosinus trichosporium
P31973 2.08e-08 59 27 8 186 1 petH Ferredoxin--NADP reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q7SFY2 2.71e-08 58 26 5 146 3 mcr-1 NADH-cytochrome b5 reductase 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A2Q898 2.95e-08 58 22 5 208 3 mcr1 NADH-cytochrome b5 reductase 2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A4QR21 3.71e-08 58 25 4 173 3 MCR1 NADH-cytochrome b5 reductase 2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A1CRK9 4.56e-08 58 21 4 183 3 mcr1 NADH-cytochrome b5 reductase 2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q44549 5.15e-08 58 26 10 195 3 petH Ferredoxin--NADP reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9FKW6 7.45e-08 57 27 5 165 1 LFNR1 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic Arabidopsis thaliana
P39865 8.09e-08 58 26 9 215 3 NIA1 Nitrate reductase [NADH] 1 Phaseolus vulgaris
A7TM72 8.15e-08 57 24 7 183 3 MCR1B NADH-cytochrome b5 reductase 2-B Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P58558 9.25e-08 57 26 10 199 3 petH Ferredoxin--NADP reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5EB81 1.04e-07 56 25 6 194 2 Cyb5r1 NADH-cytochrome b5 reductase 1 Rattus norvegicus
Q3MHW9 1.19e-07 56 26 9 210 2 CYB5R1 NADH-cytochrome b5 reductase 1 Bos taurus
Q93RE3 1.36e-07 57 23 6 185 3 petH Ferredoxin--NADP reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2UKB8 1.37e-07 56 24 4 180 3 mcr1 NADH-cytochrome b5 reductase 2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9UHQ9 1.49e-07 56 26 7 195 1 CYB5R1 NADH-cytochrome b5 reductase 1 Homo sapiens
P21890 2.05e-07 56 25 10 195 1 petH Ferredoxin--NADP reductase Nostoc sp. (strain ATCC 29151 / PCC 7119)
Q1QYU6 2.24e-07 56 22 8 209 1 bmoB Glycine betaine monooxygenase reductase subunit Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5JJ90 2.3e-07 55 29 7 163 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P54233 2.4e-07 56 23 7 222 2 INR1 Inducible nitrate reductase [NADH] 1 Glycine max
Q46CG8 2.66e-07 55 27 6 159 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Methanosarcina barkeri (strain Fusaro / DSM 804)
P16081 2.93e-07 56 27 9 192 2 NIA1 Nitrate reductase [NADH] 1 Oryza sativa subsp. japonica
Q7L1T6 3.52e-07 55 23 3 163 1 CYB5R4 Cytochrome b5 reductase 4 Homo sapiens
P41343 4.49e-07 55 26 5 165 2 PETH Ferredoxin--NADP reductase, chloroplastic Mesembryanthemum crystallinum
Q8PW55 5.39e-07 54 27 5 152 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q55CT1 5.82e-07 55 24 7 203 2 redB NADPH--cytochrome P450 reductase Dictyostelium discoideum
Q6CS27 6.13e-07 54 25 4 141 3 MCR1 NADH-cytochrome b5 reductase 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A6R1T7 8.32e-07 53 23 5 176 3 MCR1 NADH-cytochrome b5 reductase 2 Ajellomyces capsulatus (strain NAm1 / WU24)
P39870 9.12e-07 55 24 7 210 2 INR2 Inducible nitrate reductase [NADH] 2 Glycine max
Q6BCY4 1.08e-06 53 22 7 216 1 CYB5R2 NADH-cytochrome b5 reductase 2 Homo sapiens
P17571 1.17e-06 54 25 8 192 1 NNR1 Nitrate reductase [NADH] 1 (Fragment) Zea mays
P27968 1.28e-06 54 27 8 200 2 NAR-7 Nitrate reductase [NAD(P)H] Hordeum vulgare
P10933 1.37e-06 53 25 3 163 1 PETH Ferredoxin--NADP reductase, leaf isozyme, chloroplastic Pisum sativum
Q7N215 1.58e-06 53 23 7 204 3 hmp Flavohemoprotein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5AD27 1.83e-06 53 25 6 172 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A1D4H0 1.91e-06 53 21 4 185 3 mcr1 NADH-cytochrome b5 reductase 2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q8GAZ4 1.94e-06 53 23 3 172 3 hmp Flavohemoprotein Burkholderia sp. (strain TH2)
