Homologs in group_2652

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04470 FBDBKF_04470 100.0 Morganella morganii S1 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
NLDBIP_06080 NLDBIP_06080 100.0 Morganella morganii S4 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
LHKJJB_02960 LHKJJB_02960 100.0 Morganella morganii S3 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
HKOGLL_06435 HKOGLL_06435 100.0 Morganella morganii S5 aRO8 DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
F4V73_RS08920 F4V73_RS08920 86.7 Morganella psychrotolerans - PLP-dependent aminotransferase family protein

Distribution of the homologs in the orthogroup group_2652

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2652

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P77730 2.91e-78 254 32 6 477 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
P39389 2.91e-66 223 30 11 476 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
Q5HJR1 7.39e-40 152 25 9 447 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain COL)
Q2G1P1 7.39e-40 152 25 9 447 1 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKF1 7.39e-40 152 25 9 447 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain USA300)
Q7A875 1.86e-38 148 25 9 447 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain N315)
Q99XA5 1.86e-38 148 25 9 447 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q796Q6 2.38e-38 149 24 11 485 3 yisV Uncharacterized HTH-type transcriptional regulator YisV Bacillus subtilis (strain 168)
Q2YUS3 6.05e-38 147 25 9 447 3 norG HTH-type transcriptional regulator NorG Staphylococcus aureus (strain bovine RF122 / ET3-1)
H3ZPL1 3.16e-36 141 27 8 332 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
P96681 8.83e-35 139 24 13 495 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
Q72LL6 2.52e-32 130 28 6 322 1 lysN 2-aminoadipate transaminase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P95957 2.42e-30 125 26 5 313 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q08792 5.62e-27 116 24 9 370 3 ycxD Uncharacterized HTH-type transcriptional regulator YcxD Bacillus subtilis (strain 168)
P49309 8.13e-25 110 25 13 440 3 mocR Probable rhizopine catabolism regulatory protein MocR Rhizobium meliloti
D5AKX9 1.32e-17 88 25 16 499 1 tauR HTH-type transcriptional regulator TauR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P96669 1.8e-17 88 24 19 480 3 ydeL Uncharacterized HTH-type transcriptional regulator YdeL Bacillus subtilis (strain 168)
Q9WVM8 5.05e-17 86 26 9 318 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
Q8N5Z0 7.33e-16 83 27 9 318 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
Q93703 1.82e-15 82 24 13 343 1 tatn-1 Tyrosine aminotransferase Caenorhabditis elegans
P94426 1.99e-15 82 23 10 399 1 gabR HTH-type transcriptional regulatory protein GabR Bacillus subtilis (strain 168)
Q5E9N4 2.56e-15 81 26 11 320 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
Q56232 6.78e-15 79 29 14 307 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P40193 3.28e-14 77 25 17 436 1 ptsJ Vitamin B6 salvage pathway transcriptional repressor PtsJ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q64602 3.95e-14 77 25 12 329 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
O07578 1.91e-13 75 24 15 378 3 yhdI Uncharacterized HTH-type transcriptional regulator YhdI Bacillus subtilis (strain 168)
Q54K00 2.14e-13 75 23 9 329 3 DDB_G0287711 Aromatic amino acid aminotransferase DDB_G0287711 Dictyostelium discoideum
O58489 8.14e-13 73 24 6 246 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P04694 3.74e-12 71 26 6 193 1 Tat Tyrosine aminotransferase Rattus norvegicus
Q60317 3.82e-12 71 25 4 188 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P96663 1.28e-11 70 21 13 408 3 ydeF Uncharacterized HTH-type transcriptional regulator YdeF Bacillus subtilis (strain 168)
Q8QZR1 2.01e-11 69 26 6 193 1 Tat Tyrosine aminotransferase Mus musculus
Q01856 2.07e-11 69 22 15 464 3 RHOS4_30730 Uncharacterized HTH-type transcriptional regulator RHOS4_30730 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
D4AU29 8.96e-11 67 24 14 347 3 swnA Aminotransferase swnA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
O14192 1.53e-10 66 22 9 338 3 SPAC56E4.03 Aromatic amino acid aminotransferase C56E4.03 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q82DR2 1.65e-10 66 26 17 343 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q58CZ9 1.79e-10 66 26 6 193 2 TAT Tyrosine aminotransferase Bos taurus
Q08432 1.9e-10 66 23 10 299 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
O33822 2.04e-10 65 26 18 342 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q9X0Y2 4.78e-10 64 24 12 306 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9FN30 5.43e-10 64 29 7 193 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
