Homologs in group_722

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02215 FBDBKF_02215 100.0 Morganella morganii S1 tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
NLDBIP_00775 NLDBIP_00775 100.0 Morganella morganii S4 tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
LHKJJB_01260 LHKJJB_01260 100.0 Morganella morganii S3 tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
HKOGLL_01300 HKOGLL_01300 100.0 Morganella morganii S5 tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
F4V73_RS04585 F4V73_RS04585 84.1 Morganella psychrotolerans tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
PMI_RS05615 PMI_RS05615 63.9 Proteus mirabilis HI4320 tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB

Distribution of the homologs in the orthogroup group_722

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_722

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7CQE0 6.57e-103 300 64 0 230 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P76256 5.06e-97 285 62 0 230 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Escherichia coli (strain K12)
Q87RD1 9.52e-81 244 53 0 233 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P43990 1.83e-61 195 48 6 238 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9L9 2.61e-44 150 35 1 198 3 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57409 9.78e-42 144 31 2 223 3 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AI5 2.25e-35 128 29 3 231 3 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O05516 1.29e-17 81 32 3 149 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Bacillus subtilis (strain 168)
Q49857 8.4e-14 72 37 4 135 3 ML0378 Uncharacterized protein ML0378 Mycobacterium leprae (strain TN)
P65084 2.95e-12 67 36 2 130 3 BQ2027_MB3455C Uncharacterized protein Mb3455c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WKY7 2.95e-12 67 36 2 130 1 Rv3421c Uncharacterized protein Rv3421c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKY6 2.95e-12 67 36 2 130 3 MT3530 Uncharacterized protein MT3530 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2Y7B6 4.13e-11 65 36 2 88 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q47W35 4.85e-11 65 30 3 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
C1DB12 5.45e-11 64 38 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Laribacter hongkongensis (strain HLHK9)
B1XVZ2 5.53e-11 64 35 3 120 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q1GYU4 1.77e-10 63 40 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4SZK1 2.23e-10 63 47 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q474C0 6.01e-10 61 36 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0A5M7 6.56e-10 61 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0AJ91 8.12e-10 61 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0K862 9.64e-10 61 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B3R5H2 1e-09 61 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A0M1X3 1.01e-09 60 26 1 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q0VMU1 1.07e-09 60 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
B4EW57 1.86e-09 60 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Proteus mirabilis (strain HI4320)
B0TIN7 2.34e-09 60 31 2 99 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella halifaxensis (strain HAW-EB4)
B1KHE2 2.85e-09 59 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q5QY46 3.29e-09 59 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B2FK06 3.51e-09 59 28 3 116 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Stenotrophomonas maltophilia (strain K279a)
B8CJF1 3.52e-09 59 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
B8F7W7 4.32e-09 59 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
B1JM18 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q665U5 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4THT1 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pestis (strain Pestoides F)
Q1CME2 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7E3 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q74RQ9 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pestis
B2K2I3 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C366 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FE71 4.65e-09 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q65RP0 5.79e-09 58 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P36175 6.52e-09 58 30 3 112 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Mannheimia haemolytica
A8H152 6.8e-09 58 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9L7A5 8.05e-09 58 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A4WEJ9 9.16e-09 58 27 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Enterobacter sp. (strain 638)
Q83C88 1.01e-08 58 30 4 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B2VGJ0 1.04e-08 58 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B0BQ60 1.24e-08 57 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GY07 1.24e-08 57 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1C4 1.24e-08 57 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1AXM9 1.28e-08 57 34 2 85 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ruthia magnifica subsp. Calyptogena magnifica
P43764 1.28e-08 57 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87B17 1.44e-08 57 33 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0U4B5 1.44e-08 57 33 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xylella fastidiosa (strain M12)
B2I7X4 1.44e-08 57 33 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xylella fastidiosa (strain M23)
C3LS11 1.46e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio cholerae serotype O1 (strain M66-2)
A5F9E8 1.46e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8FS64 1.54e-08 57 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella sediminis (strain HAW-EB3)
