Homologs in group_2231

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17100 FBDBKF_17100 100.0 Morganella morganii S1 guaA glutamine-hydrolyzing GMP synthase
NLDBIP_01670 NLDBIP_01670 100.0 Morganella morganii S4 guaA glutamine-hydrolyzing GMP synthase
LHKJJB_00365 LHKJJB_00365 100.0 Morganella morganii S3 guaA glutamine-hydrolyzing GMP synthase
HKOGLL_00405 HKOGLL_00405 100.0 Morganella morganii S5 guaA glutamine-hydrolyzing GMP synthase
F4V73_RS05860 F4V73_RS05860 95.0 Morganella psychrotolerans guaA glutamine-hydrolyzing GMP synthase
PMI_RS07520 PMI_RS07520 90.1 Proteus mirabilis HI4320 guaA glutamine-hydrolyzing GMP synthase

Distribution of the homologs in the orthogroup group_2231

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2231

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EY59 0 990 90 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Proteus mirabilis (strain HI4320)
Q7N3K4 0 969 87 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JKT2 0 951 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GHV1 0 950 85 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Serratia proteamaculans (strain 568)
C5BER5 0 943 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Edwardsiella ictaluri (strain 93-146)
A8AD80 0 941 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D288 0 936 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DBG3 0 935 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7UGU5 0 933 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TXT2 0 932 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z4Q3 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella typhi
B4TD82 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella heidelberg (strain SL476)
B5RCX9 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R569 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella enteritidis PT4 (strain P125109)
B5FR52 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella dublin (strain CT_02021853)
B5F185 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella agona (strain SL483)
Q1R8M9 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain UTI89 / UPEC)
B1LNF9 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain SMS-3-5 / SECEC)
B6I579 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain SE11)
B1IWF4 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P64294 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEY1 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE43 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O1:K1 / APEC
A8A313 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O9:H4 (strain HS)
B7M7L1 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O8 (strain IAI1)
B7MYD5 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O81 (strain ED1a)
B7NQV3 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0X6 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O157:H7 (strain EC4115 / EHEC)
P64295 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O157:H7
B7LCP7 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain 55989 / EAEC)
B7MHY8 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LKD4 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83QL1 0 932 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella flexneri
Q31XY3 0 932 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella boydii serotype 4 (strain Sb227)
P04079 0 932 83 0 525 1 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain K12)
B1XAY2 0 932 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain K12 / DH10B)
C4ZX82 0 932 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli (strain K12 / MC4100 / BW2952)
A4WD82 0 931 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Enterobacter sp. (strain 638)
Q0T212 0 931 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella flexneri serotype 5b (strain 8401)
B5BAZ5 0 931 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella paratyphi A (strain AKU_12601)
C0PYP4 0 931 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella paratyphi C (strain RKS4594)
A9N218 0 931 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PI52 0 931 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LJ8 0 931 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella choleraesuis (strain SC-B67)
A7ZPV1 0 931 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O139:H28 (strain E24377A / ETEC)
B1JSB0 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A8 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMS8 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis (strain Pestoides F)
Q1CK82 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Z2 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCU4 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis
B2K9P0 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5J6 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFZ9 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q32D55 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella dysenteriae serotype 1 (strain Sd197)
B7N691 0 930 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3YZ45 0 929 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Shigella sonnei (strain Ss046)
A7MGU1 0 929 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Cronobacter sakazakii (strain ATCC BAA-894)
B4T0N7 0 929 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella newport (strain SL254)
A9MHM5 0 929 84 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XNM4 0 929 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Klebsiella pneumoniae (strain 342)
A6TCC2 0 928 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8ZN60 0 928 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TR83 0 927 83 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Salmonella schwarzengrund (strain CVM19633)
Q2NS52 0 915 82 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Sodalis glossinidius (strain morsitans)
