Homologs in group_2542

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02150 FBDBKF_02150 100.0 Morganella morganii S1 msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP
NLDBIP_00840 NLDBIP_00840 100.0 Morganella morganii S4 msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP
LHKJJB_01195 LHKJJB_01195 100.0 Morganella morganii S3 msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP
HKOGLL_01235 HKOGLL_01235 100.0 Morganella morganii S5 msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP
F4V73_RS04500 F4V73_RS04500 87.7 Morganella psychrotolerans msrP protein-methionine-sulfoxide reductase catalytic subunit MsrP

Distribution of the homologs in the orthogroup group_2542

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2542

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1RAH1 2.05e-172 484 68 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain UTI89 / UPEC)
A1ACB6 2.05e-172 484 68 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O1:K1 / APEC
B7MCM4 2.05e-172 484 68 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NBW2 4.14e-172 484 68 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7L8Y8 4.67e-172 484 68 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain 55989 / EAEC)
B7USY1 7.24e-172 483 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I116 7.4e-172 483 67 1 333 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain SE11)
B7M3A9 7.4e-172 483 67 1 333 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O8 (strain IAI1)
A7ZN92 7.4e-172 483 67 1 333 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O139:H28 (strain E24377A / ETEC)
B5YSJ7 9.73e-172 483 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XB74 9.73e-172 483 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O157:H7
B1IZU1 1.37e-171 482 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7MWF7 1.37e-171 482 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O81 (strain ED1a)
P67347 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67348 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella typhi
B5BGT1 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella paratyphi A (strain AKU_12601)
A9N876 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJV7 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUN2 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella newport (strain SL254)
B4TJV1 2.58e-171 482 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella heidelberg (strain SL476)
A8A1H0 2.84e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O9:H4 (strain HS)
B2TWL4 2.91e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LQN8 2.91e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain SMS-3-5 / SECEC)
Q3Z0L8 4.22e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Shigella sonnei (strain Ss046)
B4TX85 4.46e-171 481 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella schwarzengrund (strain CVM19633)
Q57J91 4.46e-171 481 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella choleraesuis (strain SC-B67)
B5F7N7 4.46e-171 481 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella agona (strain SL483)
Q32HK5 4.5e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Shigella dysenteriae serotype 1 (strain Sd197)
B7NRB1 4.92e-171 481 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A9MNV7 1.25e-170 480 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C4ZQP1 1.32e-170 480 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain K12 / MC4100 / BW2952)
Q8FGI7 1.55e-170 480 67 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P76342 2.13e-170 479 67 2 336 1 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia coli (strain K12)
B5REX5 8.66e-170 478 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1C0 8.66e-170 478 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella enteritidis PT4 (strain P125109)
B5FIV5 8.66e-170 478 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Salmonella dublin (strain CT_02021853)
B7LRM8 8.85e-170 478 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MNQ9 3.67e-166 469 66 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Cronobacter sakazakii (strain ATCC BAA-894)
B2VGX7 1.87e-161 457 63 2 336 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8GK68 6.86e-159 450 63 2 333 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Serratia proteamaculans (strain 568)
Q8ZAW9 1.23e-158 451 63 2 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Yersinia pestis
Q665F0 4.06e-158 449 63 2 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6DAI9 4.58e-157 446 65 2 327 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DIK7 1.96e-156 444 64 2 327 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q0I4C9 6.36e-133 384 58 6 331 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Histophilus somni (strain 129Pt)