A3D1Q4 1.68e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q7N0B6 1.69e-08 57 27 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9PG67 1.71e-08 57 33 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xylella fastidiosa (strain 9a5c)
A9L5I3 1.71e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella baltica (strain OS195)
A6WKK4 1.71e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella baltica (strain OS185)
B8EBV5 1.71e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella baltica (strain OS223)
Q1BLY9 1.75e-08 57 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia orbicola (strain AU 1054)
B1K3S7 1.75e-08 57 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia orbicola (strain MC0-3)
A0AYZ2 1.75e-08 57 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia cenocepacia (strain HI2424)
B4EN31 1.78e-08 57 35 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q0HSD5 1.86e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella sp. (strain MR-7)
Q0HG42 1.86e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella sp. (strain MR-4)
A0KZT8 1.86e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella sp. (strain ANA-3)
Q32BQ3 1.93e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7ND53 1.93e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P05852 1.93e-08 57 26 3 112 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain K12)
B1XG69 1.93e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain K12 / DH10B)
C4ZQY1 1.93e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7UIX2 1.96e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1Z1G4 2.07e-08 57 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia ambifaria (strain MC40-6)
Q0BAL6 2.15e-08 57 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4SHI9 2.16e-08 57 33 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Stenotrophomonas maltophilia (strain R551-3)
B4RY33 2.39e-08 57 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q3IHX1 2.43e-08 57 27 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q393P6 2.79e-08 56 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2G4K2 2.95e-08 56 40 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2S8V7 3.04e-08 56 28 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Hahella chejuensis (strain KCTC 2396)
A1JQW9 3.29e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YXH9 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella sonnei (strain Ss046)
Q83Q42 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella flexneri
Q0T0J9 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella flexneri serotype 5b (strain 8401)
Q31WX0 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U1G7 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LQD8 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I436 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain SE11)
B1IRQ2 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A4M1 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O9:H4 (strain HS)
B7LZL4 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O8 (strain IAI1)
B7NJS7 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YRA4 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LGZ9 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZRU6 3.44e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8EHD6 3.45e-08 56 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1QYX8 3.57e-08 56 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8XBK3 3.68e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O157:H7
B9KRE8 3.85e-08 56 41 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A9ANA0 3.87e-08 56 34 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q4ZMF4 3.93e-08 56 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas syringae pv. syringae (strain B728a)
A3QBM3 3.96e-08 56 30 2 99 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q3J6D2 4.03e-08 56 41 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A6TE46 4.12e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A3PG14 4.18e-08 56 41 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q7NUE3 4.28e-08 56 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q88A57 4.32e-08 56 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B5XU22 4.35e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Klebsiella pneumoniae (strain 342)
Q1LK37 4.5e-08 56 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q48NU8 4.57e-08 56 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A7MJU0 4.78e-08 56 26 4 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q1LSM0 4.83e-08 56 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
B7VIH2 5.12e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio atlanticus (strain LGP32)
Q3B6I3 5.45e-08 55 30 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1S3S8 5.55e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q9I5V7 5.72e-08 55 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V4G6 6.34e-08 55 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas aeruginosa (strain LESB58)
A4Y4F3 6.59e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q2T7N3 7.24e-08 55 31 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6UZ83 7.36e-08 55 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas aeruginosa (strain PA7)
A1B3J6 7.69e-08 55 40 1 82 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Paracoccus denitrificans (strain Pd 1222)
Q1R6R7 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain UTI89 / UPEC)
Q8FDG6 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TD42 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AFY6 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O1:K1 / APEC
B7N068 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O81 (strain ED1a)
