Homologs in group_607

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01905 FBDBKF_01905 100.0 Morganella morganii S1 prs ribose-phosphate diphosphokinase
NLDBIP_01085 NLDBIP_01085 100.0 Morganella morganii S4 prs ribose-phosphate diphosphokinase
LHKJJB_00950 LHKJJB_00950 100.0 Morganella morganii S3 prs ribose-phosphate diphosphokinase
HKOGLL_00990 HKOGLL_00990 100.0 Morganella morganii S5 prs ribose-phosphate diphosphokinase
F4V73_RS04250 F4V73_RS04250 99.4 Morganella psychrotolerans prs ribose-phosphate diphosphokinase
PMI_RS05245 PMI_RS05245 96.5 Proteus mirabilis HI4320 prs ribose-phosphate diphosphokinase

Distribution of the homologs in the orthogroup group_607

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_607

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N590 0.0 622 96 0 315 3 prs Ribose-phosphate pyrophosphokinase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZEY2 0.0 613 95 0 315 3 prs Ribose-phosphate pyrophosphokinase Yersinia pestis
P0A1V6 0.0 607 94 0 315 1 prs Ribose-phosphate pyrophosphokinase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1V7 0.0 607 94 0 315 3 prs Ribose-phosphate pyrophosphokinase Salmonella typhi
P0A717 0.0 607 94 0 315 1 prs Ribose-phosphate pyrophosphokinase Escherichia coli (strain K12)
P0A718 0.0 607 94 0 315 3 prs Ribose-phosphate pyrophosphokinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A719 0.0 607 94 0 315 3 prs Ribose-phosphate pyrophosphokinase Escherichia coli O157:H7
Q1LTH2 0.0 571 89 0 312 3 prs Ribose-phosphate pyrophosphokinase Baumannia cicadellinicola subsp. Homalodisca coagulata
P57266 0.0 566 86 0 315 3 prs Ribose-phosphate pyrophosphokinase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9X2 0.0 565 86 0 315 3 prs Ribose-phosphate pyrophosphokinase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9CP22 0.0 560 86 1 314 3 prs Ribose-phosphate pyrophosphokinase Pasteurella multocida (strain Pm70)
Q8EAQ9 0.0 546 83 0 315 3 prs Ribose-phosphate pyrophosphokinase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P59512 0.0 546 83 0 315 3 prs Ribose-phosphate pyrophosphokinase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7VL55 0.0 545 84 1 315 3 prs Ribose-phosphate pyrophosphokinase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P44328 0.0 543 84 1 314 3 prs Ribose-phosphate pyrophosphokinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VR76 0.0 543 82 0 312 3 prs Ribose-phosphate pyrophosphokinase Blochmanniella floridana
Q87RN8 0.0 538 82 0 313 3 prs Ribose-phosphate pyrophosphokinase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KQ22 0.0 538 82 0 313 3 prs Ribose-phosphate pyrophosphokinase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MMZ1 0.0 537 82 0 313 3 prs Ribose-phosphate pyrophosphokinase Vibrio vulnificus (strain YJ016)
Q8DFF5 0.0 537 82 0 313 3 prs Ribose-phosphate pyrophosphokinase Vibrio vulnificus (strain CMCP6)
A6W1C7 3.64e-162 457 68 0 313 3 prs Ribose-phosphate pyrophosphokinase Marinomonas sp. (strain MWYL1)
Q888C6 8.73e-157 443 67 1 313 3 prs Ribose-phosphate pyrophosphokinase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88PX6 5.09e-156 441 67 1 313 3 prs Ribose-phosphate pyrophosphokinase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9HVC5 3.65e-155 439 68 1 313 3 prs Ribose-phosphate pyrophosphokinase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7NQS9 3.56e-153 435 67 1 312 3 prs Ribose-phosphate pyrophosphokinase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P65235 6.02e-153 434 66 1 312 1 prs Ribose-phosphate pyrophosphokinase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P65234 6.02e-153 434 66 1 312 3 prs Ribose-phosphate pyrophosphokinase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7W181 5.64e-146 416 65 1 308 3 prs Ribose-phosphate pyrophosphokinase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WNY4 5.64e-146 416 65 1 308 3 prs Ribose-phosphate pyrophosphokinase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VUH1 7.18e-146 416 64 1 308 3 prs Ribose-phosphate pyrophosphokinase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8Y2E1 1e-145 415 65 1 310 3 prs Ribose-phosphate pyrophosphokinase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q63XL8 6.67e-145 413 63 1 310 1 prs Ribose-phosphate pyrophosphokinase Burkholderia pseudomallei (strain K96243)
