Homologs in group_1218

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07090 FBDBKF_07090 100.0 Morganella morganii S1 trxB thioredoxin-disulfide reductase
NLDBIP_03880 NLDBIP_03880 100.0 Morganella morganii S4 trxB thioredoxin-disulfide reductase
LHKJJB_09710 LHKJJB_09710 100.0 Morganella morganii S3 trxB thioredoxin-disulfide reductase
HKOGLL_09265 HKOGLL_09265 100.0 Morganella morganii S5 trxB thioredoxin-disulfide reductase
F4V73_RS01275 F4V73_RS01275 91.5 Morganella psychrotolerans trxB thioredoxin-disulfide reductase
PMI_RS03420 PMI_RS03420 85.5 Proteus mirabilis HI4320 trxB thioredoxin-disulfide reductase

Distribution of the homologs in the orthogroup group_1218

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1218

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9P4 0.0 553 83 2 321 1 trxB Thioredoxin reductase Escherichia coli (strain K12)
P0A9P5 0.0 553 83 2 321 3 trxB Thioredoxin reductase Escherichia coli O157:H7
Q9KSS4 0.0 536 81 1 315 3 trxB Thioredoxin reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P43788 9.69e-176 491 75 1 315 1 trxB Thioredoxin reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93HX6 1.72e-166 468 71 2 319 1 None Glucosaminate ammonia-lyase Pseudomonas fluorescens
P39916 4.3e-158 447 66 2 317 3 trxB Thioredoxin reductase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P81433 4.74e-146 416 58 2 319 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57399 1.65e-134 387 57 2 318 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AJ2 1.79e-132 382 59 4 313 3 trxB Thioredoxin reductase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1RJD8 4.63e-117 343 53 6 313 3 trxB Thioredoxin reductase Rickettsia bellii (strain RML369-C)
Q92I02 3.68e-116 340 54 6 313 3 trxB Thioredoxin reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULP1 5.11e-114 335 53 6 312 3 trxB Thioredoxin reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68WT3 8.34e-110 324 51 6 312 3 trxB Thioredoxin reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZD97 1.44e-109 323 50 6 312 3 trxB Thioredoxin reductase Rickettsia prowazekii (strain Madrid E)
Q05741 1.5e-100 301 50 6 315 1 trxB Thioredoxin reductase Streptomyces clavuligerus
O30973 5.74e-100 299 50 5 306 3 trxB Thioredoxin reductase Mycolicibacterium smegmatis
Q9PKT7 7.87e-100 299 49 8 317 3 trxB Thioredoxin reductase Chlamydia muridarum (strain MoPn / Nigg)
P52215 3.39e-99 298 49 6 313 2 trxB Thioredoxin reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O84101 1.05e-98 296 48 8 318 3 trxB Thioredoxin reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q75CM8 1.24e-98 296 49 6 323 3 TRR1 Thioredoxin reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6FR39 9.38e-98 294 49 8 324 3 TRR1 Thioredoxin reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P29509 2.17e-97 293 48 6 323 1 TRR1 Thioredoxin reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Z8M4 3.72e-96 290 50 9 319 3 trxB Thioredoxin reductase Chlamydia pneumoniae
P9WHH1 5.4e-96 290 49 6 308 1 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH0 5.4e-96 290 49 6 308 3 trxB Thioredoxin reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P38816 9.16e-96 290 48 6 322 1 TRR2 Thioredoxin reductase 2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6HA24 6.81e-95 288 47 6 323 3 TRR1 Thioredoxin reductase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
O22229 7.21e-95 293 49 7 315 1 NTRC NADPH-dependent thioredoxin reductase 3 Arabidopsis thaliana
P51978 5.39e-93 282 47 7 320 3 cys-9 Thioredoxin reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q70G58 1.64e-92 287 47 7 313 1 Os07g0657900 Thioredoxin reductase NTRC Oryza sativa subsp. japonica
P46843 5.51e-90 279 48 6 316 3 trxB/A Bifunctional thioredoxin reductase/thioredoxin Mycobacterium leprae (strain TN)
Q6BIS1 1.1e-89 273 45 6 320 3 TRR1 Thioredoxin reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q54UU8 2.36e-88 270 45 7 327 3 trrA Thioredoxin reductase Dictyostelium discoideum
Q92375 5.6e-88 269 45 7 326 1 trr1 Thioredoxin reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q39242 1.16e-87 270 45 8 327 2 NTR2 Thioredoxin reductase 2 Arabidopsis thaliana
Q6C7L4 1.49e-87 268 45 6 320 3 TRR1 Thioredoxin reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q7Z7S3 1.3e-86 266 44 6 311 2 TRR1 Thioredoxin reductase Pneumocystis carinii
Q8J0U0 1.16e-84 261 44 7 311 2 TRR1 Thioredoxin reductase Pneumocystis jirovecii
P43496 1.56e-84 261 43 7 326 1 TRR1 Thioredoxin reductase Penicillium chrysogenum
Q39243 3.22e-82 256 46 9 334 1 NTR1 Thioredoxin reductase 1, mitochondrial Arabidopsis thaliana
Q6ZFU6 6.39e-82 254 45 7 324 2 NTRB Thioredoxin reductase NTRB Oryza sativa subsp. japonica
Q69PS6 6.19e-77 242 47 7 321 3 Os06g0327300 Thioredoxin reductase NTRA Oryza sativa subsp. japonica
Q8T6Z1 1.12e-76 239 45 7 310 2 TRXB Thioredoxin reductase (Fragment) Spironucleus barkhanus