B7MB00 8.08e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q02TI3 8.08e-08 55 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B0USH5 8.1e-08 55 30 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Histophilus somni (strain 2336)
Q63GW2 8.67e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus cereus (strain ZK / E33L)
Q6I4E9 8.67e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus anthracis
A0R8V9 8.67e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus thuringiensis (strain Al Hakam)
Q6HPD3 8.75e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81IS8 8.75e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B1LF56 8.79e-08 55 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
Q73ES6 8.84e-08 55 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B5BG20 9.29e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella paratyphi A (strain AKU_12601)
C0PYY1 9.29e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella paratyphi C (strain RKS4594)
Q5PKX9 9.29e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57JQ1 9.29e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella choleraesuis (strain SC-B67)
Q64TJ9 9.43e-08 55 29 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacteroides fragilis (strain YCH46)
Q5LCF3 9.43e-08 55 29 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A9N5Y7 9.56e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T678 9.56e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella newport (strain SL254)
Q63JF6 9.59e-08 55 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia pseudomallei (strain K96243)
Q2N8R7 9.72e-08 55 36 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Erythrobacter litoralis (strain HTCC2594)
B3EPA8 9.88e-08 55 30 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium phaeobacteroides (strain BS1)
P40731 9.92e-08 55 26 3 112 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TI59 9.92e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella heidelberg (strain SL476)
B5REG6 9.92e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZ44 9.92e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FHU3 9.92e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella dublin (strain CT_02021853)
B5F6A4 9.92e-08 55 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella agona (strain SL483)
Q3JKA5 1.04e-07 55 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia pseudomallei (strain 1710b)
A3P7W1 1.04e-07 55 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia pseudomallei (strain 1106a)
Q62DT7 1.05e-07 55 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia mallei (strain ATCC 23344)
A4JLT6 1.08e-07 55 41 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A6L5E2 1.21e-07 55 29 2 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q8P494 1.24e-07 55 32 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RXI2 1.24e-07 55 32 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UPU5 1.24e-07 55 32 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas campestris pv. campestris (strain 8004)
B4TVU2 1.35e-07 54 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella schwarzengrund (strain CVM19633)
A4SCN7 1.35e-07 54 29 3 123 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A7HLB0 1.44e-07 54 26 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q8Z3M6 1.51e-07 54 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella typhi
Q7W668 1.53e-07 54 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7MNZ9 1.53e-07 54 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio vulnificus (strain YJ016)
Q8DEG4 1.53e-07 54 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio vulnificus (strain CMCP6)
Q7WI34 1.56e-07 54 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VXN4 1.63e-07 54 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B4S5Q4 1.75e-07 54 29 3 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q1IG31 1.75e-07 54 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas entomophila (strain L48)
A8APV4 1.77e-07 54 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q1QE85 1.83e-07 54 24 2 118 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3BNE2 1.87e-07 54 31 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4FV71 1.94e-07 54 24 2 118 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A8GJV1 1.96e-07 54 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Serratia proteamaculans (strain 568)
Q8PFV1 2.07e-07 54 31 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas axonopodis pv. citri (strain 306)
O66986 2.29e-07 53 27 2 119 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Aquifex aeolicus (strain VF5)
Q8XX97 2.31e-07 53 31 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88QU6 2.41e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1BJ68 2.43e-07 53 26 2 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A5VXI4 2.48e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q21WR0 2.48e-07 53 39 4 88 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A4XZK6 2.5e-07 53 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas mendocina (strain ymp)
Q3K5S1 2.57e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas fluorescens (strain Pf0-1)
B1JDY5 2.62e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas putida (strain W619)
Q9WZX7 2.63e-07 52 33 4 130 1 tsaB tRNA threonylcarbamoyladenosine biosynthesis protein TsaB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B0KJ82 2.65e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas putida (strain GB-1)
Q254Q0 2.69e-07 53 38 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia felis (strain Fe/C-56)
Q5L5V3 2.92e-07 53 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
B3PKA5 3.08e-07 53 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cellvibrio japonicus (strain Ueda107)