Q82TQ4 7.87e-140 400 61 1 310 3 prs Ribose-phosphate pyrophosphokinase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q83AQ1 1.45e-136 392 60 1 312 3 prs Ribose-phosphate pyrophosphokinase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8PNU0 2.22e-136 392 61 1 312 3 prs Ribose-phosphate pyrophosphokinase Xanthomonas axonopodis pv. citri (strain 306)
Q8PC63 3.83e-136 391 61 1 312 3 prs Ribose-phosphate pyrophosphokinase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PA76 1.39e-135 390 59 1 312 3 prs Ribose-phosphate pyrophosphokinase Xylella fastidiosa (strain 9a5c)
Q87A22 6e-135 388 59 1 312 3 prs Ribose-phosphate pyrophosphokinase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q7M8J0 3.17e-123 358 55 3 313 3 prs Ribose-phosphate pyrophosphokinase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9ZLA1 6.12e-123 358 54 3 313 3 prs Ribose-phosphate pyrophosphokinase Helicobacter pylori (strain J99 / ATCC 700824)
P56184 4.32e-122 355 54 3 313 3 prs Ribose-phosphate pyrophosphokinase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8XHJ4 4.47e-122 355 56 4 315 3 prs Ribose-phosphate pyrophosphokinase Clostridium perfringens (strain 13 / Type A)
Q9PP15 1.24e-121 354 56 3 313 3 prs Ribose-phosphate pyrophosphokinase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0C5A1 2.69e-120 351 56 2 313 3 prs Ribose-phosphate pyrophosphokinase Hyphomonas neptunium (strain ATCC 15444)
Q6AJL7 2.76e-118 346 54 3 314 3 prs Ribose-phosphate pyrophosphokinase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q899I8 1.19e-117 344 55 4 314 3 prs Ribose-phosphate pyrophosphokinase Clostridium tetani (strain Massachusetts / E88)
Q8R753 1.87e-117 343 54 4 311 3 prs Ribose-phosphate pyrophosphokinase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q7VFY9 5.9e-117 342 54 3 313 3 prs Ribose-phosphate pyrophosphokinase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q92N73 1.82e-116 341 53 3 312 3 prs Ribose-phosphate pyrophosphokinase Rhizobium meliloti (strain 1021)
Q8EZN0 1.06e-115 339 52 3 312 3 prs Ribose-phosphate pyrophosphokinase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q98HW3 2.34e-115 338 56 5 314 3 prs Ribose-phosphate pyrophosphokinase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q72V73 5.09e-115 337 51 3 312 3 prs Ribose-phosphate pyrophosphokinase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q0ARN5 2.47e-114 335 54 3 312 3 prs Ribose-phosphate pyrophosphokinase Maricaulis maris (strain MCS10)
Q89DJ1 8.01e-114 335 53 5 313 3 prs Ribose-phosphate pyrophosphokinase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8GZV1 2.95e-112 330 54 2 313 3 prs Ribose-phosphate pyrophosphokinase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AAV6 2.95e-112 330 54 2 313 3 prs Ribose-phosphate pyrophosphokinase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8YIG1 4.81e-112 330 52 3 312 3 prs Ribose-phosphate pyrophosphokinase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8EU34 6.94e-112 330 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8FZF0 9.68e-112 329 52 3 312 3 prs Ribose-phosphate pyrophosphokinase Brucella suis biovar 1 (strain 1330)
Q97E93 1.76e-111 328 51 4 315 3 prs Ribose-phosphate pyrophosphokinase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7U7L5 2.25e-111 329 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Parasynechococcus marenigrum (strain WH8102)