O32823 4.26e-67 216 40 6 315 3 trxB Thioredoxin reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q928B5 7.23e-67 215 41 6 309 3 trxB Thioredoxin reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P80880 1.24e-66 214 39 5 320 1 trxB Thioredoxin reductase Bacillus subtilis (strain 168)
P66011 2.2e-66 213 42 6 313 1 trxB Thioredoxin reductase Staphylococcus aureus (strain MW2)
Q6GB66 2.2e-66 213 42 6 313 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MSSA476)
P99101 2.2e-66 213 42 6 313 1 trxB Thioredoxin reductase Staphylococcus aureus (strain N315)
P66010 2.2e-66 213 42 6 313 3 trxB Thioredoxin reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHQ4 2.2e-66 213 42 6 313 3 trxB Thioredoxin reductase Staphylococcus aureus (strain COL)
Q8CPY8 2.96e-66 213 42 6 311 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW4 2.96e-66 213 42 6 311 3 trxB Thioredoxin reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GIM7 1.15e-65 211 42 6 313 3 trxB Thioredoxin reductase Staphylococcus aureus (strain MRSA252)
P50971 7.18e-65 209 39 5 313 1 trxB Thioredoxin reductase Peptoclostridium acidaminophilum
P52213 1.83e-64 209 39 6 314 3 trxB Thioredoxin reductase Peptoclostridium litorale
Q9ZL18 9.53e-62 201 37 5 311 3 trxB Thioredoxin reductase Helicobacter pylori (strain J99 / ATCC 700824)
P56431 2.05e-61 201 36 5 311 1 trxB Thioredoxin reductase Helicobacter pylori (strain ATCC 700392 / 26695)
P94284 2.24e-60 198 37 7 308 3 trxB Thioredoxin reductase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P23160 3.15e-55 184 33 7 315 3 None 34.2 kDa protein in rubredoxin operon Clostridium pasteurianum
O83790 4.45e-55 184 38 4 295 3 trxB Thioredoxin reductase Treponema pallidum (strain Nichols)
P47348 2.67e-51 175 36 7 302 3 trxB Thioredoxin reductase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q58931 1.27e-47 165 33 11 312 3 MJ1536 Putative thioredoxin reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O66790 4.85e-47 164 34 8 308 3 trxB Thioredoxin reductase Aquifex aeolicus (strain VF5)
Q9PR71 4.61e-44 155 35 9 314 3 trxB Thioredoxin reductase Ureaplasma parvum serovar 3 (strain ATCC 700970)
P75531 1.39e-41 149 35 7 288 3 trxB Thioredoxin reductase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P26829 1.91e-41 154 31 7 306 1 ahpF NADH dehydrogenase Ferdinandcohnia aciditolerans (strain JCM 32973 / CCTCC AB 2017280 / YN-1)
P0A156 6.89e-41 152 34 6 278 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida
P0A155 6.89e-41 152 34 6 278 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q98PK9 5.28e-39 142 31 9 315 3 trxB Thioredoxin reductase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q6GJR8 4.58e-37 141 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MRSA252)
P66013 6.14e-37 141 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MW2)
P99118 6.14e-37 141 32 8 293 1 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain N315)
P66012 6.14e-37 141 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GC92 6.8e-37 141 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MSSA476)
Q5HIR6 8.25e-37 140 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain COL)
O05204 8.25e-37 140 32 8 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain NCTC 8325 / PS 47)
P42974 1.96e-36 140 32 8 295 1 ahpF NADH dehydrogenase Bacillus subtilis (strain 168)
O06465 3.63e-36 139 32 7 285 3 ahpF Alkyl hydroperoxide reductase subunit F Xanthomonas campestris pv. phaseoli
Q5HRY2 6.02e-35 135 32 9 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CMQ1 6.46e-35 135 32 9 293 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9I6Z2 8.43e-35 135 32 6 282 3 ahpF Alkyl hydroperoxide reductase subunit F Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P35340 7.22e-34 133 30 7 297 1 ahpF Alkyl hydroperoxide reductase subunit F Escherichia coli (strain K12)
P19480 7.9e-34 133 32 9 299 1 ahpF Alkyl hydroperoxide reductase subunit F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5WDV1 3.35e-27 112 29 12 327 3 ABC2925 Ferredoxin--NADP reductase 2 Shouchella clausii (strain KSM-K16)
B2GEF7 4.75e-26 108 32 14 308 3 LAF_1703 Ferredoxin--NADP reductase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q928P3 3.07e-25 106 28 10 311 3 lin2489 Ferredoxin--NADP reductase 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y4P5 3.57e-25 106 29 10 311 3 lmo2390 Ferredoxin--NADP reductase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71X35 8.63e-25 105 28 10 311 3 LMOf2365_2364 Ferredoxin--NADP reductase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q82ZZ8 9.05e-25 105 28 10 306 3 EF_2899 Ferredoxin--NADP reductase Enterococcus faecalis (strain ATCC 700802 / V583)
A0AL74 1.43e-24 104 28 10 311 3 lwe2338 Ferredoxin--NADP reductase 2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q72LG3 1.74e-24 104 31 10 312 3 TT_C0096 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SL28 7.58e-24 102 30 10 312 1 TTHA0465 Ferredoxin--NADP reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B3QJ15 3.23e-23 101 28 15 333 3 Rpal_4475 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain TIE-1)