A0KGI3 3.13e-07 53 27 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4K4W4 3.13e-07 53 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C6E7C1 3.14e-07 53 33 0 75 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geobacter sp. (strain M21)
Q12KB7 3.29e-07 53 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q3SGB3 3.31e-07 53 30 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q493X8 3.37e-07 53 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Blochmanniella pennsylvanica (strain BPEN)
A9MPV5 3.56e-07 53 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5GV94 3.6e-07 53 30 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SLA3 3.6e-07 53 30 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NYH1 3.6e-07 53 30 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q67K94 3.7e-07 53 27 4 168 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q4L7T2 3.81e-07 53 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus haemolyticus (strain JCSC1435)
B6EM15 3.85e-07 53 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Aliivibrio salmonicida (strain LFI1238)
A7GIP8 4.32e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5I738 4.32e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYQ8 4.32e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
C1FLX0 4.49e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Kyoto / Type A2)
B1L1Z3 4.53e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
B1IFE9 4.53e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Okra / Type B1)
C3KUS7 4.84e-07 53 29 2 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q1GP42 5.06e-07 53 38 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A6VQW2 5.42e-07 53 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B4RQ33 5.73e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5FAC2 5.73e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5WCC7 5.81e-07 52 31 2 85 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Psychrobacter sp. (strain PRwf-1)
Q9JY06 6.05e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
C5CT30 6.14e-07 52 41 2 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Variovorax paradoxus (strain S110)
Q30BK9 6.17e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria meningitidis
Q6D9D3 6.18e-07 52 27 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4SBN2 6.23e-07 52 28 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1IQ95 6.28e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B5FB82 6.48e-07 52 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Aliivibrio fischeri (strain MJ11)
Q9ZCZ9 6.59e-07 51 31 2 87 4 RP551 Uncharacterized protein RP551 Rickettsia prowazekii (strain Madrid E)
Q5NL82 7.28e-07 52 29 3 114 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C1DIY3 8.01e-07 52 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q8A997 8.05e-07 52 28 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q822Y4 8.06e-07 52 29 3 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A4VHG9 8.16e-07 52 31 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Stutzerimonas stutzeri (strain A1501)
B2JP66 8.24e-07 52 38 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A5CVM3 8.71e-07 52 31 2 85 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B7GFQ4 8.79e-07 52 26 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q7VQQ9 8.84e-07 52 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Blochmanniella floridana
C5BHG1 8.87e-07 52 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Edwardsiella ictaluri (strain 93-146)
Q03E69 1.06e-06 52 30 2 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B5YKX4 1.08e-06 52 23 1 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q6LV10 1.12e-06 52 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Photobacterium profundum (strain SS9)
A1VD24 1.13e-06 52 34 1 85 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72B00 1.13e-06 52 34 1 85 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
C6DKG9 1.17e-06 52 30 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C4K3R9 1.23e-06 52 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A4G2A7 1.23e-06 52 29 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Herminiimonas arsenicoxydans
Q47IP4 1.24e-06 52 32 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Dechloromonas aromatica (strain RCB)
A0AKI2 1.25e-06 52 35 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q13RW9 1.27e-06 52 35 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Paraburkholderia xenovorans (strain LB400)
Q87SL5 1.27e-06 52 24 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B8GPT9 1.38e-06 51 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A6LQD5 1.39e-06 51 35 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A4WWN6 1.39e-06 51 40 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
C4LB59 1.45e-06 51 28 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A1KS96 1.46e-06 51 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1SRR5 1.54e-06 51 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q891E7 1.62e-06 51 28 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium tetani (strain Massachusetts / E88)
A1W9P4 1.66e-06 51 29 2 120 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acidovorax sp. (strain JS42)
Q1GCQ5 1.68e-06 51 40 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ruegeria sp. (strain TM1040)
B1LA07 1.97e-06 51 28 3 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermotoga sp. (strain RQ2)
A5IKS6 1.97e-06 51 28 3 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A9IP11 2.08e-06 51 38 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B3E4U4 2.11e-06 51 32 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B3QLC5 2.17e-06 51 29 3 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