Q8YN97 1.11e-110 327 52 2 310 3 prs Ribose-phosphate pyrophosphokinase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7V6S2 3.09e-110 326 50 3 314 3 prs Ribose-phosphate pyrophosphokinase Prochlorococcus marinus (strain MIT 9313)
Q7VBH4 4.92e-110 325 51 5 313 3 prs Ribose-phosphate pyrophosphokinase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8UDA9 2.39e-109 323 53 3 312 3 prs Ribose-phosphate pyrophosphokinase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q81J97 3.52e-109 323 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81VZ0 3.52e-109 323 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Bacillus anthracis
Q88Z84 3.7e-109 323 50 4 315 3 prs1 Ribose-phosphate pyrophosphokinase 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7NM67 4.09e-109 323 50 2 310 3 prs Ribose-phosphate pyrophosphokinase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P42816 4.19e-109 322 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Bacillus caldolyticus
Q55848 4.87e-109 323 49 2 310 3 prs Ribose-phosphate pyrophosphokinase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O33924 8.8e-109 322 51 3 311 3 prs Ribose-phosphate pyrophosphokinase Corynebacterium ammoniagenes
Q82ZA5 1.68e-108 321 50 4 315 3 prs2 Ribose-phosphate pyrophosphokinase 2 Enterococcus faecalis (strain ATCC 700802 / V583)
P14193 1.91e-108 321 50 3 311 1 prs Ribose-phosphate pyrophosphokinase Bacillus subtilis (strain 168)
Q8KCQ2 2.78e-108 321 52 5 312 3 prs Ribose-phosphate pyrophosphokinase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q59988 6.74e-108 320 49 4 317 3 prs Ribose-phosphate pyrophosphokinase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q0BPP0 6.81e-108 319 54 3 312 3 prs Ribose-phosphate pyrophosphokinase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9CHB8 7.89e-107 317 51 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Lactococcus lactis subsp. lactis (strain IL1403)
P0DB99 1.43e-106 316 52 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
P65245 1.43e-106 316 52 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XEL0 1.43e-106 316 52 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DB98 1.43e-106 316 52 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P65243 1.43e-106 316 52 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pyogenes serotype M1
Q7V111 2.33e-106 316 49 3 311 3 prs Ribose-phosphate pyrophosphokinase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q8RHM2 2.78e-106 315 48 4 313 3 prs Ribose-phosphate pyrophosphokinase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9X1W3 8.74e-106 314 50 4 314 3 prs Ribose-phosphate pyrophosphokinase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9KGJ5 1.54e-105 313 51 3 313 3 prs Ribose-phosphate pyrophosphokinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q42583 3.39e-105 315 49 3 312 2 PRS2 Ribose-phosphate pyrophosphokinase 2, chloroplastic Arabidopsis thaliana
Q8DWM2 9.96e-105 311 50 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B7IFM5 1.77e-104 311 49 4 315 3 prs Ribose-phosphate pyrophosphokinase Thermosipho africanus (strain TCF52B)
Q42581 3.07e-104 313 48 3 312 2 PRS1 Ribose-phosphate pyrophosphokinase 1, chloroplastic Arabidopsis thaliana
B9KPJ0 7.74e-104 310 49 4 323 3 prs Ribose-phosphate pyrophosphokinase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q9XG98 8.73e-104 310 48 3 313 2 PRS1 Ribose-phosphate pyrophosphokinase 1 Spinacia oleracea
P65240 1.1e-102 306 50 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65239 1.1e-102 306 50 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q6Z2L5 3.32e-102 308 49 3 308 2 Os02g0127700 Ribose-phosphate pyrophosphokinase 1, chloroplastic Oryza sativa subsp. japonica
Q69XQ6 3.85e-102 308 48 3 312 2 Os06g0617800 Ribose-phosphate pyrophosphokinase 2, chloroplastic Oryza sativa subsp. japonica
Q9XG99 9.86e-102 306 48 3 313 2 PRS2 Ribose-phosphate pyrophosphokinase 2, chloroplastic Spinacia oleracea