C4L8C4 0 902 80 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A8FY04 0 897 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella sediminis (strain HAW-EB3)
A1S856 0 897 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KLC1 0 896 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella woodyi (strain ATCC 51908 / MS32)
B8CKS4 0 895 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella piezotolerans (strain WP3 / JCM 13877)
A3QCH0 0 895 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1RHR0 0 894 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella sp. (strain W3-18-1)
A4Y8T3 0 894 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9KWW6 0 894 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella baltica (strain OS195)
A6WQP0 0 894 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella baltica (strain OS185)
A3D6V2 0 894 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9T4 0 891 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella baltica (strain OS223)
Q8EC52 0 890 81 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q085S4 0 887 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella frigidimarina (strain NCIMB 400)
Q6LU31 0 887 79 0 524 3 guaA GMP synthase [glutamine-hydrolyzing] Photobacterium profundum (strain SS9)
Q0HX50 0 886 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella sp. (strain MR-7)
B4RV80 0 885 80 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q0HKV2 0 885 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella sp. (strain MR-4)
A0KUK2 0 885 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella sp. (strain ANA-3)
B0TLJ4 0 885 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella halifaxensis (strain HAW-EB4)
A8H254 0 884 80 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0KJS0 0 884 78 1 529 3 guaA GMP synthase [glutamine-hydrolyzing] Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q12PS0 0 883 79 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q15R63 0 883 79 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4SM23 0 881 79 1 526 3 guaA GMP synthase [glutamine-hydrolyzing] Aeromonas salmonicida (strain A449)
Q3IHJ1 0 880 78 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudoalteromonas translucida (strain TAC 125)
B5FAY1 0 877 78 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain MJ11)
Q5E763 0 875 77 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EGZ6 0 870 77 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio salmonicida (strain LFI1238)
B7VJU8 0 866 77 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio atlanticus (strain LGP32)
A1SYT6 0 863 77 1 526 3 guaA GMP synthase [glutamine-hydrolyzing] Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q87S07 0 863 76 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MU26 0 863 77 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio campbellii (strain ATCC BAA-1116)
C3LT21 0 862 77 2 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain M66-2)
Q9KTW2 0 862 77 2 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3F1 0 862 77 2 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DF07 0 862 76 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain CMCP6)
B0BUF0 0 862 78 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q47WD1 0 861 76 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7MNE1 0 861 76 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain YJ016)
A3MZV8 0 858 78 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q5QWW5 0 858 77 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B8F3T2 0 857 77 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Glaesserella parasuis serovar 5 (strain SH0165)
B3H120 0 856 78 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q9CNX8 0 853 77 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Pasteurella multocida (strain Pm70)
Q0I2D2 0 852 77 2 526 3 guaA GMP synthase [glutamine-hydrolyzing] Histophilus somni (strain 129Pt)
Q65UI1 0 849 76 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VMR9 0 849 77 1 522 3 guaA GMP synthase [glutamine-hydrolyzing] Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0USI5 0 848 77 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Histophilus somni (strain 2336)
Q7VLE9 0 845 77 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A5UAR3 0 841 75 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Haemophilus influenzae (strain PittEE)
P44335 0 838 75 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UG27 0 838 75 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Haemophilus influenzae (strain PittGG)
Q4QNW4 0 836 75 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Haemophilus influenzae (strain 86-028NP)
C4K7H1 0 822 72 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
C5BLU3 0 797 72 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q2SCJ3 0 794 70 1 526 3 guaA GMP synthase [glutamine-hydrolyzing] Hahella chejuensis (strain KCTC 2396)
B3PIG3 0 792 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Cellvibrio japonicus (strain Ueda107)
A1U1E2 0 785 69 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3K7D0 0 783 71 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas fluorescens (strain Pf0-1)
C3K1K0 0 782 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas fluorescens (strain SBW25)
Q4K6W4 0 780 71 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1JDH6 0 776 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas putida (strain W619)
A6W2W4 0 776 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Marinomonas sp. (strain MWYL1)
Q886X5 0 775 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48LY0 0 775 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B0KRE6 0 775 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas putida (strain GB-1)
A4XY17 0 774 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas mendocina (strain ymp)