Q6N2U4 3.23e-23 101 28 15 333 1 RPA3954 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q13AK7 4.49e-23 100 28 16 334 3 RPD_1645 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB5)
Q2ITC6 1.16e-22 99 27 15 333 3 RPB_3841 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain HaA2)
Q9CF34 1.2e-22 99 25 8 302 3 LL1647 Ferredoxin--NADP reductase Lactococcus lactis subsp. lactis (strain IL1403)
A3CM39 5.95e-22 97 28 11 303 3 SSA_0813 Ferredoxin--NADP reductase Streptococcus sanguinis (strain SK36)
A4ISE6 7.5e-22 97 27 10 319 3 GTNG_2905 Ferredoxin--NADP reductase Geobacillus thermodenitrificans (strain NG80-2)
A8AXQ6 1.09e-21 96 28 11 303 3 SGO_1284 Ferredoxin--NADP reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q9K7F3 3.71e-21 95 27 12 324 3 BH3408 Ferredoxin--NADP reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4YER6 6.33e-21 94 27 12 322 3 Msed_0743 Ferredoxin--NADP reductase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
A0LXL9 7.36e-21 94 29 10 293 3 GFO_0125 Ferredoxin--NADP reductase 1 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q07RK6 1.65e-20 93 27 16 333 3 RPE_1478 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisA53)
Q02XL9 1.82e-20 93 25 8 302 3 LACR_1811 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain SK11)
Q219B6 2.18e-20 93 27 14 330 3 RPC_1458 Ferredoxin--NADP reductase Rhodopseudomonas palustris (strain BisB18)
A2RJC6 2.48e-20 92 25 8 302 3 llmg_0776 Ferredoxin--NADP reductase Lactococcus lactis subsp. cremoris (strain MG1363)
B5E6K6 4.9e-20 92 28 12 317 3 SPG_1489 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 19F (strain G54)
Q96YN9 7.56e-20 91 27 12 321 3 STK_21330 Ferredoxin--NADP reductase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
B2G9D0 8.68e-20 91 30 15 325 3 LAR_1546 Ferredoxin--NADP reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VM22 8.68e-20 91 30 15 325 3 Lreu_1657 Ferredoxin--NADP reductase Limosilactobacillus reuteri (strain DSM 20016)
A4YXZ8 9.49e-20 91 27 14 330 3 BRADO5079 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain ORS 278)
Q8DP13 1.02e-19 91 28 12 317 3 spr1421 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04JI5 1.02e-19 91 28 12 317 3 SPD_1393 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4JCM0 1.38e-19 90 25 11 324 3 Saci_0029 Ferredoxin--NADP reductase 1 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9ZD33 1.46e-19 90 28 12 309 3 RP514 Ferredoxin--NADP reductase Rickettsia prowazekii (strain Madrid E)
Q8ENX4 1.8e-19 90 28 13 321 3 OB2351 Ferredoxin--NADP reductase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B3QXE1 2.02e-19 90 27 14 333 3 Ctha_0950 Ferredoxin--NADP reductase 1 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B1ICY3 2.02e-19 90 27 12 317 3 SPH_1677 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain Hungary19A-6)
A5EMW5 2.54e-19 90 27 14 332 3 BBta_5550 Ferredoxin--NADP reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q03JS2 2.65e-19 90 28 11 306 3 STER_1382 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M3J6 2.65e-19 90 28 11 306 3 stu1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY3 2.65e-19 90 28 11 306 3 str1417 Ferredoxin--NADP reductase Streptococcus thermophilus (strain CNRZ 1066)
Q68WM0 3.54e-19 89 28 12 309 3 RT0500 Ferredoxin--NADP reductase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4J6Z4 8.46e-19 88 26 10 309 3 Saci_2144 Ferredoxin--NADP reductase 2 Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
B2IR81 8.52e-19 88 27 11 316 3 SPCG_1548 Ferredoxin--NADP reductase Streptococcus pneumoniae (strain CGSP14)
Q97PP0 8.52e-19 88 27 11 316 3 SP_1563 Ferredoxin--NADP reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97WJ5 8.71e-19 88 28 12 296 3 SSO2222 Ferredoxin--NADP reductase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8DYW9 1.35e-18 88 27 11 313 3 SAG1353 Ferredoxin--NADP reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E4H8 1.35e-18 88 27 11 313 3 gbs1423 Ferredoxin--NADP reductase Streptococcus agalactiae serotype III (strain NEM316)
Q3K0F9 1.35e-18 88 27 11 313 3 SAK_1384 Ferredoxin--NADP reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A0LY71 1.74e-18 88 29 11 296 3 GFO_0330 Ferredoxin--NADP reductase 2 Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B1YKW2 2.39e-18 87 28 13 307 3 Exig_2313 Ferredoxin--NADP reductase 1 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q5WAF1 2.4e-18 87 27 13 330 3 ABC0094 Ferredoxin--NADP reductase 1 Shouchella clausii (strain KSM-K16)
B2U9D2 4.3e-18 87 27 12 331 3 Rpic_0981 Ferredoxin--NADP reductase Ralstonia pickettii (strain 12J)
Q3STP0 5.38e-18 86 25 14 330 3 Nwi_1089 Ferredoxin--NADP reductase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B3WCB2 5.64e-18 86 27 14 316 3 LCABL_08900 Ferredoxin--NADP reductase Lacticaseibacillus casei (strain BL23)