Q8E2H0 1.68e-101 303 51 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7X8 1.68e-101 303 51 5 316 3 prs1 Ribose-phosphate pyrophosphokinase 1 Streptococcus agalactiae serotype III (strain NEM316)
Q5R8F8 5.27e-101 302 48 3 317 2 PRPS2 Ribose-phosphate pyrophosphokinase 2 Pongo abelii
Q4R4R7 5.27e-101 302 48 3 317 2 PRPS2 Ribose-phosphate pyrophosphokinase 2 Macaca fascicularis
P11908 5.27e-101 302 48 3 317 1 PRPS2 Ribose-phosphate pyrophosphokinase 2 Homo sapiens
Q5XGI0 7.56e-101 301 48 3 317 2 prps2 Ribose-phosphate pyrophosphokinase 2 Xenopus tropicalis
O64888 8.04e-101 304 49 3 307 2 PRS5 Ribose-phosphate pyrophosphokinase 5, chloroplastic Arabidopsis thaliana
P09330 1e-100 301 48 3 317 1 Prps2 Ribose-phosphate pyrophosphokinase 2 Rattus norvegicus
P60892 1.05e-100 301 47 3 317 1 Prps1 Ribose-phosphate pyrophosphokinase 1 Rattus norvegicus
Q5RFJ7 1.05e-100 301 47 3 317 2 PRPS1 Ribose-phosphate pyrophosphokinase 1 Pongo abelii
Q9D7G0 1.05e-100 301 47 3 317 1 Prps1 Ribose-phosphate pyrophosphokinase 1 Mus musculus
P60891 1.05e-100 301 47 3 317 1 PRPS1 Ribose-phosphate pyrophosphokinase 1 Homo sapiens
Q2HJ58 1.05e-100 301 47 3 317 2 PRPS1 Ribose-phosphate pyrophosphokinase 1 Bos taurus
Q9CS42 1.35e-100 301 48 3 317 1 Prps2 Ribose-phosphate pyrophosphokinase 2 Mus musculus
Q5ZI49 3.22e-100 300 47 3 323 2 PRPS2 Ribose-phosphate pyrophosphokinase 2 Gallus gallus
Q4R4U3 5.37e-100 299 47 3 317 2 PRPS1 Ribose-phosphate pyrophosphokinase 1 Macaca fascicularis
Q7ZXC9 8.3e-100 299 47 3 317 2 prps2 Ribose-phosphate pyrophosphokinase 2 Xenopus laevis
Q54PA9 1.54e-99 298 47 3 311 1 prsA Ribose-phosphate pyrophosphokinase A Dictyostelium discoideum
Q8CQU7 3.85e-99 297 49 6 315 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRQ5 3.85e-99 297 49 6 315 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P21108 3.98e-99 297 47 3 317 1 PRPS1L1 Ribose-phosphate pyrophosphokinase 3 Homo sapiens
Q49V09 7.74e-99 296 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HIH5 1.69e-98 296 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain COL)
P65238 1.85e-98 295 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain MW2)
Q6GBY8 1.85e-98 295 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain MSSA476)
Q6GJH1 1.85e-98 295 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain MRSA252)
P65237 1.85e-98 295 49 4 314 1 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain N315)
P65236 1.85e-98 295 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q92F68 3.29e-98 295 47 4 314 3 prs1 Ribose-phosphate pyrophosphokinase 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q83TK1 6.06e-98 294 48 4 314 3 prs Ribose-phosphate pyrophosphokinase Listeria welshimeri
Q48793 1.06e-97 293 47 4 314 3 prs1 Ribose-phosphate pyrophosphokinase 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q724L4 1.06e-97 293 47 4 314 3 prs1 Ribose-phosphate pyrophosphokinase 1 Listeria monocytogenes serotype 4b (strain F2365)
Q4L3F7 1.18e-97 293 49 4 314 3 prs Ribose-phosphate pyrophosphokinase Staphylococcus haemolyticus (strain JCSC1435)
O94413 1.07e-96 291 49 5 314 1 SPCC1620.06c Ribose-phosphate pyrophosphokinase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q83YI7 2.71e-96 290 47 4 314 3 prs Ribose-phosphate pyrophosphokinase Listeria ivanovii
O67556 2.77e-94 285 46 5 315 3 prs Ribose-phosphate pyrophosphokinase Aquifex aeolicus (strain VF5)
Q7UPM4 1.21e-92 281 46 5 316 3 prs Ribose-phosphate pyrophosphokinase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7MT83 5.39e-90 274 46 6 313 3 prs Ribose-phosphate pyrophosphokinase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