Q88P21 0 773 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZC3 0 773 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q02RS2 0 773 69 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1I5K9 0 773 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas entomophila (strain L48)
Q9HXM6 0 773 69 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UXJ9 0 773 69 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas aeruginosa (strain LESB58)
Q0VNF0 0 771 70 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q4ZX09 0 770 69 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Pseudomonas syringae pv. syringae (strain B728a)
B4SSX7 0 766 68 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Stenotrophomonas maltophilia (strain R551-3)
B2FNS1 0 765 68 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Stenotrophomonas maltophilia (strain K279a)
Q0A9W8 0 763 70 0 525 3 guaA GMP synthase [glutamine-hydrolyzing] Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3BSP7 0 760 68 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B2SLG1 0 759 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q60C21 0 759 69 0 523 3 guaA GMP synthase [glutamine-hydrolyzing] Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5H0S2 0 757 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3Q9 0 757 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PK88 0 755 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas axonopodis pv. citri (strain 306)
Q1LSJ1 0 754 67 3 527 3 guaA GMP synthase [glutamine-hydrolyzing] Baumannia cicadellinicola subsp. Homalodisca coagulata
Q8P8Q6 0 752 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RSB6 0 752 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain B100)
Q4UVC5 0 752 67 1 523 3 guaA GMP synthase [glutamine-hydrolyzing] Xanthomonas campestris pv. campestris (strain 8004)
B0U3R8 0 749 66 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain M12)
Q87BK6 0 749 66 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6W2 0 749 66 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain M23)
Q9PAR6 0 748 67 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Xylella fastidiosa (strain 9a5c)
Q3SI29 0 739 67 1 521 3 guaA GMP synthase [glutamine-hydrolyzing] Thiobacillus denitrificans (strain ATCC 25259)
Q1H280 0 735 66 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5ZUS0 0 734 64 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q31F66 0 734 69 0 523 3 guaA GMP synthase [glutamine-hydrolyzing] Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5WVX4 0 732 64 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Legionella pneumophila (strain Lens)
Q5X4I9 0 731 64 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Legionella pneumophila (strain Paris)
A5ICM2 0 730 64 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Legionella pneumophila (strain Corby)
Q3JDG3 0 725 65 0 523 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6FFN2 0 722 66 2 527 3 guaA GMP synthase [glutamine-hydrolyzing] Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1K5U3 0 720 66 1 520 3 guaA GMP synthase [glutamine-hydrolyzing] Azoarcus sp. (strain BH72)
Q5NYE5 0 719 66 1 520 3 guaA GMP synthase [glutamine-hydrolyzing] Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7NSG1 0 705 64 2 524 3 guaA GMP synthase [glutamine-hydrolyzing] Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q82XZ6 0 705 65 1 516 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2JIA0 0 701 65 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q2Y9R9 0 701 63 1 521 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0ADW4 0 698 64 1 516 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q83BZ6 0 696 61 1 525 1 guaA GMP synthase [glutamine-hydrolyzing] Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B6IZE2 0 696 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Coxiella burnetii (strain CbuG_Q212)
A9N8L6 0 696 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J7Z4 0 696 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Coxiella burnetii (strain CbuK_Q154)
A9KGD5 0 694 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Coxiella burnetii (strain Dugway 5J108-111)
B0U0B2 0 691 62 2 523 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A1KRY5 0 690 64 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JXR2 0 689 64 5 526 3 guaA GMP synthase [glutamine-hydrolyzing] Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW60 0 689 64 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A5CVV4 0 689 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1AXH0 0 689 61 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Ruthia magnifica subsp. Calyptogena magnifica
B4RJH7 0 686 64 4 525 1 guaA GMP synthase [glutamine-hydrolyzing] Neisseria gonorrhoeae (strain NCCP11945)
Q5F4X9 0 686 64 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B2T5G8 0 684 63 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q5NG38 0 681 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HJ0 0 681 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain FSC 198)
A4IXW6 0 681 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. tularensis (strain WY96-3418)
A0Q6C0 0 681 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. novicida (strain U112)
Q13XE2 0 680 62 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Paraburkholderia xenovorans (strain LB400)
A9M138 0 680 63 3 525 3 guaA GMP synthase [glutamine-hydrolyzing] Neisseria meningitidis serogroup C (strain 053442)
Q2A3D4 0 680 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain LVS)
A6SZM5 0 680 61 3 537 3 guaA GMP synthase [glutamine-hydrolyzing] Janthinobacterium sp. (strain Marseille)
Q0BLV0 0 679 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain OSU18)
A7NCA3 0 679 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SGK4 0 678 61 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Francisella tularensis subsp. mediasiatica (strain FSC147)