C3K338 2.18e-06 51 29 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pseudomonas fluorescens (strain SBW25)
Q2LSP8 2.32e-06 51 26 0 75 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Syntrophus aciditrophicus (strain SB)
A4SRB1 2.44e-06 50 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Aeromonas salmonicida (strain A449)
Q71XT8 2.53e-06 50 34 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KX28 2.53e-06 50 34 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q2L002 2.63e-06 50 40 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bordetella avium (strain 197N)
Q2NWE6 2.64e-06 50 25 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Sodalis glossinidius (strain morsitans)
A1TYE0 2.73e-06 50 31 2 86 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q929U3 3.13e-06 50 34 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C0QTG9 3.15e-06 50 23 2 133 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Persephonella marina (strain DSM 14350 / EX-H1)
Q8Y5I7 3.27e-06 50 34 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A1TP41 3.49e-06 50 35 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Paracidovorax citrulli (strain AAC00-1)
A1VM52 3.61e-06 50 36 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Polaromonas naphthalenivorans (strain CJ2)
B2U928 3.65e-06 50 29 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ralstonia pickettii (strain 12J)
Q8KGA4 3.65e-06 50 30 3 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A6VU47 3.77e-06 50 28 4 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Marinomonas sp. (strain MWYL1)
Q28JW5 4.01e-06 50 39 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Jannaschia sp. (strain CCS1)
B2TJK1 4.4e-06 50 35 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
Q97KL6 4.45e-06 50 26 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2NIA4 4.63e-06 50 27 3 118 3 Msp_0013 Probable bifunctional tRNA threonylcarbamoyladenosine biosynthesis protein Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q11TP2 4.73e-06 50 25 2 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q2RGJ3 5.09e-06 50 37 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q3JF13 5.45e-06 50 26 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q82XN2 5.47e-06 50 26 2 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C5CD32 5.7e-06 50 25 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q5LLR7 5.81e-06 50 40 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B3CLX6 5.83e-06 49 28 2 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q9F0V0 6.05e-06 49 25 1 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Riemerella anatipestifer
Q7MU42 6.17e-06 49 33 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q18CP0 6.54e-06 49 32 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridioides difficile (strain 630)
Q6MD07 7.52e-06 49 35 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Protochlamydia amoebophila (strain UWE25)
B7K087 8.02e-06 49 30 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q73H71 8.9e-06 49 28 3 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Wolbachia pipientis wMel
Q9WXZ2 9.08e-06 49 27 3 117 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C0R3B8 9.41e-06 49 28 3 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q0ATQ2 1.01e-05 49 39 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Maricaulis maris (strain MCS10)
Q21MU7 1.03e-05 49 27 4 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7A4H8 1.19e-05 48 29 2 110 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain N315)
Q99SK3 1.19e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X4L9 1.19e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A5IUJ5 1.22e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain JH9)
A6U3D4 1.22e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain JH1)
Q6GF23 1.25e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain MRSA252)
A0Q2U7 1.25e-05 48 27 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium novyi (strain NT)
A8Z4V2 1.29e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QIP6 1.29e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain Newman)
Q5HEF2 1.29e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain COL)
Q2FWL2 1.29e-05 48 29 2 110 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF75 1.29e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain USA300)
Q048X8 1.29e-05 48 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G933 1.29e-05 48 30 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5FLZ3 1.34e-05 48 27 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8NVJ5 1.35e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain MW2)
Q6G7Q8 1.35e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain MSSA476)
Q0RM11 1.43e-05 48 29 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q2YUG0 1.43e-05 48 29 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q65N07 1.51e-05 48 23 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q31EM1 1.54e-05 48 28 2 85 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q30ZN1 1.6e-05 48 27 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A8MCC8 1.61e-05 48 28 2 125 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167)
A5N5B9 1.64e-05 48 26 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYW7 1.64e-05 48 26 2 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium kluyveri (strain NBRC 12016)
B2S3R9 1.69e-05 48 36 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Treponema pallidum subsp. pallidum (strain SS14)
O83686 1.69e-05 48 36 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Treponema pallidum (strain Nichols)
Q045T6 1.81e-05 48 28 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B3EHF8 1.84e-05 48 26 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q9KFD3 2e-05 48 27 2 116 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A6W504 2.56e-05 48 36 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