P38620 6.14e-88 269 45 5 315 1 PRS2 Ribose-phosphate pyrophosphokinase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38063 9.42e-88 268 45 5 315 1 PRS4 Ribose-phosphate pyrophosphokinase 4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q82HE7 5.92e-87 266 45 6 315 3 prs Ribose-phosphate pyrophosphokinase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q88VA5 1.04e-86 266 47 4 312 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P38689 8.06e-86 263 46 5 319 1 PRS3 Ribose-phosphate pyrophosphokinase 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9K3U0 4.31e-84 259 43 5 314 3 prs Ribose-phosphate pyrophosphokinase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8FQV2 8.53e-84 258 44 4 315 3 prs Ribose-phosphate pyrophosphokinase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P75044 9.99e-84 258 43 6 316 3 prs Ribose-phosphate pyrophosphokinase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8DZK4 2.94e-83 257 43 6 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E568 2.94e-83 257 43 6 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus agalactiae serotype III (strain NEM316)
Q8NRU9 3.69e-83 257 43 4 315 3 prs Ribose-phosphate pyrophosphokinase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P46585 8.45e-82 253 44 4 314 3 PRS1 Ribose-phosphate pyrophosphokinase 1 Candida albicans
P47304 9.35e-82 253 41 6 317 3 prs Ribose-phosphate pyrophosphokinase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P65242 2.2e-81 252 43 5 315 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P65241 2.2e-81 252 43 5 315 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9CEI4 3.35e-81 251 42 6 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Lactococcus lactis subsp. lactis (strain IL1403)
Q5XC85 3.59e-81 251 42 5 314 1 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q723E1 3.63e-81 251 43 6 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Listeria monocytogenes serotype 4b (strain F2365)
Q832Z5 5.61e-81 251 41 5 312 3 prs1 Putative ribose-phosphate pyrophosphokinase 1 Enterococcus faecalis (strain ATCC 700802 / V583)
P0DC01 5.84e-81 251 42 5 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DC00 5.84e-81 251 42 5 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q99ZR0 1.29e-80 250 42 5 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pyogenes serotype M1
Q8P137 1.39e-80 250 42 5 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8Y9L8 1.61e-80 249 42 6 314 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92EF1 1.79e-80 249 42 5 311 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q54QU9 7.96e-80 248 39 6 314 3 prsC Ribose-phosphate pyrophosphokinase C Dictyostelium discoideum
Q8DU94 1.53e-79 248 40 5 319 3 prs2 Putative ribose-phosphate pyrophosphokinase 2 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8G5P2 3.74e-78 244 41 4 317 3 prs Ribose-phosphate pyrophosphokinase Bifidobacterium longum (strain NCC 2705)
Q75JN8 4.77e-78 244 40 6 325 3 prsB Ribose-phosphate pyrophosphokinase B Dictyostelium discoideum
Q98R83 1.13e-77 243 43 5 301 3 prs Ribose-phosphate pyrophosphokinase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9PQV0 2.79e-76 239 42 6 319 3 prs Ribose-phosphate pyrophosphokinase Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9CD45 2.97e-76 239 43 4 315 3 prs Ribose-phosphate pyrophosphokinase Mycobacterium leprae (strain TN)
P9WKE3 3.69e-76 239 43 4 315 1 prs Ribose-phosphate pyrophosphokinase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKE2 3.69e-76 239 43 4 315 3 prs Ribose-phosphate pyrophosphokinase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65233 3.69e-76 239 43 4 315 3 prs Ribose-phosphate pyrophosphokinase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P87171 7.29e-74 233 37 6 340 3 SPBC3D6.06c Ribose-phosphate pyrophosphokinase 5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9EWS0 4.46e-66 213 37 4 315 3 SCO0782 Putative ribose-phosphate pyrophosphokinase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9RUD2 6.65e-64 207 38 5 313 3 prs Ribose-phosphate pyrophosphokinase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q28DH0 4.3e-60 199 36 6 344 2 prpsap2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Xenopus tropicalis