Q1LND0 0 677 62 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B1XTW6 0 676 62 3 532 3 guaA GMP synthase [glutamine-hydrolyzing] Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4SYS2 0 676 62 3 532 3 guaA GMP synthase [glutamine-hydrolyzing] Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A3NAR3 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia pseudomallei (strain 668)
A3NWJ3 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia pseudomallei (strain 1106a)
A1V534 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia mallei (strain SAVP1)
Q62JF6 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia mallei (strain ATCC 23344)
A2SBA7 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia mallei (strain NCTC 10229)
A3MKQ7 0 674 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia mallei (strain NCTC 10247)
A4G4U7 0 673 61 3 537 3 guaA GMP synthase [glutamine-hydrolyzing] Herminiimonas arsenicoxydans
Q63T42 0 672 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia pseudomallei (strain K96243)
Q3JR65 0 672 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia pseudomallei (strain 1710b)
B9M9G4 0 672 62 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A9AIP4 0 671 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia multivorans (strain ATCC 17616 / 249)
Q4FVS5 0 670 61 2 530 3 guaA GMP synthase [glutamine-hydrolyzing] Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q47DK8 0 669 61 4 543 3 guaA GMP synthase [glutamine-hydrolyzing] Dechloromonas aromatica (strain RCB)
A1AQJ8 0 667 62 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q7WK13 0 667 62 3 531 3 guaA GMP synthase [glutamine-hydrolyzing] Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VVM4 0 665 62 3 531 3 guaA GMP synthase [glutamine-hydrolyzing] Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WAV6 0 664 62 3 531 3 guaA GMP synthase [glutamine-hydrolyzing] Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q470G4 0 664 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2UBD1 0 659 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Ralstonia pickettii (strain 12J)
Q8XZG4 0 659 60 2 541 3 guaA GMP synthase [glutamine-hydrolyzing] Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q39F73 0 658 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B1YS44 0 658 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia ambifaria (strain MC40-6)
Q0BE45 0 658 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A9IKK0 0 658 61 2 531 3 guaA GMP synthase [glutamine-hydrolyzing] Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q1BHF2 0 657 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia orbicola (strain AU 1054)
B1JUC0 0 657 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia orbicola (strain MC0-3)
A0K8B3 0 657 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia cenocepacia (strain HI2424)
B3R290 0 657 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B4EC68 0 656 61 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39TA7 0 655 61 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A2SG95 0 655 61 2 531 3 guaA GMP synthase [glutamine-hydrolyzing] Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q0KA43 0 655 61 1 536 3 guaA GMP synthase [glutamine-hydrolyzing] Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P60500 0 652 62 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A4JF45 0 652 60 2 536 3 guaA GMP synthase [glutamine-hydrolyzing] Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q492E5 0 650 58 2 522 3 guaA GMP synthase [glutamine-hydrolyzing] Blochmanniella pennsylvanica (strain BPEN)
Q3A590 0 650 60 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2L1U0 0 647 61 4 531 3 guaA GMP synthase [glutamine-hydrolyzing] Bordetella avium (strain 197N)
Q21W48 0 632 62 4 537 3 guaA GMP synthase [glutamine-hydrolyzing] Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7VRS2 0 613 55 4 519 3 guaA GMP synthase [glutamine-hydrolyzing] Blochmanniella floridana
C6BSD8 0 602 55 2 520 3 guaA GMP synthase [glutamine-hydrolyzing] Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q7UFS3 0 595 54 1 524 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5FPL0 0 594 54 2 522 3 guaA GMP synthase [glutamine-hydrolyzing] Gluconobacter oxydans (strain 621H)
Q8RDR4 0 592 56 4 517 3 guaA GMP synthase [glutamine-hydrolyzing] Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
C0QYF1 0 592 53 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q2RXI5 0 589 55 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B4R9R7 0 588 55 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Phenylobacterium zucineum (strain HLK1)
Q2KDG7 0 585 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B3PYH7 0 584 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium etli (strain CIAT 652)
B5ZYE9 0 583 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q8RC63 0 583 53 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6Q4N8 0 582 55 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Nitratiruptor sp. (strain SB155-2)
Q1MMJ7 0 581 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P29727 0 580 53 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus subtilis (strain 168)
A6UFA3 0 580 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Sinorhizobium medicae (strain WSM419)
Q92SQ3 0 580 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium meliloti (strain 1021)
Q65MU0 0 580 53 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C3MCS5 0 579 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B7IHI2 0 579 53 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosipho africanus (strain TCF52B)
A3DCD4 0 578 53 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A9WY54 0 577 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella suis (strain ATCC 23445 / NCTC 10510)
Q577H0 0 577 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus biovar 1 (strain 9-941)
Q2YK38 0 577 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus (strain 2308)