Q89HV6 5.88e-18 86 25 12 331 3 bll5883 Ferredoxin--NADP reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q03AW0 7.13e-18 85 27 14 316 3 LSEI_0826 Ferredoxin--NADP reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q1QNQ1 9.29e-18 85 25 14 330 3 Nham_1321 Ferredoxin--NADP reductase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5KVP7 9.6e-18 85 26 12 319 3 GK2954 Ferredoxin--NADP reductase Geobacillus kaustophilus (strain HTA426)
Q71Y53 1.05e-17 85 26 12 328 3 LMOf2365_1991 Ferredoxin--NADP reductase 1 Listeria monocytogenes serotype 4b (strain F2365)
A8FH11 1.77e-17 85 27 13 322 3 BPUM_2873 Ferredoxin--NADP reductase 2 Bacillus pumilus (strain SAFR-032)
Q6L1Y6 1.9e-17 84 27 13 294 3 PTO0431 Ferredoxin--NADP reductase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A4VXW3 2.01e-17 84 26 9 286 3 SSU05_1986 Ferredoxin--NADP reductase Streptococcus suis (strain 05ZYH33)
A4W460 2.01e-17 84 26 9 286 3 SSU98_1991 Ferredoxin--NADP reductase Streptococcus suis (strain 98HAH33)
Q67QU3 2.23e-17 84 27 12 322 3 STH965 Ferredoxin--NADP reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q4ULM2 2.4e-17 84 26 12 307 3 RF_0700 Ferredoxin--NADP reductase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8DUN5 2.81e-17 84 28 12 306 3 SMU_869 Ferredoxin--NADP reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A5CF57 3.48e-17 84 25 10 300 3 OTBS_1841 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Boryong)
O05268 4.56e-17 84 27 13 327 1 yumC Ferredoxin--NADP reductase 2 Bacillus subtilis (strain 168)
Q1RHV1 4.98e-17 83 26 10 304 3 RBE_0982 Ferredoxin--NADP reductase Rickettsia bellii (strain RML369-C)
A7Z8C1 5.17e-17 83 27 13 322 3 RBAM_029160 Ferredoxin--NADP reductase 2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3CTT3 8.49e-17 83 25 10 302 3 OTT_1322 Ferredoxin--NADP reductase Orientia tsutsugamushi (strain Ikeda)
A8GW75 1.14e-16 82 25 10 304 3 A1I_03745 Ferredoxin--NADP reductase Rickettsia bellii (strain OSU 85-389)
A0LT79 1.15e-16 82 29 11 313 3 Acel_0866 Ferredoxin--NADP reductase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A8F1N2 1.34e-16 82 26 12 303 3 RMA_0647 Ferredoxin--NADP reductase Rickettsia massiliae (strain Mtu5)
B1HZ05 3.22e-16 81 26 11 291 3 Bsph_0789 Ferredoxin--NADP reductase 1 Lysinibacillus sphaericus (strain C3-41)
Q92A47 4.32e-16 80 24 12 326 3 lin2075 Ferredoxin--NADP reductase 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q03PJ4 4.4e-16 80 28 13 311 3 LVIS_1813 Ferredoxin--NADP reductase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
O31475 4.66e-16 80 26 15 323 1 ycgT Ferredoxin--NADP reductase 1 Bacillus subtilis (strain 168)
P80892 5.07e-16 73 85 0 41 1 trxB Thioredoxin reductase (Fragment) Aliivibrio fischeri
Q8ETS1 5.07e-16 80 23 12 326 3 OB0186 Ferredoxin--NADP reductase 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2W0C9 5.86e-16 80 26 11 305 3 amb3892 Ferredoxin--NADP reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A8GNK2 1.07e-15 80 26 11 304 3 A1C_03465 Ferredoxin--NADP reductase Rickettsia akari (strain Hartford)
B0BXN8 1.44e-15 79 26 12 308 3 RrIowa_0762 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Iowa)
A5FJT9 1.57e-15 79 27 10 292 3 Fjoh_1507 Ferredoxin--NADP reductase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A8M2W8 1.77e-15 79 28 12 308 3 Sare_0817 Ferredoxin--NADP reductase Salinispora arenicola (strain CNS-205)
B4SFQ3 2.02e-15 79 27 16 326 3 Ppha_1024 Ferredoxin--NADP reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A8GS72 2.06e-15 79 26 12 308 3 A1G_03605 Ferredoxin--NADP reductase Rickettsia rickettsii (strain Sheila Smith)
Q92HY3 2.12e-15 79 26 12 307 3 RC0637 Ferredoxin--NADP reductase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
B3QXR3 2.2e-15 79 26 13 310 3 Ctha_2529 Ferredoxin--NADP reductase 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q8Y5U4 2.31e-15 79 25 12 328 3 lmo1961 Ferredoxin--NADP reductase 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B4U394 2.31e-15 79 26 10 309 3 Sez_1109 Ferredoxin--NADP reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A0AK73 2.82e-15 78 24 12 326 3 lwe1987 Ferredoxin--NADP reductase 1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A8YTT2 9.08e-15 77 26 13 303 3 lhv_0465 Ferredoxin--NADP reductase Lactobacillus helveticus (strain DPC 4571)
Q48U54 1.05e-14 77 30 11 278 3 M28_Spy0638 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q03ZE9 1.06e-14 77 25 12 317 3 LEUM_0297 Ferredoxin--NADP reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B1HW35 1.22e-14 77 25 11 291 3 Bsph_2322 Ferredoxin--NADP reductase 3 Lysinibacillus sphaericus (strain C3-41)
A6H064 1.4e-14 77 27 11 295 3 FP1670 Ferredoxin--NADP reductase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q0RRX8 1.66e-14 76 27 12 309 3 FRAAL1022 Ferredoxin--NADP reductase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