Q9SUR6 6.83e-10 64 24 13 345 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
Q60013 7.9e-10 64 25 13 338 3 aspC Aspartate aminotransferase Streptomyces virginiae
Q67Y55 8.2e-10 64 22 15 387 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
P17735 1.11e-09 63 27 7 196 1 TAT Tyrosine aminotransferase Homo sapiens
Q58097 1.18e-09 63 26 12 274 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P55683 1.38e-09 63 24 7 249 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P96847 2.41e-09 62 25 15 344 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9LVY1 2.73e-09 62 25 9 269 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q9Y7S6 2.74e-09 62 23 13 319 3 SPCC569.07 Aromatic amino acid aminotransferase C569.07 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54K95 2.78e-09 62 25 4 182 3 tat Tyrosine aminotransferase Dictyostelium discoideum
Q795M6 2.94e-09 62 24 17 342 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q8NS92 3.56e-09 62 25 14 360 3 pdxR HTH-type pyridoxine biosynthesis transcriptional regulator PdxR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A0A0P0VI36 5.22e-09 62 20 10 334 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
P16524 5.48e-09 61 23 13 313 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
O52815 5.68e-09 61 25 14 342 1 hpgT (S)-3,5-dihydroxyphenylglycine transaminase Amycolatopsis orientalis
A7XRY8 5.8e-09 61 25 10 320 1 tdiD Aminotransferase tdiD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q98B00 6.13e-09 61 27 4 166 3 hisC3 Histidinol-phosphate aminotransferase 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P09053 8.06e-09 61 23 8 221 1 avtA Valine--pyruvate aminotransferase Escherichia coli (strain K12)
F8P1W6 1.21e-08 60 21 11 357 2 amt1 L-tyrosine:2-oxoglutarate aminotransferase amt1 Serpula lacrymans var. lacrymans (strain S7.9)
P14909 2.08e-08 59 20 19 351 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q86AG8 2.29e-08 60 23 6 255 3 DDB_G0272014 Aromatic amino acid aminotransferase DDB_G0272014 Dictyostelium discoideum
O67781 2.53e-08 59 24 13 316 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
P10356 2.65e-08 59 23 6 259 1 YER152C Uncharacterized protein YER152C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8VYP2 1.15e-07 57 21 14 353 2 At4g23590 Probable aminotransferase TAT4 Arabidopsis thaliana
E9L7A5 1.35e-07 57 21 15 322 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
B0K735 1.65e-07 56 23 8 252 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q16773 2.31e-07 56 24 8 253 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q30ZX9 4.1e-07 55 22 13 335 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0LEA5 7.81e-07 54 24 13 284 1 dapL LL-diaminopimelate aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
O93744 8.44e-07 54 23 7 199 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q58874 1.04e-06 54 22 10 288 3 MJ1479 Uncharacterized aminotransferase MJ1479 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9SIE1 1.37e-06 54 22 12 299 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
C6C2Z3 1.5e-06 53 22 13 291 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
P0A961 1.68e-06 53 21 8 269 3 alaA Glutamate-pyruvate aminotransferase AlaA Shigella flexneri
P0A959 1.68e-06 53 21 8 269 1 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli (strain K12)
P0A960 1.68e-06 53 21 8 269 3 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ST02 1.95e-06 53 21 10 267 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
Q4J8X2 2.02e-06 53 20 17 347 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
B8CX89 2.28e-06 53 24 12 282 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B0K625 4.61e-06 52 22 9 252 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
Q9SIV0 4.77e-06 52 23 6 193 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
B3Q8Z5 8.95e-06 51 25 8 236 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 8.95e-06 51 25 8 236 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3Z8H5 9.85e-06 51 22 15 420 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
P71348 1.2e-05 51 24 11 270 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3J7H2 1.71e-05 50 22 8 245 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q39K90 1.96e-05 50 26 13 293 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8KDS8 2e-05 50 25 15 273 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P53001 3.19e-05 49 21 15 337 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