O84200 2.57e-05 47 29 2 108 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KMG5 2.57e-05 47 29 2 108 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q73JV7 2.64e-05 47 31 2 95 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
B0BBH7 2.74e-05 47 29 2 108 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9U7 2.74e-05 47 29 2 108 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q3YS67 2.93e-05 47 27 3 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ehrlichia canis (strain Jake)
B2V910 3.17e-05 47 25 2 129 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Sulfurihydrogenibium sp. (strain YO3AOP1)
C1A601 3.25e-05 47 35 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q49Z04 3.26e-05 47 26 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8D283 3.63e-05 47 31 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Wigglesworthia glossinidia brevipalpis
Q1IUF1 3.63e-05 47 35 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Koribacter versatilis (strain Ellin345)
Q72J91 3.84e-05 47 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SIW2 4.24e-05 47 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B8J7H2 4.31e-05 47 27 1 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A8LP83 4.32e-05 47 34 2 104 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q8XI89 4.39e-05 47 27 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TN80 4.39e-05 47 27 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B7K765 4.41e-05 47 26 1 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Gloeothece citriformis (strain PCC 7424)
A1A1Q5 4.46e-05 47 34 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q0SQV5 4.64e-05 47 27 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Clostridium perfringens (strain SM101 / Type A)
A6LKP0 4.68e-05 47 24 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
C4XSD3 4.72e-05 47 34 3 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q6AL73 4.95e-05 47 34 0 64 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A3DJ13 5.14e-05 47 24 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q0SM86 5.55e-05 47 24 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borreliella afzelii (strain PKo)
Q9Z8Z0 5.58e-05 47 33 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia pneumoniae
Q8CNL9 5.7e-05 47 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMG7 5.7e-05 47 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0V811 5.86e-05 47 25 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baumannii (strain AYE)
B2HUS7 5.86e-05 47 25 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baumannii (strain ACICU)
B7I2K6 5.86e-05 47 25 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baumannii (strain AB0057)
B7H0A7 5.86e-05 47 25 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baumannii (strain AB307-0294)
Q660A6 6e-05 47 23 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
B0VKC7 6.03e-05 47 25 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baumannii (strain SDF)
Q88YN0 6.05e-05 47 28 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O05518 6.43e-05 46 22 2 110 1 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bacillus subtilis (strain 168)
B7J0L4 7.94e-05 46 23 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borreliella burgdorferi (strain ZS7)
O51710 8.09e-05 46 23 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q3ANQ6 8.69e-05 46 23 2 120 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlorobium chlorochromatii (strain CaD3)
Q9PKJ5 9.11e-05 46 32 4 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chlamydia muridarum (strain MoPn / Nigg)
A4IJU4 9.14e-05 46 24 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geobacillus thermodenitrificans (strain NG80-2)
O22145 9.34e-05 46 29 3 114 2 GCP1 Probable tRNA N6-adenosine threonylcarbamoyltransferase, mitochondrial Arabidopsis thaliana
Q74KY8 9.58e-05 46 27 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q5L3F6 0.000108 46 25 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geobacillus kaustophilus (strain HTA426)
Q2IFU7 0.000119 45 26 1 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8G4D1 0.000137 45 32 0 67 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bifidobacterium longum (strain NCC 2705)
Q24QC9 0.000143 45 27 3 132 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Desulfitobacterium hafniense (strain Y51)
A1KAI4 0.000153 45 25 3 113 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Azoarcus sp. (strain BH72)
Q2SR45 0.000156 45 22 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
B9MKR8 0.000158 45 25 1 97 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A5G3X1 0.00016 45 25 1 97 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geotalea uraniireducens (strain Rf4)
A9FDL0 0.000162 45 26 2 123 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Sorangium cellulosum (strain So ce56)
Q6G1R3 0.000169 45 33 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2VNJ2 0.000185 45 38 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylocapsa acidiphila
Q9UXT7 0.00021 45 34 1 63 1 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q1WSV5 0.000223 45 30 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Ligilactobacillus salivarius (strain UCC118)
Q2RND2 0.000228 45 35 0 80 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P0CQ15 0.000228 45 29 0 64 3 KAE1 tRNA N6-adenosine threonylcarbamoyltransferase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A7HGZ6 0.000236 45 29 3 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Anaeromyxobacter sp. (strain Fw109-5)
Q8U4B6 0.000241 45 26 1 99 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P0CQ14 0.000266 45 29 0 64 3 KAE1 tRNA N6-adenosine threonylcarbamoyltransferase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