B2SBN5 0 577 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella abortus (strain S19)
A7Z235 0 577 53 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B9JZA3 0 577 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q5L3E1 0 577 53 2 521 3 guaA GMP synthase [glutamine-hydrolyzing] Geobacillus kaustophilus (strain HTA426)
B9J7L1 0 576 52 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q89N53 0 576 52 1 517 3 guaA GMP synthase [glutamine-hydrolyzing] Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5FMD6 0 576 53 5 528 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A8FAH5 0 576 53 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus pumilus (strain SAFR-032)
Q3Z886 0 575 54 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8CXK8 0 575 55 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3ZXH7 0 575 54 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Dehalococcoides mccartyi (strain CBDB1)
Q18CT8 0 575 53 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridioides difficile (strain 630)
Q8FWT4 0 575 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella suis biovar 1 (strain 1330)
A5VU71 0 575 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RKS9 0 575 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella melitensis biotype 2 (strain ATCC 23457)
A9MEB0 0 575 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
B0TI09 0 574 52 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B8DNB9 0 574 53 2 519 3 guaA GMP synthase [glutamine-hydrolyzing] Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A1URR0 0 574 53 2 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A1VEV0 0 573 53 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Nitratidesulfovibrio vulgaris (strain DP4)
Q72D86 0 573 53 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2RGP2 0 573 54 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q03H14 0 572 52 2 517 3 guaA GMP synthase [glutamine-hydrolyzing] Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
P60502 0 572 53 4 519 3 guaA GMP synthase [glutamine-hydrolyzing] Spiroplasma kunkelii
Q891G7 0 572 52 2 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium tetani (strain Massachusetts / E88)
Q5NN19 0 571 53 2 526 3 guaA GMP synthase [glutamine-hydrolyzing] Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A6LKY1 0 570 53 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q8UIL2 0 569 53 5 532 3 guaA GMP synthase [glutamine-hydrolyzing] Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8Y822 0 569 51 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q987R3 0 568 53 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A4YSU1 0 568 53 1 517 3 guaA GMP synthase [glutamine-hydrolyzing] Bradyrhizobium sp. (strain ORS 278)
Q92CU0 0 568 51 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8I4P0 0 567 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q046I2 0 567 52 4 525 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B6JHM4 0 567 53 1 517 3 guaA GMP synthase [glutamine-hydrolyzing] Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q9Z6H4 0 567 53 2 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. cremoris (strain MG1363)
Q6HPC6 0 566 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus thuringiensis subsp. konkukian (strain 97-27)
A7GKG1 0 566 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q74LF7 0 566 52 5 526 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q720X7 0 566 51 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serotype 4b (strain F2365)
Q6APU2 0 566 52 4 523 3 guaA GMP synthase [glutamine-hydrolyzing] Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B7IUT1 0 566 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain G9842)
A0AHK7 0 565 51 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q02Y87 0 565 52 2 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. cremoris (strain SK11)
Q63GV4 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ZK / E33L)
C1EUB4 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain 03BB102)
B7JM61 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain AH820)
Q81VE0 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis
A0R8W7 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus thuringiensis (strain Al Hakam)
C3L508 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBL1 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus anthracis (strain A0248)
Q8DZX7 0 565 53 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5M8 0 565 53 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype III (strain NEM316)
Q3K1C0 0 565 53 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q81IS3 0 565 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9CFJ0 0 564 52 2 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactococcus lactis subsp. lactis (strain IL1403)
Q9KF78 0 564 51 3 523 3 guaA Putative GMP synthase [glutamine-hydrolyzing] Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4XKX8 0 564 53 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q73ER7 0 564 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RQD7 0 564 55 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter fetus subsp. fetus (strain 82-40)
P60501 0 563 53 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3SQP4 0 563 52 2 523 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B7H4Q8 0 563 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus cereus (strain B4264)
B1YIZ1 0 563 51 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q6G5J3 0 563 52 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8XI46 0 562 51 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium perfringens (strain 13 / Type A)
A9VQG9 0 562 52 3 520 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus mycoides (strain KBAB4)
Q1WRY8 0 561 51 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Ligilactobacillus salivarius (strain UCC118)
A0Q2S8 0 561 52 2 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium novyi (strain NT)