B5XKX5 1.78e-14 76 29 11 278 3 Spy49_0668 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JHF5 2.11e-14 76 29 11 294 3 MGAS10270_Spy0716 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1J776 2.28e-14 75 30 11 278 3 MGAS10750_Spy0748 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M4 (strain MGAS10750)
P0DB07 2.3e-14 75 30 11 278 3 SPs1279 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB06 2.3e-14 75 30 11 278 3 SpyM3_0575 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q38YJ1 2.63e-14 75 25 12 312 3 LCA_0435 Ferredoxin--NADP reductase 2 Latilactobacillus sakei subsp. sakei (strain 23K)
A2RF47 2.86e-14 75 29 11 278 3 SpyM51151 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JMB2 2.86e-14 75 29 11 278 3 MGAS9429_Spy0712 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCC9 2.86e-14 75 29 11 278 3 MGAS2096_Spy0727 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8P1F2 2.86e-14 75 29 11 278 3 spyM18_0909 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCQ2 2.86e-14 75 29 11 278 3 M6_Spy0676 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2GJY7 3.08e-14 75 26 11 293 3 APH_0734 Ferredoxin--NADP reductase Anaplasma phagocytophilum (strain HZ)
Q9A0B5 3.18e-14 75 30 11 278 3 SPy_0850 Ferredoxin--NADP reductase Streptococcus pyogenes serotype M1
B1MX70 3.54e-14 75 27 12 310 3 LCK_00289 Ferredoxin--NADP reductase Leuconostoc citreum (strain KM20)
Q74KS6 3.94e-14 75 26 12 309 3 LJ_0501 Ferredoxin--NADP reductase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q65FE0 4.34e-14 75 25 13 327 3 BLi03393 Ferredoxin--NADP reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A9H9C9 4.52e-14 75 26 11 315 3 GDI0711 Ferredoxin--NADP reductase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A1SKI3 5.07e-14 75 26 14 314 3 Noca_2816 Ferredoxin--NADP reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B2IHR5 6.13e-14 75 26 15 330 3 Bind_2345 Ferredoxin--NADP reductase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A9NFF6 6.95e-14 74 25 12 309 3 ACL_0467 Ferredoxin--NADP reductase Acholeplasma laidlawii (strain PG-8A)
A8EYV4 7.39e-14 74 25 11 305 3 A1E_02985 Ferredoxin--NADP reductase Rickettsia canadensis (strain McKiel)
Q045M0 9.84e-14 73 26 14 316 3 LGAS_0447 Ferredoxin--NADP reductase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q0KCD1 1.15e-13 74 26 12 320 3 H16_A1199 Ferredoxin--NADP reductase 1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q88UC0 1.28e-13 73 26 13 309 3 lp_2585 Ferredoxin--NADP reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A7GUD5 1.31e-13 73 26 13 322 3 Bcer98_3539 Ferredoxin--NADP reductase 2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5FLU4 1.45e-13 73 26 11 290 3 LBA0439 Ferredoxin--NADP reductase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q3AS18 1.7e-13 73 26 11 307 3 Cag_0944 Ferredoxin--NADP reductase Chlorobium chlorochromatii (strain CaD3)
Q049B3 1.76e-13 73 26 14 307 3 LBUL_1466 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G967 1.76e-13 73 26 14 307 3 Ldb1586 Ferredoxin--NADP reductase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q4FMZ1 2.91e-13 72 23 14 317 3 SAR11_0627 Ferredoxin--NADP reductase Pelagibacter ubique (strain HTCC1062)
Q8Y0A5 3.1e-13 72 27 12 326 3 RSc1139 Ferredoxin--NADP reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A4SVT8 3.1e-13 72 27 12 290 3 Pnuc_0382 Ferredoxin--NADP reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q5FT88 3.15e-13 72 27 9 299 3 GOX0631 Ferredoxin--NADP reductase Gluconobacter oxydans (strain 621H)
A4X398 3.21e-13 72 28 15 311 3 Strop_0871 Ferredoxin--NADP reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q2JFM8 3.82e-13 72 26 12 303 3 Francci3_0530 Ferredoxin--NADP reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B3R4A7 3.95e-13 72 26 12 318 3 RALTA_A1176 Ferredoxin--NADP reductase 1 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q6HP49 4.47e-13 72 25 14 306 3 BT9727_0321 Ferredoxin--NADP reductase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZB7 4.47e-13 72 25 14 306 3 BA_0352 Ferredoxin--NADP reductase 1 Bacillus anthracis
A0R951 4.47e-13 72 25 14 306 3 BALH_0343 Ferredoxin--NADP reductase 1 Bacillus thuringiensis (strain Al Hakam)
Q473F6 8.67e-13 71 25 12 321 3 Reut_A1099 Ferredoxin--NADP reductase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A7HW48 1.09e-12 71 25 12 297 3 Plav_2522 Ferredoxin--NADP reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q5PAR7 1.17e-12 70 25 10 297 3 AM617 Ferredoxin--NADP reductase Anaplasma marginale (strain St. Maries)