Q5ZL26 4.27e-59 196 36 6 343 2 PRPSAP2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Gallus gallus
O60256 9.33e-59 196 35 5 343 1 PRPSAP2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Homo sapiens
A2VDS0 2.58e-58 194 35 6 343 2 PRPSAP2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Bos taurus
Q5RBA8 3e-58 194 35 5 343 2 PRPSAP2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Pongo abelii
O08618 4.4e-58 194 35 5 343 1 Prpsap2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Rattus norvegicus
Q8R574 5.76e-58 193 35 5 343 1 Prpsap2 Phosphoribosyl pyrophosphate synthase-associated protein 2 Mus musculus
Q08DW2 1.68e-56 189 35 6 343 2 PRPSAP1 Phosphoribosyl pyrophosphate synthase-associated protein 1 Bos taurus
Q14558 4.8e-56 188 35 6 343 1 PRPSAP1 Phosphoribosyl pyrophosphate synthase-associated protein 1 Homo sapiens
Q9D0M1 5.07e-56 188 35 6 343 1 Prpsap1 Phosphoribosyl pyrophosphate synthase-associated protein 1 Mus musculus
Q63468 7.21e-56 187 35 6 343 1 Prpsap1 Phosphoribosyl pyrophosphate synthase-associated protein 1 Rattus norvegicus
P41831 9.51e-47 165 42 3 202 3 SPAC4A8.14 Ribose-phosphate pyrophosphokinase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P41831 4.36e-13 72 35 3 115 3 SPAC4A8.14 Ribose-phosphate pyrophosphokinase 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q58761 2.23e-42 150 33 6 272 1 prs Ribose-phosphate pyrophosphokinase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TUT6 2.28e-42 150 31 6 293 3 prs Ribose-phosphate pyrophosphokinase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P32895 1.6e-41 152 41 3 206 1 PRS1 Ribose-phosphate pyrophosphokinase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32895 2.8e-16 82 40 3 115 1 PRS1 Ribose-phosphate pyrophosphokinase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O26877 2.23e-40 145 35 4 266 3 prs Ribose-phosphate pyrophosphokinase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O59586 2.92e-40 145 33 6 245 3 prs Ribose-phosphate pyrophosphokinase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A5UNK4 4.65e-39 142 32 5 267 3 prs Ribose-phosphate pyrophosphokinase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q8U458 7.34e-39 141 35 6 245 3 prs Ribose-phosphate pyrophosphokinase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q973F3 8.32e-38 139 29 5 249 3 prs Ribose-phosphate pyrophosphokinase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4J9A6 8.41e-38 139 30 5 276 3 prs Ribose-phosphate pyrophosphokinase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
O52958 2.8e-37 137 33 7 249 1 prs Ribose-phosphate pyrophosphokinase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9UY08 4.2e-37 137 30 7 268 3 prs Ribose-phosphate pyrophosphokinase Pyrococcus abyssi (strain GE5 / Orsay)
Q8TRK8 1.07e-36 135 32 8 303 3 prs Ribose-phosphate pyrophosphokinase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PUX3 6.06e-36 134 32 8 300 3 prs Ribose-phosphate pyrophosphokinase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9HLV6 4.67e-35 131 30 6 272 3 prs Ribose-phosphate pyrophosphokinase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q97CA5 2.31e-34 129 30 7 276 1 prs Ribose-phosphate pyrophosphokinase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q97Z86 1.24e-32 125 30 5 245 1 prs Ribose-phosphate pyrophosphokinase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O28853 2.08e-32 124 33 8 272 3 prs2 Ribose-phosphate pyrophosphokinase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8ZU24 2.1e-31 122 34 7 244 3 prs Ribose-phosphate pyrophosphokinase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q9YAW0 4.26e-31 121 29 3 270 3 prs Ribose-phosphate