B9MS76 0 561 52 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B2G994 0 560 51 3 518 3 guaA GMP synthase [glutamine-hydrolyzing] Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VLY3 0 560 51 3 518 3 guaA GMP synthase [glutamine-hydrolyzing] Limosilactobacillus reuteri (strain DSM 20016)
Q1QKC3 0 560 52 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
O85192 0 560 51 4 523 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus rhamnosus
A3PA84 0 559 52 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9301)
A6LQ90 0 559 51 3 517 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
O66601 0 559 53 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Aquifex aeolicus (strain VF5)
Q3B0W1 0 558 52 5 527 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain CC9902)
A2BTY4 0 558 51 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9515)
Q31DE7 0 558 51 6 533 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9312)
Q8DGA5 0 558 51 4 528 3 guaA GMP synthase [glutamine-hydrolyzing] Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B9DLM7 0 558 52 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus carnosus (strain TM300)
Q5WJI0 0 558 50 4 523 3 guaA GMP synthase [glutamine-hydrolyzing] Shouchella clausii (strain KSM-K16)
Q97FM9 0 558 51 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5M4P4 0 557 52 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q38ZE1 0 557 51 3 518 3 guaA GMP synthase [glutamine-hydrolyzing] Latilactobacillus sakei subsp. sakei (strain 23K)
Q8D1V0 0 556 49 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Wigglesworthia glossinidia brevipalpis
Q5M029 0 556 52 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus thermophilus (strain CNRZ 1066)
A8G223 0 556 51 6 533 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9215)
Q88Y74 0 556 51 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q839J8 0 556 52 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Enterococcus faecalis (strain ATCC 700802 / V583)
B8GVI7 0 556 51 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A7U9 0 556 51 1 525 3 guaA GMP synthase [glutamine-hydrolyzing] Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3AD70 0 556 51 2 517 3 guaA GMP synthase [glutamine-hydrolyzing] Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q5N2F8 0 555 51 3 527 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q036Y5 0 555 51 4 523 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q04CA4 0 555 51 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBU7 0 555 51 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B3W952 0 555 51 4 523 3 guaA GMP synthase [glutamine-hydrolyzing] Lacticaseibacillus casei (strain BL23)
B7K8T7 0 555 50 4 531 3 guaA GMP synthase [glutamine-hydrolyzing] Gloeothece citriformis (strain PCC 7424)
A7GIN0 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IFD1 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Okra / Type B1)
A5I720 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYP0 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain ATCC 19397 / Type A)
Q7M8K2 0 555 53 3 526 3 guaA GMP synthase [glutamine-hydrolyzing] Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B0S0S7 0 555 51 4 517 3 guaA GMP synthase [glutamine-hydrolyzing] Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
C1FLV2 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Kyoto / Type A2)
C3KUC5 0 555 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain 657 / Type Ba4)
B5XLN9 0 555 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M49 (strain NZ131)
Q48TF6 0 555 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J6G5 0 555 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M4 (strain MGAS10750)
P64300 0 555 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M18 (strain MGAS8232)
P64299 0 555 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M1
C4XSN8 0 555 52 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A2BNG3 0 555 51 6 533 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain AS9601)
Q5XC20 0 554 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q67S57 0 553 52 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q1JLL1 0 553 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBM8 0 553 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M12 (strain MGAS2096)
B1L1J7 0 553 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Loch Maree / Type A3)
B9DUB2 0 553 52 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus uberis (strain ATCC BAA-854 / 0140J)
C0MAM2 0 553 51 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus equi subsp. equi (strain 4047)
B3EEV3 0 553 54 7 524 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B7JXM2 0 553 51 4 527 3 guaA GMP synthase [glutamine-hydrolyzing] Rippkaea orientalis (strain PCC 8801 / RF-1)
Q311X7 0 553 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P0DB55 0 552 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB54 0 552 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q212S9 0 552 51 2 517 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain BisB18)
Q6G197 0 552 52 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Bartonella quintana (strain Toulouse)
C0MFC7 0 551 51 4 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus equi subsp. zooepidemicus (strain H70)
A2RED2 0 551 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8NY69 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MW2)
Q6GC81 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MSSA476)
Q6F1C4 0 551 51 6 526 3 guaA GMP synthase [glutamine-hydrolyzing] Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q8KFZ5 0 551 53 8 532 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A4SGJ0 0 551 54 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q1JGP6 0 551 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q6GJQ6 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain MRSA252)
