Homologs in group_230

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00980 FBDBKF_00980 34.7 Morganella morganii S1 cysA ABC-type sulfate/molybdate transport systems, ATPase component
EHELCC_00565 EHELCC_00565 34.7 Morganella morganii S2 cysA ABC-type sulfate/molybdate transport systems, ATPase component
NLDBIP_02895 NLDBIP_02895 34.7 Morganella morganii S4 cysA ABC-type sulfate/molybdate transport systems, ATPase component
LHKJJB_04410 LHKJJB_04410 34.7 Morganella morganii S3 cysA ABC-type sulfate/molybdate transport systems, ATPase component
HKOGLL_02635 HKOGLL_02635 34.7 Morganella morganii S5 cysA ABC-type sulfate/molybdate transport systems, ATPase component
F4V73_RS07055 F4V73_RS07055 34.2 Morganella psychrotolerans cysA sulfate ABC transporter ATP-binding protein
PMI_RS09040 PMI_RS09040 36.7 Proteus mirabilis HI4320 cysA sulfate/thiosulfate ABC transporter ATP-binding protein CysA

Distribution of the homologs in the orthogroup group_230

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_230

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1SWH9 1.31e-172 488 67 1 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q46ZM0 3.59e-137 398 55 5 371 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K998 7.04e-136 394 55 7 368 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LLP5 7.44e-136 394 55 5 365 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7WID6 2.32e-135 393 54 7 363 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VYN2 3.37e-135 392 53 7 363 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W6G5 9.5e-135 391 54 7 363 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q1GID1 1.01e-134 391 56 4 352 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria sp. (strain TM1040)
Q8XZX8 2.87e-134 390 54 7 366 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8UB29 6.06e-133 386 54 3 356 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YCB1 8.95e-133 386 56 4 349 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5LX21 1.09e-132 385 55 5 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q89WG0 1.09e-132 386 53 5 369 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8FW07 3.46e-132 384 56 4 349 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 3.46e-132 384 56 4 349 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q2L0H5 3.63e-132 385 53 6 363 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q2YKR8 4.7e-132 384 56 4 349 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q13ER6 9.52e-132 384 53 4 371 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
A3PRY1 2.36e-131 382 56 4 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q21CA3 3.42e-131 382 53 3 371 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q2J2E9 5.05e-131 382 52 4 372 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
Q7NRX5 1.45e-130 381 54 5 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1QTX6 1.46e-130 381 55 3 350 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6NDQ0 2.4e-130 380 52 4 372 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3IX40 4.02e-130 379 55 4 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q92WD6 9.95e-130 378 55 4 352 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q8UII7 2.43e-129 378 53 2 352 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9KRT4 4.46e-129 377 54 5 357 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MLB8 3.82e-128 375 53 5 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q8D954 4.7e-128 375 53 5 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q07UI9 1.94e-127 373 52 4 371 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q28QL7 2.71e-127 372 53 4 352 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q164Y5 4.43e-127 372 51 5 361 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6G194 5.87e-127 371 52 6 356 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
Q31VH5 2.47e-126 370 52 5 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q8X6U5 2.7e-126 370 52 5 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q3YW77 3.62e-126 369 52 5 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
P10907 1.07e-125 368 51 5 360 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q3JMW7 5.44e-125 366 52 4 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q1R5H8 6.73e-125 366 52 7 361 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 6.73e-125 366 52 7 361 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q2SU77 9.38e-125 366 53 4 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8FCQ2 1.98e-124 365 52 7 361 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TC10 2.81e-124 364 52 8 365 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8Z245 2.84e-124 364 52 6 365 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
A1URR2 6.15e-124 363 51 5 356 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q0BIZ6 1.19e-123 363 52 3 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1M589 1.21e-123 362 52 7 362 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8ZLF4 1.24e-123 363 52 6 365 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1JIE0 1.26e-123 363 52 6 363 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q57IS3 2.49e-123 362 52 6 365 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q5PJL1 2.68e-123 362 51 6 365 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1B9Q7 3.79e-123 362 53 5 355 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q6G5J0 1.05e-122 360 51 4 353 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q63Q62 1.35e-122 360 52 3 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q2K1C8 1.77e-122 360 52 5 356 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q98G42 3.95e-122 359 52 5 357 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q62GB4 4.34e-122 359 52 3 359 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q1BRZ8 5.4e-122 359 51 3 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia orbicola (strain AU 1054)
A0K3S5 5.4e-122 359 51 3 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia cenocepacia (strain HI2424)
Q66FU4 1.09e-121 358 52 4 358 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q13TV1 1.31e-121 358 50 4 361 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q39KB9 2.46e-121 357 51 3 360 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P55604 3.04e-121 357 52 6 362 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6CZ34 3.51e-121 357 51 5 358 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CNC6 6.67e-121 356 52 4 358 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 6.67e-121 356 52 4 358 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 6.67e-121 356 52 4 358 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