pyrophosphokinase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9HN88 4.69e-30 118 35 5 249 3 prs Ribose-phosphate pyrophosphokinase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R7B4 4.69e-30 118 35 5 249 3 prs Ribose-phosphate pyrophosphokinase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O29666 2.15e-28 114 30 7 301 3 prs1 Ribose-phosphate pyrophosphokinase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q12265 1.54e-22 100 42 1 115 1 PRS5 Ribose-phosphate pyrophosphokinase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12265 4.56e-20 93 38 1 111 1 PRS5 Ribose-phosphate pyrophosphokinase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12265 1.95e-13 73 44 3 88 1 PRS5 Ribose-phosphate pyrophosphokinase 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8S2E5 5.56e-18 87 28 12 316 2 Os01g0723600 Ribose-phosphate pyrophosphokinase 3, chloroplastic Oryza sativa subsp. japonica
Q9XGA1 7.56e-17 82 28 12 315 2 PRS4 Ribose-phosphate pyrophosphokinase 4 Spinacia oleracea
Q9XGA0 1.35e-16 83 27 11 315 2 PRS3 Ribose-phosphate pyrophosphokinase 3, mitochondrial Spinacia oleracea
Q93Z66 3.79e-15 79 28 10 269 2 PRS3 Ribose-phosphate pyrophosphokinase 3, chloroplastic Arabidopsis thaliana
Q680A5 2.62e-14 75 27 13 318 1 PRS4 Ribose-phosphate pyrophosphokinase 4 Arabidopsis thaliana
Q6ZFT5 3.55e-14 75 27 11 319 2 Os02g0714600 Ribose-phosphate pyrophosphokinase 4 Oryza sativa subsp. japonica
B3DPH5 5.55e-06 50 44 0 54 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum (strain DJO10A)
B7GNR5 5.6e-06 50 44 0 54 3 upp Uracil phosphoribosyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B8DVI9 1.19e-05 48 34 1 82 3 upp Uracil phosphoribosyltransferase Bifidobacterium animalis subsp. lactis (strain AD011)
A0ZZM2 2.5e-05 48 31 1 87 3 upp Uracil phosphoribosyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A0B5B7 0.000257 45 37 3 93 3 Mthe_0089 PyrE-like protein Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02375
Feature type CDS
Gene prs
Product ribose-phosphate diphosphokinase
Location 456184 - 457131 (strand: -1)
Length 948 (nucleotides) / 315 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_607
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13793 N-terminal domain of ribose phosphate pyrophosphokinase
PF14572 Phosphoribosyl synthetase-associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0462 Nucleotide transport and metabolism (F) F Phosphoribosylpyrophosphate synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MPDMKLFAGNAIPELAQRVANRLYTNLGDAAIGRFSDGEVSVQINENVRGGDVFIIQSTCAPTNDNLMELVVMVDALRRASAGRITAVIPYFGYARQDRRVRSTRVPITAKVVADFLSSVGVDRVLTVDLHAEQIQGFFDVPVDNVFGSPILLEDMLQKDLDNPIVVSPDIGGVVRARAIAKLLNDTDMAIIDKRRPRANVSQVMHIIGDVAGRDCVLVDDMIDTGGTLCKAAEALKERGAKRVFAYATHPIFSGNAVNNIRDSVIDEVIVCDTIPLSAEIKALNKVRSLTLSGMLAEAIRRISNEESISAMFEH

Flanking regions ( +/- flanking 50bp)

TTTCAGGTTCACAATTCAATCTCTCTGGACGCATGCCTGAGGTTTTTCTCGTGCCTGATATGAAGCTTTTTGCTGGTAACGCCATCCCGGAACTAGCACAACGTGTTGCCAACCGCCTGTACACTAACCTCGGAGACGCTGCGATCGGTCGTTTCAGCGACGGTGAAGTCAGTGTTCAAATCAATGAAAACGTGCGTGGTGGTGATGTTTTCATCATCCAGTCCACCTGTGCGCCGACTAACGATAACCTGATGGAACTGGTTGTCATGGTTGATGCGCTGCGCCGTGCTTCTGCGGGTCGTATCACTGCTGTTATCCCGTATTTCGGCTATGCCCGTCAGGATCGCCGCGTCCGCTCCACGCGTGTGCCAATCACCGCGAAAGTGGTCGCTGACTTCCTCTCAAGTGTGGGTGTTGACCGTGTGCTGACAGTGGATCTTCACGCTGAGCAGATTCAGGGCTTCTTCGATGTTCCGGTTGATAACGTCTTCGGCAGCCCAATCCTGCTGGAAGATATGCTGCAGAAAGATCTGGACAACCCGATTGTGGTTTCTCCGGATATCGGTGGTGTGGTCCGCGCCCGTGCGATCGCCAAACTGCTGAACGACACTGATATGGCTATCATCGACAAACGCCGCCCGCGTGCGAACGTTTCTCAGGTGATGCATATCATCGGTGATGTTGCCGGTCGTGACTGTGTACTGGTTGACGATATGATCGATACCGGGGGCACGCTGTGCAAAGCTGCGGAAGCACTGAAAGAACGTGGTGCGAAACGTGTGTTTGCATACGCAACTCACCCTATCTTCTCCGGCAACGCGGTCAACAATATCCGTGATTCTGTGATTGATGAAGTGATTGTCTGTGACACCATTCCGTTATCAGCTGAAATCAAAGCACTGAATAAAGTCCGTTCTCTGACTTTATCCGGAATGCTGGCAGAAGCCATCCGCCGTATCAGTAATGAAGAGTCTATCTCCGCGATGTTCGAACACTGATTTCATAATCAGTATACACATTGCGTGCTTAAACCCGTTGTGAAGACAAC