P99105 0 551 51 3 519 1 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain N315)
P64296 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IPX0 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain JH9)
A6TYP2 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain JH1)
A7WY93 0 551 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q3B1J3 0 551 54 8 526 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q7V3N7 0 550 50 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B9L0W3 0 550 51 4 530 3 guaA GMP synthase [glutamine-hydrolyzing] Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A8Z0R1 0 550 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain USA300 / TCH1516)
A6QE71 0 550 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain Newman)
Q5HIQ6 0 550 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain COL)
Q2G0Y6 0 550 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJM5 0 550 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain USA300)
B3ELI1 0 550 53 8 529 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeobacteroides (strain BS1)
C1CQS0 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain Taiwan19F-14)
P64298 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P64297 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1ICM9 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain Hungary19A-6)
C1C842 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain 70585)
B5E5U0 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 19F (strain G54)
Q04JQ8 0 549 51 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q3AT13 0 549 53 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium chlorochromatii (strain CaD3)
B2J9G3 0 548 50 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
C1CLE8 0 548 50 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain P1031)
Q2YVL5 0 548 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus aureus (strain bovine RF122 / ET3-1)
P49057 0 548 51 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2IQR1 0 548 50 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain CGSP14)
Q3ANK7 0 547 51 5 527 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain CC9605)
A2C5P2 0 547 51 5 527 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9303)
B4SFX7 0 547 53 7 526 3 guaA GMP synthase [glutamine-hydrolyzing] Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q7UA53 0 547 51 5 527 3 guaA GMP synthase [glutamine-hydrolyzing] Parasynechococcus marenigrum (strain WH8102)
Q49UU9 0 546 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B1WY30 0 546 49 4 531 3 guaA GMP synthase [glutamine-hydrolyzing] Crocosphaera subtropica (strain ATCC 51142 / BH68)
A5N5D9 0 546 49 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYY7 0 546 49 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium kluyveri (strain NBRC 12016)
B9KFL4 0 546 51 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
C1CF29 0 545 50 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain JJA)
B8ZKZ5 0 545 50 4 520 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q8DU81 0 545 50 3 521 3 guaA GMP synthase [glutamine-hydrolyzing] Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8CMQ8 0 545 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B2UZ05 0 545 50 4 519 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Alaska E43 / Type E3)
Q5HRX1 0 545 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2TIX3 0 545 50 4 519 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Eklund 17B / Type B)
B8D0Z5 0 544 50 4 522 3 guaA GMP synthase [glutamine-hydrolyzing] Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q11WK3 0 544 52 6 518 3 guaA GMP synthase [glutamine-hydrolyzing] Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q2S0V0 0 544 51 6 532 3 guaA GMP synthase [glutamine-hydrolyzing] Salinibacter ruber (strain DSM 13855 / M31)
Q8YT80 0 543 49 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9PN49 0 543 51 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
C1A3W7 0 543 54 5 519 3 guaA GMP synthase [glutamine-hydrolyzing] Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
A1W0N3 0 543 51 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FMV3 0 543 50 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q2IV75 0 542 52 2 521 3 guaA GMP synthase [glutamine-hydrolyzing] Rhodopseudomonas palustris (strain HaA2)
Q7MWL9 0 542 53 7 518 3 guaA GMP synthase [glutamine-hydrolyzing] Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIF9 0 542 53 6 517 3 guaA GMP synthase [glutamine-hydrolyzing] Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B3QYF4 0 542 52 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q3MEA8 0 542 49 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4L386 0 542 51 3 519 3 guaA GMP synthase [glutamine-hydrolyzing] Staphylococcus haemolyticus (strain JCSC1435)
B2A5V5 0 542 50 3 517 3 guaA GMP synthase [glutamine-hydrolyzing] Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q5HTL3 0 541 50 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni (strain RM1221)
Q0IE37 0 541 51 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Synechococcus sp. (strain CC9311)
B1XLR5 0 541 49 4 529 3 guaA GMP synthase [glutamine-hydrolyzing] Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A7H2D2 0 541 50 2 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
B9E8Y0 0 540 51 3 525 3 guaA GMP synthase [glutamine-hydrolyzing] Macrococcus caseolyticus (strain JCSC5402)
Q822V6 0 540 52 8 518 3 guaA GMP synthase [glutamine-hydrolyzing] Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A2BZD9 0 540 50 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain NATL1A)
Q9PKM3 0 540 52 8 518 3 guaA GMP synthase [glutamine-hydrolyzing] Chlamydia muridarum (strain MoPn / Nigg)
A6TLR3 0 539 50 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Alkaliphilus metalliredigens (strain QYMF)
Q46I26 0 539 50 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain NATL2A)