B0UUL6 7.02e-133 384 58 6 331 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Histophilus somni (strain 2336)
Q9CN98 1.1e-132 383 56 3 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pasteurella multocida (strain Pm70)
B3GZ85 6.62e-131 379 56 4 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N3C8 6.62e-131 379 56 4 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BT06 1.68e-130 378 56 4 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q7VKI8 4.87e-127 369 55 7 334 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VQE0 1.77e-124 362 65 1 260 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q5FQ05 2.94e-122 357 54 3 327 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Gluconobacter oxydans (strain 621H)
C3MB06 2.47e-120 352 57 6 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2K9I8 2.41e-119 349 54 3 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PWV0 4.43e-118 346 53 3 337 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Rhizobium etli (strain CIAT 652)
Q92QE7 5.1e-118 346 56 4 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Rhizobium meliloti (strain 1021)
P0A4R1 9.46e-117 343 53 3 322 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Brucella suis biovar 1 (strain 1330)
P0A4R0 9.46e-117 343 53 3 322 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q7NZY0 3.02e-115 338 53 7 333 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P58770 6.41e-115 338 56 7 327 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9A4T2 1.06e-114 337 51 4 331 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9HVA4 1.95e-114 337 52 5 331 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0SVB3 1.07e-113 335 62 2 256 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Caulobacter sp. (strain K31)
Q88DZ2 1.34e-113 335 51 5 334 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B4UGL0 2.12e-113 334 53 5 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Anaeromyxobacter sp. (strain K)
B8J9Q0 6.9e-113 333 53 5 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q2IGN2 1.01e-111 330 52 4 326 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Anaeromyxobacter dehalogenans (strain 2CP-C)
Q5LNE0 1.29e-111 329 62 2 253 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q888N2 1.55e-110 328 50 4 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
G8QMC2 2.96e-110 326 59 3 272 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Azospira oryzae (strain ATCC BAA-33 / DSM 13638 / PS)
Q60AK7 5.93e-109 323 51 6 331 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q62G98 9.1e-109 323 50 3 330 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Burkholderia mallei (strain ATCC 23344)
Q63Q46 6.48e-106 316 59 2 251 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Burkholderia pseudomallei (strain K96243)
Q7MR39 8.08e-106 315 51 7 329 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q8PA98 2.57e-104 311 51 5 329 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9RRF6 4.51e-104 312 58 2 259 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8XV50 8.25e-104 310 49 8 340 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8PLY8 1.55e-103 309 58 2 258 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Xanthomonas axonopodis pv. citri (strain 306)
Q9PIC3 5.7e-102 304 49 7 327 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2W2Q1 5.65e-99 297 56 3 265 3 msrP Protein-methionine-sulfoxide reductase catalytic subunit MsrP Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
G8QM63 2.23e-10 63 28 2 154 2 yedY1 Putative protein-methionine-sulfoxide reductase subunit YedZ1 Azospira oryzae (strain ATCC BAA-33 / DSM 13638 / PS)
P39863 1.59e-07 56 25 6 178 3 NIA Nitrate reductase [NADPH] Fusarium oxysporum
P36858 2.85e-07 55 26 8 204 3 niaD Nitrate reductase [NADPH] Aspergillus niger
P43100 4.14e-07 55 25 7 175 3 NIA Nitrate reductase [NADPH] Beauveria bassiana
P23312 3.56e-06 52 26 5 184 2 NIA Nitrate reductase [NADH] Spinacia oleracea
O32103 1.63e-05 48 26 4 158 3 yuiH Uncharacterized oxidoreductase YuiH Bacillus subtilis (strain 168)
P08509 1.8e-05 50 25 5 186 2 NIA2 Nitrate reductase [NADH] 2 Nicotiana tabacum
P11605 6.07e-05 48 24 4 185 3 NIA1 Nitrate reductase [NADH] 1 Nicotiana tabacum
P39870 0.000154 47 26 7 178 2 INR2 Inducible nitrate reductase [NADH] 2 Glycine max
P54233 0.000573 45 26 6 180 2 INR1 Inducible nitrate reductase [NADH] 1 Glycine max
P17570 0.000744 45 24 4 173 3 NIA Nitrate reductase [NADH] Solanum lycopersicum
P39869 0.000748 45 24 6 177 3 NIA Nitrate reductase [NADH] Lotus japonicus
P27969 0.001 44 29 7 175 2 None Nitrate reductase [NADH] (Fragment) Hordeum vulgare