P94360 2.88e-119 352 48 3 365 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
O32151 3.11e-119 352 49 8 373 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q9Z3R9 6.79e-119 351 52 7 359 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q8UBB7 6.72e-118 349 50 3 357 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2K6L3 3.38e-116 343 49 4 357 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P54933 7.06e-115 340 49 2 343 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q1M8R6 8.13e-115 340 49 5 357 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9KL04 1.42e-113 338 49 8 367 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7CS28 3.01e-113 337 49 4 359 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q01937 1.68e-112 335 50 6 362 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q87GB5 2.07e-112 335 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P9WQI3 5.67e-112 335 52 4 325 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 5.67e-112 335 52 4 325 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5DZC6 9.91e-112 333 48 6 354 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65QT6 1.25e-111 333 50 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7MFC4 8.73e-111 331 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 8.73e-111 331 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q1MCN6 1.7e-110 330 47 4 363 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K4V4 1.77e-110 330 47 4 363 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8X8K4 3.26e-110 329 49 6 358 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q00752 5.85e-110 329 46 7 377 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q79EE4 6.98e-110 328 48 6 366 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2YKZ7 8.38e-110 327 47 4 350 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 8.38e-110 327 47 4 350 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8FVT0 9.76e-110 327 47 4 350 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q8FHR3 1.38e-109 327 49 6 358 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q664X5 2.09e-109 327 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 2.09e-109 327 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 2.09e-109 327 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 2.09e-109 327 49 8 365 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q7UBD0 2.63e-109 327 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri
Q0SXQ1 5.16e-109 326 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella flexneri serotype 5b (strain 8401)
P77481 6.42e-109 325 49 6 358 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q0TI47 6.42e-109 325 49 6 358 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RC47 1.17e-108 325 49 6 358 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q8FB37 1.37e-108 325 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3YUV0 1.86e-108 325 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Shigella sonnei (strain Ss046)
Q1R3Q1 1.86e-108 325 49 6 357 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain UTI89 / UPEC)
P68187 1.86e-108 325 49 6 357 1 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli (strain K12)
P68188 1.86e-108 325 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O157:H7
Q6LK87 3.54e-108 324 48 7 355 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q0TA26 1.33e-107 323 49 6 357 3 malK Maltose/maltodextrin import ATP-binding protein MalK Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7N986 5.66e-107 321 48 7 355 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z1U0 5.85e-107 321 49 6 355 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhi
Q9L0Q1 6.08e-107 321 45 4 376 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P19566 6.39e-106 318 49 6 355 1 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57GZ7 6.39e-106 318 49 6 355 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella choleraesuis (strain SC-B67)
Q5PKZ8 1.89e-105 317 49 6 355 3 malK Maltose/maltodextrin import ATP-binding protein MalK Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9YGA6 2.68e-102 309 44 7 374 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
D4GP39 9.64e-100 303 45 7 363 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P18813 8.88e-99 297 54 4 291 3 malK Maltose/maltodextrin import ATP-binding protein MalK (Fragment) Klebsiella aerogenes
D4GP38 6.92e-95 290 44 7 366 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q8RGC8 7.08e-90 277 43 5 311 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9KLQ5 1.22e-88 273 47 4 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6LKD4 4.94e-88 272 41 5 351 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
P37009 5.09e-87 269 47 2 280 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q7AH43 3.57e-83 259 45 2 280 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q5FL41 1.33e-82 258 39 6 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q6D734 1.68e-82 258 47 4 285 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q47T99 2.27e-82 258 42 10 352 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
A0PY57 3.82e-82 257 37 6 345 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q7N8B9 4.6e-82 256 43 5 312 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q042G7 1.31e-81 256 39 5 341 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q0I2Z4 1.59e-81 255 45 3 278 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q24XJ2 2.06e-81 255 38 5 345 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
A0LUE6 3.72e-81 255 40 6 341 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q1GB17 4.84e-81 254 38 6 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q32EY4 5.51e-81 255 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q63E84 5.72e-81 253 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 5.72e-81 253 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 5.72e-81 253 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 5.91e-81 253 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q74K65 5.93e-81 254 39 5 341 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q7MKU3 7.01e-81 254 45 2 283 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 7.01e-81 254 45 2 283 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