Q0BQJ9 1.56e-12 70 28 10 294 3 GbCGDNIH1_2006 Ferredoxin--NADP reductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q65GY3 1.91e-12 70 25 15 323 3 BLi02810 Ferredoxin--NADP reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7GKN4 2.2e-12 70 22 11 305 3 Bcer98_0331 Ferredoxin--NADP reductase 1 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B1YEQ1 2.26e-12 70 24 13 298 3 Exig_2773 Ferredoxin--NADP reductase 2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q2RNR2 2.87e-12 70 26 10 306 3 Rru_A3439 Ferredoxin--NADP reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B1I067 2.91e-12 70 24 12 319 3 Bsph_0993 Ferredoxin--NADP reductase 2 Lysinibacillus sphaericus (strain C3-41)
Q816D9 4.1e-12 69 25 13 320 1 BC_4926 Ferredoxin--NADP reductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q632D6 4.21e-12 69 25 13 320 3 BCE33L4658 Ferredoxin--NADP reductase Bacillus cereus (strain ZK / E33L)
Q6HBX6 4.21e-12 69 25 13 320 3 BT9727_4639 Ferredoxin--NADP reductase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q72YF6 4.21e-12 69 25 13 320 3 BCE_5065 Ferredoxin--NADP reductase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81XS0 4.21e-12 69 25 13 320 3 BA_5160 Ferredoxin--NADP reductase 2 Bacillus anthracis
A0RKB9 4.21e-12 69 25 13 320 3 BALH_4465 Ferredoxin--NADP reductase 2 Bacillus thuringiensis (strain Al Hakam)
A4JS50 4.78e-12 69 26 13 308 3 Bcep1808_6193 Ferredoxin--NADP reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A4F891 7.34e-12 68 29 11 307 3 SACE_0932 Ferredoxin--NADP reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
B3CMJ8 7.39e-12 68 25 11 299 3 WP1010 Ferredoxin--NADP reductase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q3YS71 1.16e-11 68 24 10 287 3 Ecaj_0391 Ferredoxin--NADP reductase Ehrlichia canis (strain Jake)
A9VRK8 1.77e-11 67 25 15 307 3 BcerKBAB4_0332 Ferredoxin--NADP reductase 1 Bacillus mycoides (strain KBAB4)
A9VMZ3 1.93e-11 67 25 13 323 3 BcerKBAB4_4748 Ferredoxin--NADP reductase 2 Bacillus mycoides (strain KBAB4)
A8FB45 1.99e-11 67 25 14 328 3 BPUM_0777 Ferredoxin--NADP reductase 1 Bacillus pumilus (strain SAFR-032)
Q98M06 2.11e-11 67 25 15 313 3 mll0792 Ferredoxin--NADP reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q73EA6 2.62e-11 67 24 14 306 3 BCE_0452 Ferredoxin--NADP reductase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1WUT6 2.84e-11 67 24 14 314 3 LSL_0439 Ferredoxin--NADP reductase Ligilactobacillus salivarius (strain UCC118)
A8AA47 2.96e-11 66 27 8 309 3 Igni_0617 Ferredoxin--NADP reductase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A7Z171 3.55e-11 66 25 13 322 3 RBAM_003480 Ferredoxin--NADP reductase 1 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3QPZ8 4.15e-11 66 26 12 307 3 Cpar_1603 Ferredoxin--NADP reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q1LPH7 4.92e-11 66 25 11 318 3 Rmet_1063 Ferredoxin--NADP reductase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R5L8 5.22e-11 66 24 14 305 3 RALTA_A2094 Ferredoxin--NADP reductase 2 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B2JN27 6.44e-11 65 24 10 308 3 Bphy_3740 Ferredoxin--NADP reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q4L8N5 9.49e-11 65 25 16 296 3 SH0681 Ferredoxin--NADP reductase Staphylococcus haemolyticus (strain JCSC1435)
Q0K8J6 1e-10 65 25 14 305 3 H16_A2592 Ferredoxin--NADP reductase 2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q46YY3 1.11e-10 65 25 14 305 3 Reut_A2287 Ferredoxin--NADP reductase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A5FYH8 1.58e-10 64 25 9 305 3 Acry_1452 Ferredoxin--NADP reductase Acidiphilium cryptum (strain JF-5)
B4S9F8 1.84e-10 64 26 15 312 3 Paes_1610 Ferredoxin--NADP reductase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q1LKJ7 2.14e-10 64 24 14 305 3 Rmet_2452 Ferredoxin--NADP reductase 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q73GH2 3.81e-10 63 24 11 297 3 WD_0982 Ferredoxin--NADP reductase Wolbachia pipientis wMel
Q03H60 5.4e-10 63 23 13 319 3 PEPE_0366 Ferredoxin--NADP reductase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q04HB6 6.04e-10 63 28 6 197 3 OEOE_0163 Ferredoxin--NADP reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A1W6V2 6.48e-10 63 25 12 305 3 Ajs_1789 Ferredoxin--NADP reductase Acidovorax sp. (strain JS42)
Q2GGH5 1.17e-09 62 23 11 295 3 ECH_0649 Ferredoxin--NADP reductase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q8KCB2 1.18e-09 62 27 13 294 1 CT1512 Ferredoxin--NADP reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3EKW5 1.37e-09 62 26 10 292 3 Cphamn1_1733 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain BS1)
P43783 1.43e-09 62 28 13 250 3 gor Glutathione reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1BHP4 1.49e-09 62 25 13 294 3 Cpha266_1905 Ferredoxin--NADP reductase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q5HBC7 1.84e-09 61 23 10 293 3 Erum4020 Ferredoxin--NADP reductase Ehrlichia ruminantium (strain Welgevonden)
Q483W3 2.24e-09 61 23 12 290 3 CPS_1923 Ferredoxin--NADP reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B2T4Y1 2.41e-09 61 23 14 321 3 Bphyt_2243 Ferredoxin--NADP reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q5FH31 2.68e-09 61 22 10 293 3 ERGA_CDS_04100 Ferredoxin--NADP reductase Ehrlichia ruminantium (strain Gardel)
