Homologs in group_3097

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19300 FBDBKF_19300 100.0 Morganella morganii S1 ampR LysR family transcriptional regulator AmpR
NLDBIP_07910 NLDBIP_07910 100.0 Morganella morganii S4 ampR LysR family transcriptional regulator AmpR
LHKJJB_07445 LHKJJB_07445 100.0 Morganella morganii S3 ampR LysR family transcriptional regulator AmpR
HKOGLL_03485 HKOGLL_03485 100.0 Morganella morganii S5 ampR LysR family transcriptional regulator AmpR
F4V73_RS12060 F4V73_RS12060 81.4 Morganella psychrotolerans ampR LysR family transcriptional regulator AmpR

Distribution of the homologs in the orthogroup group_3097

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3097

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P12529 2.29e-137 392 65 0 285 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P05051 1.24e-134 385 64 0 286 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P45461 8.14e-129 370 61 2 289 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
P24734 2.57e-118 344 61 0 290 1 ampR HTH-type transcriptional activator AmpR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O69772 1.27e-98 294 56 1 284 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
P52683 2.49e-96 288 48 2 291 3 smeR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Serratia marcescens
P52660 1.64e-95 286 50 1 288 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P52658 9.98e-93 279 50 2 288 3 ampR HTH-type transcriptional activator AmpR Citrobacter koseri
P52676 3.8e-91 275 46 2 287 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
P14145 6.65e-84 256 48 1 290 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P0A9F6 3.77e-47 162 34 3 295 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 3.77e-47 162 34 3 295 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 3.77e-47 162 34 3 295 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
Q57083 1.35e-38 140 33 4 285 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P55576 4.67e-33 125 33 6 284 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P34818 5.06e-30 117 33 6 292 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P45099 1.75e-29 116 27 3 291 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P42507 1.11e-28 114 31 4 285 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P11720 1.04e-26 108 31 6 298 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P46068 1.86e-26 108 29 6 291 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P77333 7.74e-18 85 29 5 256 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P75836 7.53e-14 73 29 3 174 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
Q5N5I5 2.99e-13 72 36 4 138 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.99e-13 72 36 4 138 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P42722 5.59e-13 71 37 3 132 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O32186 9.19e-13 70 25 5 235 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P25544 1.64e-12 70 34 4 133 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P37641 3.86e-12 68 32 3 150 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
Q06610 4.5e-12 68 35 4 141 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
O78432 1.35e-11 67 24 7 269 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P43011 1.52e-11 67 24 6 264 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZDG9 3.94e-11 65 36 2 130 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q81VJ1 4.59e-11 65 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P23841 5.14e-11 65 36 3 122 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
Q6HPH4 5.5e-11 65 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H01 8.12e-11 64 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 8.12e-11 64 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
A0T0V5 9.4e-11 64 34 5 135 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
O34685 1.17e-10 64 28 7 235 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
Q6B936 1.64e-10 64 25 8 270 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P70785 2.05e-10 63 35 2 126 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P55181 2.06e-10 63 37 3 127 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
Q01610 2.61e-10 63 26 10 304 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q81IX0 4.9e-10 62 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q85G62 6.86e-10 62 25 10 304 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
A0R8S0 7.8e-10 62 23 8 266 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P71025 9.14e-10 61 24 11 258 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
Q3MCB5 1.03e-09 62 25 10 305 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P52669 1.09e-09 61 32 1 120 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
P52595 1.68e-09 61 32 3 127 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
P27111 1.86e-09 60 35 1 116 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P52659 2.12e-09 60 28 11 302 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
Q8X4M5 3.41e-09 60 35 1 116 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P52696 4.2e-09 60 24 9 294 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P0A9G1 4.49e-09 60 25 9 270 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 4.49e-09 60 25 9 270 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 4.49e-09 60 25 9 270 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
A0T0G2 7.52e-09 59 23 8 249 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P0A2Q4 8.83e-09 58 26 9 270 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 8.83e-09 58 26 9 270 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P73123 1.14e-08 58 27 11 269 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YQ82 1.34e-08 58 25 10 305 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P77559 1.84e-08 58 26 10 309 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P52665 2.19e-08 55 46 0 62 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P30864 2.48e-08 57 24 2 177 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
Q9HWH8 2.67e-08 57 28 0 128 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52685 3.17e-08 57 30 2 143 3 mauR Mau operon transcriptional activator Paracoccus denitrificans
P16931 3.31e-08 57 33 2 128 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P94501 4.15e-08 57 30 1 120 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P96725 5.34e-08 56 31 3 124 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
Q55459 7.73e-08 56 31 5 133 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9X5P2 8.71e-08 56 36 3 131 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P76250 9.69e-08 55 28 1 144 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
P77744 1.14e-07 55 25 6 176 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
A1JI47 1.95e-07 55 32 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JQ39 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 2.6e-07 54 31 0 115 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7Z5E4 4.17e-07 53 31 2 129 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P49518 4.3e-07 53 32 5 136 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
Q44311 5e-07 53 28 3 129 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
P0ACR4 5.85e-07 53 26 6 189 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 5.85e-07 53 26 6 189 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 5.85e-07 53 26 6 189 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