Q3AC10 3.52e-05 49 23 15 325 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3M504 4.03e-05 49 26 5 173 3 hisC1 Histidinol-phosphate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9C969 5e-05 49 23 15 324 1 ISS1 Aromatic aminotransferase ISS1 Arabidopsis thaliana
P22405 6.06e-05 48 44 0 67 4 korA Protein KorA Streptomyces lividans
Q824A4 6.64e-05 48 25 8 195 3 dapL LL-diaminopimelate aminotransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q8R5Q4 6.94e-05 48 24 6 231 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8KD01 7.79e-05 48 25 4 157 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9W698 8.89e-05 48 24 9 208 3 accs 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Takifugu rubripes
B8FP20 9.03e-05 48 24 5 194 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B4U9L1 0.0001 48 24 7 204 3 hisC Histidinol-phosphate aminotransferase Hydrogenobaculum sp. (strain Y04AAS1)
Q9ST03 0.000102 48 20 11 267 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
A5V022 0.000108 48 26 9 203 3 hisC Histidinol-phosphate aminotransferase Roseiflexus sp. (strain RS-1)
P77434 0.000128 47 23 12 292 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
B7STY2 0.000129 48 22 10 293 1 atrD L-tyrosine:2-oxoglutarate aminotransferase atrD Tapinella panuoides
Q84CG1 0.000136 47 28 8 182 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q07IG8 0.00015 47 22 11 321 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
Q8DTQ4 0.000153 47 25 7 178 3 hisC Histidinol-phosphate aminotransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O31665 0.000174 47 22 11 290 1 mtnE L-glutamine--4-(methylsulfanyl)-2-oxobutanoate aminotransferase Bacillus subtilis (strain 168)
O87320 0.00018 47 21 12 292 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
Q20YH9 0.000195 47 26 14 263 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
Q3ZXC8 0.000209 47 23 17 424 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
Q63Q87 0.00021 47 26 8 243 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain K96243)
Q62GE0 0.00021 47 26 8 243 3 hisC1 Histidinol-phosphate aminotransferase 1 Burkholderia mallei (strain ATCC 23344)
Q3JMZ7 0.000232 47 26 8 243 3 hisC2 Histidinol-phosphate aminotransferase 2 Burkholderia pseudomallei (strain 1710b)
Q9PBC6 0.000259 47 27 7 178 3 hisC Histidinol-phosphate aminotransferase Xylella fastidiosa (strain 9a5c)
Q9V0L2 0.000314 46 20 17 390 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
A5FRC5 0.000321 46 25 14 327 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q24QJ1 0.00033 46 24 5 194 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
Q9KCA8 0.000331 46 24 9 204 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0ACL4 0.000332 45 29 1 91 3 exuR Exu regulon transcriptional regulator Shigella flexneri
P0ACL2 0.000332 45 29 1 91 4 exuR Exu regulon transcriptional regulator Escherichia coli (strain K12)
P0ACL3 0.000332 45 29 1 91 3 exuR Exu regulon transcriptional regulator Escherichia coli O157:H7
D5FKJ2 0.000335 46 26 7 188 3 mrsB L-aspartate:5-guanidino-3-methyl-2-oxopentanoate transaminase Pseudomonas syringae pv. syringae
P36692 0.000376 45 29 4 134 3 aspC Probable aspartate aminotransferase (Fragment) Streptomyces griseus
B0RSL5 0.000392 46 31 6 129 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain B100)
A0M287 0.000402 46 27 9 166 3 hisC Histidinol-phosphate aminotransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B4SGL8 0.000473 45 25 5 158 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q8DTM1 0.000503 45 21 13 342 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q3B3L3 0.000542 45 24 8 191 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q5F4K8 0.000645 45 23 17 319 1 AAT Aspartate aminotransferase Pinus pinaster
Q4UU41 0.000683 45 32 7 130 3 hisC Histidinol-phosphate aminotransferase Xanthomonas campestris pv. campestris (strain 8004)
A8MEH2 0.000697 45 24 12 246 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
B3ECG2 0.000715 45 25 5 160 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q3SV41 0.000865 45 28 8 173 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q0P5G4 0.000893 45 25 13 261 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
Q7VSZ0 0.001 45 24 7 232 3 hisC2 Histidinol-phosphate aminotransferase 2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9SAR0 0.001 45 23 10 260 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
Q11DR9 0.001 45 27 7 173 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
B1I544 0.001 45 25 12 274 3 dapL LL-diaminopimelate aminotransferase Desulforudis audaxviator (strain MP104C)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_05760
Feature type CDS
Gene aRO8
Product DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain
Location 147018 - 148439 (strand: 1)
Length 1422 (nucleotides) / 473 (amino acids)