B9K6Y6 0.000268 44 24 3 117 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A9NHW6 0.000283 44 24 1 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acholeplasma laidlawii (strain PG-8A)
A1ARX8 0.000306 44 24 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B6YUD9 0.000315 44 28 2 99 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Thermococcus onnurineus (strain NA1)
B2G5W6 0.000328 44 27 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VID8 0.000328 44 27 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Limosilactobacillus reuteri (strain DSM 20016)
Q5GT66 0.000378 44 27 3 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q01TA4 0.00039 44 26 1 119 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Solibacter usitatus (strain Ellin6076)
Q6MQ48 0.000392 44 23 2 115 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q5FPS6 0.000401 44 32 0 68 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Gluconobacter oxydans (strain 621H)
B3QYH8 0.000404 44 24 2 121 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B7IGB4 0.000415 44 23 2 109 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Thermosipho africanus (strain TCF52B)
A9IZF6 0.000438 44 32 2 100 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
O57716 0.00045 44 33 1 63 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8RFX8 0.000451 44 22 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A1R0J1 0.000483 44 22 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borrelia turicatae (strain 91E135)
A4WKT1 0.000519 43 20 7 211 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
Q6FYF1 0.000522 43 32 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Bartonella quintana (strain Toulouse)
Q602S1 0.000584 43 26 2 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B5RQA5 0.000602 43 20 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borrelia recurrentis (strain A1)
Q5X2T1 0.000654 43 29 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Legionella pneumophila (strain Paris)
Q5WU89 0.000684 43 29 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Legionella pneumophila (strain Lens)
Q39W35 0.00072 43 26 0 87 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5IEF9 0.000723 43 29 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Legionella pneumophila (strain Corby)
A9W0N8 0.000727 43 33 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylorubrum extorquens (strain PA1)
B7KZD5 0.000727 43 33 0 81 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B5RMW0 0.000743 43 20 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Borrelia duttonii (strain Ly)
Q5ZT08 0.000743 43 29 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A2BJY9 0.000744 43 29 3 140 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
B9M2S8 0.000767 43 26 1 80 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8E1B4 0.000779 43 27 2 110 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A0L5L8 0.000782 43 31 0 77 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q035Y0 0.000811 43 28 3 116 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W9X7 0.000811 43 28 3 116 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Lacticaseibacillus casei (strain BL23)
A1WZH8 0.000833 43 28 4 112 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q82DK2 0.000843 43 31 0 69 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O29153 0.000893 43 28 2 95 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A4XM18 0.001 43 24 1 91 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q3A3G6 0.001 43 27 0 65 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q6FCK9 0.001 43 24 3 111 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C5A3G1 0.001 43 27 2 99 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q5JEW3 0.001 43 27 2 99 3 kae1 tRNA N6-adenosine threonylcarbamoyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
B8EJI6 0.001 43 33 0 71 3 tsaD tRNA N6-adenosine threonylcarbamoyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02685
Feature type CDS
Gene tsaB
Product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
Location 521782 - 522483 (strand: 1)
Length 702 (nucleotides) / 233 (amino acids)
In genomic island -

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_722
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00814 tRNA N6-adenosine threonylcarbamoyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1214 Translation, ribosomal structure and biogenesis (J) J tRNA A37 threonylcarbamoyladenosine modification protein TsaB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14742 tRNA threonylcarbamoyladenosine biosynthesis protein TsaB - -

Protein Sequence

MSSRILALDTATEACSVALYNNGEITADFAVTPREHTQRILPMVQAVLAQQNLSLRDLDALAFGQGPGSFTGVRIGVGIAQGLALGAELPMIGVSSLETMAEGVFRTTGLARVLVAIDARMDEVYCAAYVRDEQGIFRQELAEAVLKPADFVTRCAALTGEWGLAGTGWAAYPQMQETLTLSTQMTEITLPHAQDMLPPALNALRRGETSAPESAEPVYLRNEVTWKKLPGRE

Flanking regions ( +/- flanking 50bp)

CCGTGATTTTTTTGTTACCATAAACCTTATTTATTTGCCGGAGTTATGGCATGTCCAGCCGAATTTTAGCCTTAGATACAGCAACAGAAGCCTGTTCTGTTGCACTTTACAACAATGGTGAGATCACCGCCGATTTTGCAGTCACCCCCCGCGAACACACACAGCGCATTCTGCCGATGGTGCAGGCGGTGCTGGCACAGCAGAATCTCTCTCTCCGTGATCTTGATGCACTGGCCTTTGGTCAGGGGCCGGGCAGCTTTACCGGCGTGCGGATTGGTGTCGGGATCGCGCAGGGTCTGGCACTGGGCGCTGAACTGCCGATGATCGGTGTCTCATCGCTGGAAACCATGGCGGAAGGGGTTTTCCGTACTACCGGGCTCGCCCGTGTGCTGGTTGCCATTGATGCCCGCATGGATGAAGTGTACTGCGCGGCGTATGTCCGTGATGAACAGGGCATTTTCCGGCAGGAACTGGCGGAAGCGGTGCTGAAACCGGCTGATTTTGTCACGCGCTGTGCCGCACTCACCGGCGAATGGGGACTGGCCGGCACCGGCTGGGCGGCGTATCCGCAGATGCAGGAAACGCTGACTCTCAGTACTCAGATGACAGAGATTACGCTGCCGCATGCACAGGATATGCTGCCGCCGGCACTGAATGCACTGCGCCGCGGGGAAACATCTGCCCCTGAATCGGCAGAGCCGGTGTATTTGCGCAACGAAGTGACCTGGAAGAAATTACCGGGCCGGGAATAACGTAAAAAAATAGCCTGCATCAATTGTTGAACCGGCAATCATCAGCCACA