Q04778 7.74e-07 53 29 1 124 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q8KA72 8.59e-07 53 31 2 116 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P52686 1.47e-06 52 31 5 145 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
O68014 1.52e-06 52 30 4 127 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P94403 1.63e-06 52 29 4 121 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
O33945 1.79e-06 52 29 4 157 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P37682 1.84e-06 52 24 9 278 3 yiaU Uncharacterized HTH-type transcriptional regulator YiaU Escherichia coli (strain K12)
P96194 2.12e-06 50 36 0 84 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
Q1R6S1 2.53e-06 51 22 4 174 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 2.53e-06 51 22 4 174 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O19892 3.38e-06 51 24 8 264 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P0ACR8 4.16e-06 50 28 3 167 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 4.16e-06 50 28 3 167 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
Q0TD46 4.26e-06 50 22 4 174 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P45463 4.42e-06 50 22 4 174 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
P52670 5.13e-06 50 40 1 83 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9JXW7 6.77e-06 50 29 1 129 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B7NU32 7.06e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q329U3 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B2TU26 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I4A0 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 7.19e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P52689 7.21e-06 50 27 4 135 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P45349 7.35e-06 50 29 4 138 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3YVK2 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 7.39e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LUJ5 7.53e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NF72 7.53e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q1R4H3 7.6e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 7.6e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 7.6e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 7.6e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 7.6e-06 50 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q9JPU9 9.15e-06 50 28 1 129 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P20668 9.18e-06 50 29 1 122 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
B4TNR5 9.78e-06 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
B4SYF7 9.87e-06 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P52666 1.05e-05 49 40 0 64 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
B5FN59 1.05e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
P77700 1.07e-05 49 36 3 92 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P0A2Q0 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 1.07e-05 49 47 0 61 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
O32255 1.08e-05 49 28 5 138 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P0A4T7 1.08e-05 49 28 1 136 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 1.08e-05 49 28 1 136 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
P67662 1.44e-05 49 27 3 145 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 1.44e-05 49 27 3 145 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 1.44e-05 49 27 3 145 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
Q8XBK9 1.9e-05 48 21 4 174 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P72131 2.08e-05 48 25 5 258 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P77171 2.5e-05 48 29 2 155 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P70773 3.08e-05 48 29 4 141 3 argP HTH-type transcriptional regulator ArgP Aeromonas salmonicida
O06703 4.22e-05 48 36 0 79 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0ACR0 4.4e-05 47 45 0 60 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 4.4e-05 47 45 0 60 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
Q8FK66 4.56e-05 47 45 0 60 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 4.56e-05 47 45 0 60 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RF30 4.69e-05 47 45 0 60 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 4.69e-05 47 45 0 60 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
Q765S2 5.94e-05 47 27 6 182 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P25547 6.26e-05 47 28 4 147 3 gbpR HTH-type transcriptional regulator GbpR Rhizobium radiobacter
P39592 9.4e-05 47 26 2 120 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P52677 0.000104 46 29 1 125 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
A4QH19 0.000123 46 42 0 61 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q47141 0.000126 46 43 0 60 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P67660 0.000129 46 37 1 90 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 0.000129 46 37 1 90 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
P58508 0.000147 46 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella typhi
P33634 0.000164 46 27 7 162 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P52661 0.000198 45 26 2 140 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
Q57748 0.000221 45 36 1 73 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P58509 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TV33 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella schwarzengrund (strain CVM19633)
B5BFM9 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi A (strain AKU_12601)
C0PY38 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi C (strain RKS4594)
A9N3P8 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJH0 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T5G4 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella newport (strain SL254)
B4THE6 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella heidelberg (strain SL476)
Q57K51 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella choleraesuis (strain SC-B67)
B5F5I9 0.000247 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella agona (strain SL483)
O87883 0.00025 44 30 2 128 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
P94387 0.000284 45 27 2 115 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
B5RE25 0.000379 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXJ1 0.000379 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella enteritidis PT4 (strain P125109)
B5FUH7 0.000379 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella dublin (strain CT_02021853)
A9MRG1 0.0004 45 24 6 250 3 argP HTH-type transcriptional regulator ArgP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MR91 0.000411 44 24 6 250 3 argP HTH-type transcriptional regulator ArgP Cronobacter sakazakii (strain ATCC BAA-894)
P74422 0.000553 44 29 3 124 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P39127 0.000733 43 34 0 61 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
O07906 0.000762 43 24 1 110 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
B7NHX5 0.000803 43 24 6 250 3 argP HTH-type transcriptional regulator ArgP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8APC5 0.000871 43 24 6 250 3 argP HTH-type transcriptional regulator ArgP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XUC3 0.001 43 23 6 250 3 argP HTH-type transcriptional regulator ArgP Klebsiella pneumoniae (strain 342)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_07585
Feature type CDS
Gene ampR
Product LysR family transcriptional regulator AmpR
Location 253919 - 254794 (strand: -1)
Length 876 (nucleotides) / 291 (amino acids)