Contig

Accession ZDB_215
Length 284267 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2652
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II
PF00392 Bacterial regulatory proteins, gntR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1167 Transcription (K)
Amino acid transport and metabolism (E)		 KE DNA-binding transcriptional regulator, MocR family, contains an aminotransferase domain

Protein Sequence

MVQLPRYRQMADQIKQAVREGVLPPDSRLPSVRVLAAQYNVSLTTALKVLRTLEDEHVAVARPKSGFFVATVQPAAAESRNTETHTADFAPLDEQTELHMSMVGEECRVRLDLANGRRELYPVRKLSLIMRQLSYSKPFLLGDSVKGTGYAPLKEEIARRAVSYGCHITPETLLITNGCIEALSLALRATLSPGDAVAVESPCYFVLLQMLRNLNLRLTEVDACENGYVDCDKLTALFRRKAVKAFVTLANVNNPLGKTIPDEVKAEITRQADENGVIIIEDDTFGDAAFGGQRPFPMRAFSHNVILCSGFSKTIAPGVRIGWVHSQHYMRKITSLKYTSSMGSQVLPQAAISELLSNGGYDAHLRRLRRELAAQVQNIRRVVLREFPPGTTVTEPKGGYVLWVTMPEGSLNVRELFLNARAEGIGIAPGHIFATDNRYDRCFRLNAGFGCDKDVEDAIARLAQWCRESLHTG

Flanking regions ( +/- flanking 50bp)

AACGTACTCTTACAGAAACACACAGAACCCGTAAGAATGAGGCAGAACAGATGGTACAGCTTCCGCGCTACCGGCAGATGGCCGATCAGATAAAACAGGCTGTCCGCGAGGGCGTTTTACCGCCGGACAGCCGTCTGCCGTCCGTCCGTGTTCTGGCCGCACAGTACAATGTCAGCCTGACCACCGCCCTGAAAGTGCTGCGCACGCTGGAAGATGAGCATGTTGCCGTGGCGCGGCCGAAATCCGGCTTTTTTGTCGCCACGGTTCAGCCTGCCGCAGCGGAAAGCCGCAATACAGAGACACACACCGCCGATTTTGCCCCTCTGGATGAACAGACGGAACTGCATATGTCGATGGTCGGCGAAGAGTGCCGTGTCCGGCTCGATCTGGCTAACGGCCGCCGGGAACTTTATCCGGTCAGAAAGCTGAGTCTTATCATGCGCCAGCTCAGTTACAGCAAGCCGTTCCTGCTGGGGGATTCGGTCAAAGGCACCGGATATGCCCCGCTGAAAGAGGAAATTGCCCGCCGCGCAGTCAGTTACGGTTGCCATATCACACCGGAAACCCTGCTTATCACCAACGGCTGTATTGAAGCCTTATCACTGGCACTGCGCGCCACGCTCAGCCCCGGGGATGCGGTGGCAGTGGAATCCCCCTGTTACTTTGTACTGCTGCAGATGCTGCGTAATCTCAATCTGCGGCTGACCGAAGTGGATGCCTGTGAAAACGGTTATGTCGATTGCGATAAACTCACCGCCCTGTTCCGCCGCAAAGCGGTAAAAGCTTTTGTGACACTCGCCAACGTCAATAATCCGCTGGGCAAAACGATTCCGGATGAAGTCAAAGCGGAGATAACCCGTCAGGCGGATGAAAACGGTGTGATCATTATTGAGGATGATACTTTCGGTGATGCCGCATTCGGCGGGCAGCGCCCGTTCCCGATGCGGGCATTCAGTCACAATGTCATTCTGTGCAGCGGATTTTCCAAAACCATCGCACCCGGCGTGCGTATCGGCTGGGTTCACAGTCAGCATTACATGCGCAAAATCACCTCCCTCAAATACACCTCCTCGATGGGCTCTCAGGTCCTGCCGCAGGCAGCTATCAGCGAACTGCTGAGCAACGGTGGCTATGATGCTCATCTGCGCCGCCTGCGCCGTGAACTGGCGGCACAGGTGCAGAACATCCGCCGTGTTGTGTTGCGGGAATTTCCGCCGGGCACCACCGTGACCGAACCGAAAGGCGGTTATGTTCTGTGGGTCACCATGCCGGAAGGCAGCCTGAATGTGCGGGAGCTGTTTCTCAATGCACGGGCGGAGGGGATCGGCATCGCGCCGGGACATATCTTTGCCACCGACAACCGCTATGATCGCTGTTTCCGGCTCAACGCCGGGTTCGGCTGTGATAAGGACGTGGAGGATGCGATCGCCCGGCTGGCTCAGTGGTGCCGGGAATCATTACACACCGGATAACCCGGGGCTGACTGTTCTGTTTCTGCAACAGTGAAACCCGTTTTCATGAC