Q5GRV1 3.65e-09 60 23 11 301 3 Wbm0685 Ferredoxin--NADP reductase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q13Y97 6.56e-09 60 24 14 317 3 Bxeno_A2404 Ferredoxin--NADP reductase Paraburkholderia xenovorans (strain LB400)
Q51973 1.99e-08 58 26 13 300 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
D0VWY5 2.24e-08 58 29 9 224 1 garB Glutathione amide reductase Marichromatium gracile
Q60151 4.57e-08 57 31 10 195 3 gor Glutathione reductase Streptococcus thermophilus
A8Z076 6.73e-08 57 28 11 242 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300 / TCH1516)
A6QFI1 6.73e-08 57 28 11 242 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain Newman)
Q2FIA5 6.73e-08 57 28 11 242 1 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain USA300)
Q5HHB4 8.59e-08 57 29 10 221 3 cdr Coenzyme A disulfide reductase Staphylococcus aureus (strain COL)
Q4L4Y7 1.38e-07 56 28 11 222 3 cdr Coenzyme A disulfide reductase Staphylococcus haemolyticus (strain JCSC1435)
Q8EWR4 1.45e-07 55 22 14 307 3 MYPE1390 Ferredoxin--NADP reductase Malacoplasma penetrans (strain HF-2)
Q3B2Q8 1.82e-07 55 23 11 311 3 Plut_1516 Ferredoxin--NADP reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q2GCZ2 2.16e-07 55 23 10 316 3 NSE_0779 Ferredoxin--NADP reductase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
P06715 2.72e-07 55 29 11 221 1 gor Glutathione reductase Escherichia coli (strain K12)
Q8CPT6 7e-07 53 25 7 220 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQI9 7e-07 53 25 7 220 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1WQW2 7.55e-07 53 25 11 294 3 Veis_4316 Ferredoxin--NADP reductase Verminephrobacter eiseniae (strain EF01-2)
Q7NBE9 8.75e-07 53 21 13 297 3 MYCGA3300 Ferredoxin--NADP reductase Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q6GE59 9.65e-07 53 25 17 330 3 SAR2461 Ferredoxin--NADP reductase Staphylococcus aureus (strain MRSA252)
Q21VM4 1.23e-06 53 28 8 177 3 Rfer_2462 Ferredoxin--NADP reductase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B3EEF0 1.48e-06 52 26 9 291 3 Clim_1719 Ferredoxin--NADP reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q2YZ12 2.34e-06 52 25 17 330 3 SAB2252c Ferredoxin--NADP reductase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NV36 2.38e-06 52 25 17 330 3 MW2294 Ferredoxin--NADP reductase Staphylococcus aureus (strain MW2)
Q6G6U7 2.38e-06 52 25 17 330 3 SAS2264 Ferredoxin--NADP reductase Staphylococcus aureus (strain MSSA476)
O62768 2.4e-06 52 25 6 200 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Bos taurus
Q1IZM1 2.51e-06 52 27 13 298 3 Dgeo_1013 Ferredoxin--NADP reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
P47791 3.86e-06 52 28 11 232 1 Gsr Glutathione reductase, mitochondrial Mus musculus
Q8KCW2 5.63e-06 51 24 14 319 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P42435 7.51e-06 51 26 11 240 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
P50970 9.25e-06 50 26 15 337 3 lpd Dihydrolipoyl dehydrogenase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8U195 1.03e-05 50 26 15 351 1 sudA Sulfide dehydrogenase subunit alpha Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
B1XWQ5 1.17e-05 50 24 13 294 3 Lcho_2791 Ferredoxin--NADP reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q96NN9 1.27e-05 50 30 7 152 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens
A8Z563 1.29e-05 50 25 17 330 3 USA300HOU_2355 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300 / TCH1516)
Q99RQ5 1.29e-05 50 25 17 330 3 SAV2372 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJL4 1.29e-05 50 25 17 330 3 NWMN_2274 Ferredoxin--NADP reductase Staphylococcus aureus (strain Newman)
Q5HDI3 1.29e-05 50 25 17 330 3 SACOL2369 Ferredoxin--NADP reductase Staphylococcus aureus (strain COL)
A5IVF3 1.29e-05 50 25 17 330 3 SaurJH9_2396 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH9)
Q2FVP8 1.29e-05 50 25 17 330 1 SAOUHSC_02654 Ferredoxin--NADP reductase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEC4 1.29e-05 50 25 17 330 1 SAUSA300_2319 Ferredoxin--NADP reductase Staphylococcus aureus (strain USA300)
A6U499 1.29e-05 50 25 17 330 3 SaurJH1_2442 Ferredoxin--NADP reductase Staphylococcus aureus (strain JH1)
A7X5Z9 1.29e-05 50 25 17 330 3 SAHV_2356 Ferredoxin--NADP reductase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9LKC0 1.37e-05 50 27 6 160 2 YUC5 Probable indole-3-pyruvate monooxygenase YUCCA5 Arabidopsis thaliana
A4SFT9 1.56e-05 49 22 10 305 3 Cvib_1336 Ferredoxin--NADP reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
P00390 2.24e-05 49 27 10 231 1 GSR Glutathione reductase, mitochondrial Homo sapiens
Q38YM3 2.85e-05 48 27 9 194 3 LCA_0403 Ferredoxin--NADP reductase 1 Latilactobacillus sakei subsp. sakei (strain 23K)
O89049 3.34e-05 48 23 6 200 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Rattus norvegicus