Q0X0E5 2.3e-06 52 23 7 213 1 CYB5R3 NADH-cytochrome b5 reductase 3 Canis lupus familiaris
O04977 2.6e-06 52 26 5 171 2 PETH Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic Nicotiana tabacum
Q9UXV5 2.77e-06 52 27 5 149 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Pyrococcus abyssi (strain GE5 / Orsay)
P58884 2.89e-06 52 25 7 168 3 pyrK Dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P41346 3.63e-06 52 26 3 152 2 PETH Ferredoxin--NADP reductase, chloroplastic Vicia faba
A6ZZH2 3.83e-06 52 25 5 147 3 MCR1 NADH-cytochrome b5 reductase 2 Saccharomyces cerevisiae (strain YJM789)
O23877 3.92e-06 52 30 5 132 1 Os07g0147900 Ferredoxin--NADP reductase, embryo isozyme, chloroplastic Oryza sativa subsp. japonica
Q88PP0 4.35e-06 52 26 5 167 3 hmp Flavohemoprotein Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6D245 4.59e-06 52 21 11 275 3 hmp Flavohemoprotein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9DCN2 5.04e-06 51 25 9 215 1 Cyb5r3 NADH-cytochrome b5 reductase 3 Mus musculus
P20070 5.23e-06 51 24 8 215 1 Cyb5r3 NADH-cytochrome b5 reductase 3 Rattus norvegicus
P00455 5.41e-06 51 24 5 165 1 PETH Ferredoxin--NADP reductase, chloroplastic Spinacia oleracea
C8VJR5 5.41e-06 52 25 6 150 2 alnC NADH-cytochrome b5 reductase-like protein alnC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9L6L9 6.57e-06 50 22 8 208 1 fre NAD(P)H-flavin reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P39676 7.25e-06 51 21 9 256 1 YHB1 Flavohemoprotein Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5R4D2 7.92e-06 50 24 9 216 2 OXNAD1 Oxidoreductase NAD-binding domain-containing protein 1 Pongo abelii
P0AEN1 7.97e-06 50 23 6 200 1 fre NAD(P)H-flavin reductase Escherichia coli (strain K12)
P0AEN2 7.97e-06 50 23 6 200 3 fre NAD(P)H-flavin reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEN3 7.97e-06 50 23 6 200 3 fre NAD(P)H-flavin reductase Escherichia coli O157:H7
Q9S9P8 8.63e-06 51 25 5 164 1 RFNR2 Ferredoxin--NADP reductase, root isozyme 2, chloroplastic Arabidopsis thaliana
P58886 9.92e-06 50 27 5 154 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P27783 1.45e-05 51 24 9 215 2 NIA1 Nitrate reductase [NAD(P)H] Betula pendula
P59799 1.54e-05 46 34 2 84 1 fdx5 2Fe-2S ferredoxin-5 Aquifex aeolicus (strain VF5)
P83686 1.54e-05 49 23 7 213 1 CYB5R3 NADH-cytochrome b5 reductase 3 (Fragment) Sus scrofa
Q9M0V6 1.58e-05 50 26 6 168 2 RFNR1 Ferredoxin--NADP reductase, root isozyme 1, chloroplastic Arabidopsis thaliana
P36859 1.87e-05 50 27 11 217 2 NIA Nitrate reductase [NADH] Petunia hybrida
Q41014 2.07e-05 50 28 5 132 2 None Ferredoxin--NADP reductase, root isozyme, chloroplastic Pisum sativum
Q96HP4 2.21e-05 49 24 5 156 1 OXNAD1 Oxidoreductase NAD-binding domain-containing protein 1 Homo sapiens
P36060 2.22e-05 49 24 5 147 1 MCR1 NADH-cytochrome b5 reductase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12WN0 2.4e-05 49 26 6 152 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q9AIX6 3.24e-05 49 28 6 159 1 boxA Benzoyl-CoA oxygenase component A Aromatoleum evansii
P07514 3.37e-05 48 23 7 213 1 CYB5R3 NADH-cytochrome b5 reductase 3 Bos taurus
P14779 3.64e-05 49 27 9 184 1 cyp102A1 Bifunctional cytochrome P450/NADPH--P450 reductase Priestia megaterium (strain ATCC 14581 / DSM 32 / CCUG 1817 / JCM 2506 / NBRC 15308 / NCIMB 9376 / NCTC 10342 / NRRL B-14308 / VKM B-512 / Ford 19)