Contig

Accession ZDB_216
Length 269970 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3097
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K17850 LysR family transcriptional regulator, regulator of gene expression of beta-lactamase beta-Lactam resistance -

Protein Sequence

MVRRYLPLNPLRAFEAAARHLSFTRAAIELNVTHAAVSQQVRALEEQLGCVLFTRVSRGLVLTHEGEGLLPVLNEAFDRIADTLECFSHGQFRERVKVGAVGTFAAGWLLPRLAGFYDSHPHIDLHISTHNNHVDPAAEGHDYTIRFGNGAWHESDAELIFSAPHAPLCSPAIAEQLQQPDDVHRFTLLRSFRRDEWSRWLDCAGGTPPSPSQPVMVFDTSLAMAEAAQLGAGVAIAPVCMFSRLLQSGALVQPFAAEITLGGYWLTRLQSRTETPAMQQFARWLLNTAAA

Flanking regions ( +/- flanking 50bp)

ACAAACGGTTATTTATAACAAGAGCCTAAAGAAAAACTTACAGGTGGATTATGGTCAGACGTTATCTCCCCCTTAACCCGCTGCGCGCCTTTGAGGCCGCCGCCCGTCATCTCAGTTTTACCCGCGCGGCGATTGAGCTGAATGTCACCCATGCCGCCGTCAGCCAGCAGGTCAGGGCGCTGGAAGAACAACTCGGCTGTGTGCTGTTTACCCGCGTCTCGCGCGGGCTGGTGCTGACCCATGAAGGTGAGGGATTACTGCCGGTGCTCAATGAGGCGTTTGACCGGATTGCGGATACTCTGGAGTGTTTTTCTCACGGGCAGTTCCGTGAGCGGGTGAAAGTCGGTGCGGTGGGAACATTTGCCGCAGGCTGGCTGCTGCCGCGTCTGGCCGGATTCTATGACAGCCATCCGCATATTGATCTGCATATCTCCACCCATAACAATCATGTGGACCCGGCGGCGGAAGGGCATGATTATACGATCCGTTTCGGTAACGGCGCATGGCATGAATCGGATGCGGAACTGATTTTCAGTGCGCCGCACGCCCCGCTGTGCTCTCCGGCCATTGCAGAACAGTTACAGCAGCCGGATGATGTTCACCGCTTTACCCTGCTGCGCTCATTCCGCCGGGATGAATGGAGCCGCTGGCTGGATTGTGCGGGCGGCACACCGCCTTCCCCGTCACAGCCGGTAATGGTGTTCGATACCTCACTGGCCATGGCCGAGGCGGCACAACTGGGTGCCGGGGTAGCGATCGCACCGGTATGCATGTTCAGCCGCCTGTTGCAGTCAGGCGCACTGGTACAGCCGTTTGCCGCTGAAATCACCCTCGGCGGCTACTGGCTGACGCGGTTACAGTCCCGTACGGAAACCCCGGCCATGCAGCAATTCGCCCGCTGGCTGCTGAATACGGCGGCGGCGTAAAACTCACTCACCTTCCAGGCTTTTTACCCGCAAATCATCACCTTCACTGA