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02620
Feature type CDS
Gene msrP
Product protein-methionine-sulfoxide reductase catalytic subunit MsrP
Location 507694 - 508698 (strand: 1)
Length 1005 (nucleotides) / 334 (amino acids)
In genomic island -

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2542
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00174 Oxidoreductase molybdopterin binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2041 Energy production and conversion (C) C Molybdopterin-dependent catalytic subunit of periplasmic DMSO/TMAO and protein-methionine-sulfoxide reductases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07147 methionine sulfoxide reductase catalytic subunit [EC:1.8.-.-] - -

Protein Sequence

MKKIIRSSEITPESVFMMKRRNLLKLLGAGTAGLMVSPSVSAGLFSWFSGDDKPGVPEIILKDLSYTKPEKYQSDLVLTPEDKVTGYNNFYEFGLNKSDPAENAHTLKTDEWTLTVEGEVNRPLVLNADEIRHKFQAEERIYRMRCVEAWSMVIPWVGFPLRDLLLSAEPNSKAKYVAFETVYAPEQMPGQKSRFTGGGLQYPYIEGLRLDEALHPLTLMATGVYGKELPKQNGAPVRLVVPWKYGFKGIKSIVKIRLTESEPPTTWNLSAPREYGFYANVNPQVDHPRWSQATERFIGSGGLGRTTRQPTLLFNGYAEDVAELYKGMDLRRYF

Flanking regions ( +/- flanking 50bp)

TAACAGTTCCTGAATGTTATCACCGTGATTGTTGAATACAGGGACTCATCATGAAGAAAATAATACGATCGTCTGAGATTACGCCGGAATCCGTTTTTATGATGAAGCGCAGGAATCTGCTTAAATTATTAGGTGCCGGTACGGCCGGATTAATGGTCAGCCCGTCAGTCAGCGCCGGTCTGTTTTCGTGGTTTTCCGGCGATGATAAGCCCGGCGTTCCGGAGATAATCTTAAAAGACCTCAGTTATACAAAACCTGAAAAGTATCAGTCCGATCTGGTATTAACGCCGGAGGATAAGGTGACAGGTTACAATAATTTTTATGAATTCGGCCTGAATAAATCGGACCCGGCCGAAAACGCACATACCCTGAAAACGGATGAATGGACACTGACGGTTGAGGGGGAAGTTAACCGGCCTCTGGTATTAAATGCCGATGAGATCCGTCATAAATTTCAGGCCGAAGAGCGTATTTACCGGATGCGCTGTGTGGAAGCATGGTCAATGGTTATTCCGTGGGTTGGTTTTCCTCTGAGAGATTTATTGTTATCAGCGGAACCGAACAGCAAAGCGAAATATGTTGCTTTTGAAACGGTGTACGCTCCGGAACAAATGCCCGGTCAAAAGAGCCGTTTTACCGGAGGCGGGCTTCAGTATCCGTATATTGAGGGGTTGCGCCTGGATGAAGCACTTCACCCTCTGACACTGATGGCAACCGGTGTTTACGGAAAAGAACTGCCGAAACAAAATGGAGCACCTGTCCGGCTGGTGGTACCGTGGAAATATGGTTTTAAAGGCATAAAATCCATTGTTAAAATTCGCCTGACAGAATCTGAGCCGCCGACCACATGGAATCTTTCAGCACCCCGTGAATATGGGTTTTATGCCAATGTAAACCCGCAGGTTGATCATCCGCGCTGGTCACAGGCTACAGAACGTTTTATCGGCTCCGGAGGGTTAGGCCGGACAACACGGCAGCCGACATTACTGTTTAACGGGTATGCAGAAGACGTGGCAGAATTATATAAAGGGATGGATTTGCGGAGATATTTCTGATGATGAAATTATTCCGTTACCCGGTGGTTAAACTTTTTTTTCATATGACG