P41345 3.96e-05 49 29 3 106 1 Os03g0784700 Ferredoxin--NADP reductase, root isozyme, chloroplastic Oryza sativa subsp. japonica
Q9I0H4 4.84e-05 48 24 4 166 3 hmp Flavohemoprotein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5PQA4 6.02e-05 48 25 7 196 2 cyb5r2 NADH-cytochrome b5 reductase 2 Xenopus laevis
Q8VE38 6.81e-05 48 25 10 216 1 Oxnad1 Oxidoreductase NAD-binding domain-containing protein 1 Mus musculus
Q7C0F9 7.05e-05 48 22 9 275 3 hmp Flavohemoprotein Shigella flexneri
P24232 7.05e-05 48 22 9 275 1 hmp Flavohemoprotein Escherichia coli (strain K12)
P11605 7.42e-05 48 25 10 216 3 NIA1 Nitrate reductase [NADH] 1 Nicotiana tabacum
P58888 7.45e-05 47 27 5 155 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P11035 7.51e-05 48 26 8 191 1 NIA2 Nitrate reductase [NADH] 2 Arabidopsis thaliana
Q5BJ68 7.58e-05 47 23 6 196 2 cyb5r2 NADH-cytochrome b5 reductase 2 Xenopus tropicalis
Q7ABK6 8.05e-05 48 21 8 274 3 hmp Flavohemoprotein Escherichia coli O157:H7
Q59MV9 0.000102 47 33 5 106 2 YHB1 Flavohemoprotein Candida albicans (strain SC5314 / ATCC MYA-2876)
Q92AH4 0.000109 47 30 7 141 3 pyrK Dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0CRD8 0.000114 47 23 8 212 3 mcr1 NADH-cytochrome b5 reductase 2 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q60HG4 0.000117 47 23 7 213 2 CYB5R3 NADH-cytochrome b5 reductase 3 Macaca fascicularis
Q0W8E0 0.000126 47 26 6 154 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
A2AI05 0.00013 47 28 4 119 2 Ndor1 NADPH-dependent diflavin oxidoreductase 1 Mus musculus
Q8FF30 0.000139 47 22 9 275 3 hmp Flavohemoprotein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O57738 0.000157 46 26 6 149 3 pyrK Probable dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5ZHX7 0.000162 47 23 6 196 2 CYB5R2 NADH-cytochrome b5 reductase 2 Gallus gallus
P00454 0.000178 46 30 4 110 1 petH Ferredoxin--NADP reductase Spirulina sp.
P39864 0.000207 47 25 5 147 3 NIAA Nitrate reductase [NADPH] Phytophthora infestans
P39868 0.000226 47 25 10 208 2 NIA2 Nitrate reductase [NADH], clone PBNBR1412 Brassica napus
P44428 0.000242 43 34 3 83 3 fdx 2Fe-2S ferredoxin Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4P3D8 0.000266 47 26 4 167 3 TAH18 NADPH-dependent diflavin oxidoreductase 1 Ustilago maydis (strain 521 / FGSC 9021)
P08509 0.000266 47 25 10 216 2 NIA2 Nitrate reductase [NADH] 2 Nicotiana tabacum
P36842 0.000388 46 22 6 212 3 NIAD Nitrate reductase [NADPH] Leptosphaeria maculans
Q6LM37 0.000389 46 23 12 282 3 hmp Flavohemoprotein Photobacterium profundum (strain SS9)
P43128 0.000426 44 23 6 156 3 fre NAD(P)H-flavin reductase (Fragment) Vibrio orientalis
Q47266 0.000449 45 20 11 277 3 hmp Flavohemoprotein Dickeya dadantii (strain 3937)
Q4WJW8 0.000492 45 21 4 185 3 mcr1 NADH-cytochrome b5 reductase 2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9CFW7 0.000566 45 26 7 163 1 pyrK Dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit Lactococcus lactis subsp. lactis (strain IL1403)
O04397 0.000605 45 30 4 105 2 None Ferredoxin--NADP reductase, root-type isozyme, chloroplastic Nicotiana tabacum
Q05531 0.000661 45 25 12 229 2 NAR1 Nitrate reductase [NADPH] Ustilago maydis (strain 521 / FGSC 9021)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_11090
Feature type CDS
Gene nqrF
Product NADH:ubiquinone reductase (Na(+)-transporting) subunit F
Location 42351 - 43577 (strand: -1)
Length 1227 (nucleotides) / 408 (amino acids)