Q254T8 0 539 53 8 519 3 guaA GMP synthase [glutamine-hydrolyzing] Chlamydia felis (strain Fe/C-56)
A1BD85 0 538 53 6 524 3 guaA GMP synthase [glutamine-hydrolyzing] Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q7VEH5 0 538 50 5 523 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A6QBI5 0 537 52 6 524 3 guaA GMP synthase [glutamine-hydrolyzing] Sulfurovum sp. (strain NBC37-1)
Q30TH8 0 537 51 3 523 3 guaA GMP synthase [glutamine-hydrolyzing] Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5APF2 0 537 50 6 523 3 GUA1 GMP synthase [glutamine-hydrolyzing] Candida albicans (strain SC5314 / ATCC MYA-2876)
Q6BLS3 0 536 50 6 523 3 GUA1 GMP synthase [glutamine-hydrolyzing] Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q64XQ7 0 536 52 8 525 3 guaA GMP synthase [glutamine-hydrolyzing] Bacteroides fragilis (strain YCH46)
Q5LGV6 0 536 52 8 525 3 guaA GMP synthase [glutamine-hydrolyzing] Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q7V9A9 0 535 50 5 527 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9313)
Q1GGV8 0 535 52 7 528 3 guaA GMP synthase [glutamine-hydrolyzing] Ruegeria sp. (strain TM1040)
B1ZNB4 0 535 50 1 516 3 guaA GMP synthase [glutamine-hydrolyzing] Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
Q0UHC4 0 535 51 7 530 3 GUA1 GMP synthase [glutamine-hydrolyzing] Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q73LZ4 0 533 50 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q5LRL6 0 533 52 5 519 3 guaA GMP synthase [glutamine-hydrolyzing] Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q7NHC2 0 533 49 3 522 3 guaA GMP synthase [glutamine-hydrolyzing] Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B2KCS8 0 533 51 4 518 3 guaA GMP synthase [glutamine-hydrolyzing] Elusimicrobium minutum (strain Pei191)
B9KT27 0 532 52 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J210 0 532 52 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PK79 0 532 52 7 522 3 guaA GMP synthase [glutamine-hydrolyzing] Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A7I131 0 531 50 3 516 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q4P763 0 531 50 9 552 3 GUA1 GMP synthase [glutamine-hydrolyzing] Ustilago maydis (strain 521 / FGSC 9021)
Q6ASN4 0 530 49 5 517 3 guaA GMP synthase [glutamine-hydrolyzing] Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A8ETA7 0 530 50 4 516 3 guaA GMP synthase [glutamine-hydrolyzing] Aliarcobacter butzleri (strain RM4018)
P38625 0 529 49 6 523 1 GUA1 GMP synthase [glutamine-hydrolyzing] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A4WTP4 0 529 51 6 522 3 guaA GMP synthase [glutamine-hydrolyzing] Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q89ZV6 0 529 52 7 522 3 guaA1 GMP synthase [glutamine-hydrolyzing] 1 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q756B7 0 528 49 6 523 3 GUA1 GMP synthase [glutamine-hydrolyzing] Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A6LD04 0 527 52 7 518 3 guaA GMP synthase [glutamine-hydrolyzing] Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q6CU71 0 526 49 6 523 3 GUA1 GMP synthase [glutamine-hydrolyzing] Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_01790
Feature type CDS
Gene guaA
Product glutamine-hydrolyzing GMP synthase
Location 350742 - 352319 (strand: 1)
Length 1578 (nucleotides) / 525 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2231
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00117 Glutamine amidotransferase class-I
PF00958 GMP synthase C terminal domain
PF02540 NAD synthase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0519 Nucleotide transport and metabolism (F) F GMP synthase, PP-ATPase domain/subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MTTNIHQHRILILDFGSQYTQLIARRIREIGVYCELWAWDVTEEQIRNFNPNGIILSGGPESTTEHNSPRAPEYVFSAGVPVLGICYGMQTMSMQLGGAVETSDEREFGYAQVEIRETCELFRGIQDMLDDNGKPLLDVWMSHGDKVTAIPSDFVTVASTETCPFAIMANDEKRFYGVQFHPEVTHTHQGQEILKRFVLDICQCEALWTPEAIIEDTVIRLREQIGDDHVILALSGGVDSSVTAMLLNRAIGKRLTCVFVDNGLLRLNEAEQVMEMFAGKFDLNIIHAKAEDRFLNALKGIADPEAKRKAIGHTFIEIFDEEASKQKQVKWLAQGTIYPDVIESAASETGKAHVIKSHHNVGGLPEDMELGLVEPLRELFKDEVRRIGLQLGLPYDMLYRHPFPGPGLGVRVLGEVKKEYCDILRRADAIFIEELHKADLYHKVSQAFTVFLPVRSVGVMGDGRKYDWVVSLRAVETIDFMTAHWAHLPYDLLGRVSNRIINEVDGISRVVYDVSGKPPATIEWE

Flanking regions ( +/- flanking 50bp)

CGGTCTGCGGACCGCCAGCCTATAATTGTTTGCTCTTGGAACATACATTAATGACAACGAATATTCATCAGCACCGCATTCTTATCCTCGACTTTGGATCGCAGTACACTCAGCTGATCGCGCGCCGTATCCGTGAAATCGGCGTTTATTGTGAACTGTGGGCATGGGATGTCACTGAAGAACAGATCCGTAATTTCAATCCGAACGGTATTATTCTCTCCGGCGGCCCGGAAAGCACCACTGAACACAACAGCCCGCGCGCACCTGAGTATGTCTTCAGCGCCGGTGTACCGGTTCTCGGCATCTGCTACGGCATGCAGACCATGTCTATGCAGCTCGGTGGCGCAGTGGAAACCTCTGACGAGCGCGAGTTCGGTTATGCGCAGGTTGAAATCCGCGAAACCTGCGAACTGTTCCGTGGTATTCAGGATATGCTGGATGACAACGGCAAACCACTGCTGGATGTGTGGATGAGCCACGGTGACAAAGTTACCGCTATCCCGTCTGATTTCGTGACTGTCGCCAGCACCGAAACCTGTCCGTTTGCGATCATGGCAAACGACGAAAAACGTTTTTACGGCGTGCAGTTCCACCCGGAAGTGACCCATACTCACCAGGGCCAGGAAATCCTCAAACGTTTCGTGCTGGATATCTGTCAGTGTGAAGCCCTGTGGACTCCGGAAGCCATTATTGAAGACACCGTTATCCGTCTGCGTGAGCAGATTGGTGATGACCATGTCATCCTGGCACTCTCCGGTGGCGTGGACTCATCCGTGACTGCCATGCTGTTAAACCGTGCTATCGGCAAGCGCCTGACCTGTGTATTCGTGGATAACGGCTTACTGCGCCTGAACGAAGCAGAGCAGGTTATGGAAATGTTTGCGGGCAAATTTGACCTCAATATCATCCACGCCAAAGCGGAAGACCGTTTCCTGAATGCCCTGAAAGGCATTGCGGATCCGGAAGCCAAACGTAAAGCTATCGGCCATACATTCATTGAAATTTTTGATGAAGAAGCGTCAAAACAGAAGCAGGTAAAATGGCTGGCACAGGGCACTATCTATCCGGATGTGATTGAATCTGCCGCCTCTGAAACCGGTAAAGCCCATGTGATCAAATCCCACCATAACGTCGGCGGCCTGCCGGAAGATATGGAGCTGGGACTGGTTGAGCCGCTGCGCGAACTGTTCAAAGATGAAGTCCGCCGTATCGGTCTGCAGCTGGGTCTGCCGTACGATATGCTGTACCGCCATCCGTTCCCGGGCCCGGGTCTGGGTGTCCGCGTACTGGGTGAAGTGAAAAAAGAGTACTGCGACATCCTGCGCCGTGCTGATGCTATCTTTATCGAAGAGCTGCACAAAGCGGATCTGTACCATAAAGTCAGCCAGGCATTCACTGTCTTCCTGCCGGTGCGTTCTGTCGGTGTCATGGGCGACGGCCGTAAATACGACTGGGTTGTCTCACTGCGCGCAGTCGAAACCATCGACTTTATGACCGCACACTGGGCACATCTGCCATACGACCTGTTAGGCCGCGTCTCCAACCGCATCATCAATGAAGTCGACGGCATTTCCCGTGTCGTTTACGACGTCAGCGGCAAGCCACCGGCGACGATTGAGTGGGAATGATATACCAATAGTTTTTAACTACCGGTAATTATCAGAAAACCGAAAGTCAT