Q0S032 4.12e-05 48 26 7 237 1 bphA4 Biphenyl 2,3-dioxygenase, ferredoxin reductase component Rhodococcus jostii (strain RHA1)
A1TRN6 4.37e-05 48 31 6 155 3 Aave_3058 Ferredoxin--NADP reductase Paracidovorax citrulli (strain AAC00-1)
A9C3H6 5.82e-05 47 22 11 306 3 Daci_4658 Ferredoxin--NADP reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
P42770 6.17e-05 48 27 9 195 2 EMB2360 Glutathione reductase, chloroplastic Arabidopsis thaliana
P48642 7.83e-05 47 24 8 201 2 GRC2 Glutathione reductase, cytosolic Oryza sativa subsp. japonica
Q43154 7.84e-05 47 23 8 217 2 None Glutathione reductase, chloroplastic (Fragment) Spinacia oleracea
Q43621 8.88e-05 47 24 9 202 2 None Glutathione reductase, cytosolic Pisum sativum
Q9JMH6 8.9e-05 47 24 7 201 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Mus musculus
Q7A3W1 9.99e-05 47 25 18 330 1 SA2162 Ferredoxin--NADP reductase Staphylococcus aureus (strain N315)
Q1QX78 0.000108 47 24 13 329 3 sthA Soluble pyridine nucleotide transhydrogenase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q49WB0 0.000126 47 28 11 205 3 cdr Coenzyme A disulfide reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A2TIL1 0.00015 47 29 13 239 2 GSR Glutathione reductase, mitochondrial Callithrix jacchus
O64489 0.000151 46 27 5 141 2 YUC9 Probable indole-3-pyruvate monooxygenase YUCCA9 Arabidopsis thaliana
M1W428 0.000152 46 25 15 307 2 tcpT Thioredoxin reductase tcpT Claviceps purpurea (strain 20.1)
P23189 0.000187 46 25 7 196 3 gor Glutathione reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3TY86 0.00028 46 29 7 152 1 Aifm3 Apoptosis-inducing factor 3 Mus musculus
Q5XC60 0.000396 45 26 13 259 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q16881 0.000576 45 24 7 201 1 TXNRD1 Thioredoxin reductase 1, cytoplasmic Homo sapiens
P50736 0.000584 44 23 13 313 1 bdr Bacilliredoxin reductase Bdr Bacillus subtilis (strain 168)
Q873E8 0.000588 45 27 7 176 3 gtr-1 Glutathione reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5NVA2 0.000604 45 23 7 201 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Pongo abelii
A0KEJ2 0.00067 44 27 6 203 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P70619 0.000692 44 27 12 233 2 Gsr Glutathione reductase (Fragment) Rattus norvegicus
Q9LK94 0.000788 44 26 10 240 1 MDAR4 Monodehydroascorbate reductase 4, peroxisomal Arabidopsis thaliana
Q5S3I2 0.000825 44 23 5 209 1 ddmA1 Dicamba O-demethylase 1, ferredoxin reductase component Stenotrophomonas maltophilia
A8GG95 0.000863 44 24 10 227 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Serratia proteamaculans (strain 568)
Q5S3I1 0.001 44 23 5 209 1 ddmA2 Dicamba O-demethylase 2, ferredoxin reductase component Stenotrophomonas maltophilia
Q49ZU9 0.001 43 22 13 297 3 SSP0530 Ferredoxin--NADP reductase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_03880
Feature type CDS
Gene trxB
Product thioredoxin-disulfide reductase
Location 101697 - 102656 (strand: 1)
Length 960 (nucleotides) / 319 (amino acids)

Contig

Accession ZDB_214
Length 335585 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1218
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF07992 Pyridine nucleotide-disulphide oxidoreductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0492 Posttranslational modification, protein turnover, chaperones (O) O Thioredoxin reductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00384 thioredoxin reductase (NADPH) [EC:1.8.1.9] Selenocompound metabolism -

Protein Sequence

MNATRHSKLIILGSGPAGYTAAVYAARANLNPVLITGVEVGGQLTTTTEVENWPGDPEGLTGPGLMERMQAHAEKFETEIINDYITEVDFSKRPFTLTGENTYTCDALIIATGASARYIGLPSEEAFKGRGVSACATCDGFFYRNQKVAVVGGGNTAVEEALYLSNIASEVHLIHRRDSFRAEKILISRLMDKVQNGNIVLHTDRTLDEVLGDQMGVTAVRLRDTKSDATEELPVMGCFIAIGHSPNTGIFEGHLDLENGYIRVQSGTHGNATQTSVPGVFAAGDVMDHIYRQAITSAGTGCMAALDAERYLDSLADSK

Flanking regions ( +/- flanking 50bp)

CTCCTACAATCCTGTACACGCTTTTTTGCCATTCTGTTAATGAGGTGTTCATGAACGCAACCCGACACAGTAAATTAATTATTCTGGGTTCCGGCCCTGCCGGATATACCGCTGCGGTTTATGCGGCACGGGCGAATTTAAATCCGGTGCTGATTACCGGGGTGGAAGTCGGTGGTCAGTTAACCACCACCACCGAAGTGGAAAACTGGCCGGGTGACCCGGAAGGTCTGACCGGACCGGGCCTGATGGAGCGTATGCAGGCTCACGCCGAAAAATTTGAGACTGAAATCATCAATGATTACATCACTGAAGTGGATTTCAGCAAACGCCCGTTTACCCTGACCGGGGAAAATACCTATACCTGTGACGCGCTGATTATCGCCACCGGCGCATCCGCCCGTTATATCGGCCTGCCGTCAGAAGAGGCCTTCAAAGGCCGTGGTGTGTCCGCCTGTGCCACCTGCGACGGCTTTTTCTACCGTAACCAGAAAGTCGCAGTGGTCGGCGGCGGTAACACTGCCGTGGAAGAGGCGCTGTATCTCTCCAATATCGCGTCAGAAGTGCATCTGATCCACCGCCGTGACAGCTTCCGCGCTGAAAAAATCCTTATCAGCCGTCTGATGGATAAGGTTCAGAACGGCAATATCGTTCTGCACACTGACCGTACCCTGGATGAAGTACTCGGCGACCAGATGGGTGTGACCGCTGTCCGTCTGCGTGACACCAAAAGTGACGCAACCGAAGAGCTGCCGGTGATGGGCTGCTTTATCGCCATCGGCCACAGTCCGAATACCGGTATTTTTGAGGGACATCTGGATCTGGAAAACGGCTATATCCGTGTTCAGTCCGGCACGCACGGTAATGCAACACAGACATCCGTTCCGGGTGTGTTTGCCGCCGGTGATGTGATGGATCATATCTACCGTCAGGCAATCACCTCTGCGGGAACCGGGTGCATGGCCGCACTGGATGCCGAGCGCTATCTCGACAGCCTCGCAGACAGCAAATAATCCAGCATTTTCAGGGCGCTATATCTGTAGCGCCTTTTCGTGTACCATGA