Contig

Accession ZDB_220
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2019
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain
PF00175 Oxidoreductase NAD-binding domain
PF00970 Oxidoreductase FAD-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2871 Energy production and conversion (C) C Na+-transporting NADH:ubiquinone oxidoreductase, subunit NqrF

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00351 Na+-transporting NADH:ubiquinone oxidoreductase subunit F [EC:7.2.1.1] - -

Protein Sequence

MDIVILGVAMFTLIVLALTALILFAKSKLVNTGDVKIEINGDAEKSFDAPAGDKLLNVLSGQGIFVSSACGGGGTCGQCRVKIKEGGGDILPTEMSHINKREAREGCRLACQVNVKQDLKIELPEEIFGVKKWECEVISNDNKATFIKELKLKIPDGESVPFRAGGYIQIECPPHVVRYDEFDVPQEYREDWDKFNLFRYVSDVKEPTVRAYSMANYPEEHGIIMLNVRIATPPPRVPDAPPGIMSSYIWSLKPGDKVTISGPFGEFFAKDTDAEMIFIGGGAGMAPMRSHIFDQLKRLHSKRKMSFWYGARSKREMFYEEDFDQLQAENENFTWNVALSDALPEDNWDGYTGFIHNVLYEHYLKNHPAPEDCEFYMCGPPMMNAAVIKMLKDLGVEDENIMLDDFGG

Flanking regions ( +/- flanking 50bp)

TGGGCTTTATGTCCTTCTCCGGCGTACAGTTATAAGGGTGAAACGCAATTATGGATATCGTTATTTTAGGCGTGGCAATGTTTACCCTGATTGTTCTGGCGCTGACCGCGTTGATTTTGTTTGCAAAATCAAAACTGGTGAACACAGGGGACGTTAAGATTGAAATCAACGGCGATGCGGAGAAAAGCTTCGACGCACCGGCCGGTGACAAGTTACTGAATGTGCTGTCCGGTCAGGGGATTTTTGTCTCCTCGGCCTGCGGCGGCGGCGGAACCTGCGGCCAGTGCCGCGTGAAGATCAAAGAAGGCGGCGGTGATATTCTGCCGACAGAAATGTCTCACATTAATAAACGCGAAGCCCGTGAAGGCTGCCGTCTGGCGTGCCAGGTGAATGTGAAGCAGGATCTGAAAATTGAGCTGCCGGAAGAGATCTTCGGGGTGAAAAAATGGGAGTGCGAAGTTATCTCCAATGATAACAAAGCGACTTTCATTAAAGAGCTGAAACTGAAAATTCCTGATGGCGAAAGTGTGCCGTTCCGTGCCGGTGGTTATATTCAGATTGAATGTCCGCCGCATGTGGTCCGCTATGATGAGTTTGATGTGCCGCAGGAATACCGCGAGGACTGGGACAAGTTCAACCTGTTCCGCTATGTGTCTGATGTGAAAGAGCCGACAGTGCGTGCTTACTCTATGGCGAACTATCCGGAAGAGCACGGCATTATCATGCTGAACGTGCGTATCGCCACACCGCCTCCGCGTGTGCCGGATGCGCCTCCGGGGATTATGTCCTCTTACATCTGGTCACTGAAACCGGGTGATAAAGTGACAATTTCCGGGCCGTTCGGGGAGTTCTTCGCGAAAGATACCGACGCGGAAATGATCTTCATCGGTGGTGGTGCGGGGATGGCGCCGATGCGTTCGCATATCTTCGACCAGCTCAAGCGTCTGCACTCCAAACGTAAGATGTCTTTCTGGTATGGTGCGCGTTCAAAACGTGAAATGTTCTATGAGGAAGATTTTGACCAGCTTCAGGCTGAGAATGAAAACTTCACCTGGAACGTGGCGTTGTCTGATGCCCTGCCGGAAGATAACTGGGACGGATACACCGGGTTTATTCATAATGTTCTCTATGAGCATTACCTGAAAAATCACCCGGCACCGGAAGATTGTGAGTTTTACATGTGCGGGCCGCCGATGATGAACGCCGCCGTGATCAAGATGCTCAAAGATCTGGGTGTGGAAGACGAAAATATTATGCTGGATGACTTCGGCGGCTGATTTCCGCCCCTGTCATAACGAAACTGCGCCCACACCTGTGGGCGCAGATG