A1TXH7 7.98e-81 254 47 2 261 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q04BG2 8.96e-81 254 38 6 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q5PMK1 1.12e-80 254 45 4 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q81TH8 1.17e-80 252 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
P40790 1.23e-80 254 45 4 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.23e-80 254 45 4 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q30V33 1.36e-80 253 51 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q3Z2Z3 1.85e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.85e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q81GC1 3.2e-80 251 45 2 263 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P69877 3.38e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 3.38e-80 253 45 4 295 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 3.38e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 3.38e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 3.38e-80 253 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1RD28 4.67e-80 252 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 4.67e-80 252 45 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q1AS06 5.81e-80 252 43 5 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
P44531 7.92e-80 250 44 3 282 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q578K3 1.42e-79 250 43 2 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 1.42e-79 250 43 2 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q6D4E2 1.85e-79 251 44 4 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9K876 1.89e-79 250 38 7 352 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1GIE5 2.03e-79 250 38 6 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q1WVI7 2.55e-79 250 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q03AH0 2.55e-79 250 39 7 350 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q5E586 3.18e-79 250 41 3 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8Z7H7 3.55e-79 250 45 4 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
A1TAI4 4.06e-79 250 43 2 278 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q0I3Y9 4.25e-79 249 42 4 291 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q9KS33 4.52e-79 250 47 3 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87PH3 5.25e-79 249 43 3 285 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2K8C8 5.99e-79 249 44 2 283 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q03PF2 8.08e-79 249 39 9 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q65UE1 1.04e-78 249 48 2 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8YCG3 1.17e-78 248 43 2 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2SJY7 2.07e-78 248 47 2 244 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q8U6M1 2.26e-78 247 42 2 284 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q92WJ0 2.38e-78 247 44 5 290 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q65S66 2.48e-78 247 43 3 284 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1B8V9 3.42e-78 248 42 4 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 3.42e-78 248 42 4 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
O85818 4.46e-78 247 42 5 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q4QK57 9.91e-78 246 43 5 289 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q1QE80 1.02e-77 247 49 1 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P45171 1.06e-77 246 42 5 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SRL2 1.07e-77 245 38 4 335 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q8FVV5 1.31e-77 245 42 2 286 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q830W6 1.46e-77 245 37 7 347 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q6LR20 1.59e-77 246 42 4 298 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q0T5R2 1.78e-77 246 43 4 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q6NBT1 2.89e-77 244 38 8 350 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9I6L0 4.65e-77 243 47 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q97KS6 4.75e-77 244 37 7 346 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q72FW5 4.85e-77 244 46 3 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q722B1 8.63e-77 244 36 5 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q88ZJ6 9.14e-77 243 39 7 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q92DL6 9.21e-77 243 36 5 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7VNG4 1.46e-76 243 41 5 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q88CL2 1.53e-76 242 48 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8Y8T6 1.56e-76 243 36 5 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8ELR4 1.68e-76 243 36 6 352 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5ZWE4 5.55e-76 241 42 5 288 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A0AGP9 7.3e-76 241 36 5 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q03JH1 7.65e-76 242 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9CM80 7.67e-76 241 44 2 278 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q3KBH4 7.82e-76 241 38 7 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q5M397 8.61e-76 241 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q1MQ44 9.29e-76 241 45 5 286 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5LYN4 1.04e-75 241 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q8XIZ5 1.19e-75 240 38 5 331 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.19e-75 240 38 5 331 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q6F9A8 1.55e-75 240 40 4 288 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9CP06 1.69e-75 240 43 6 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q5WXF0 1.84e-75 240 45 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q88AS5 2.17e-75 239 47 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8DIA0 2.28e-75 239 47 2 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5HQ70 2.74e-75 239 36 6 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q18AM3 3.93e-75 239 36 6 352 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q7CN92 5.98e-75 239 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 5.98e-75 239 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q5YZY9 1.37e-74 237 46 3 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q1J6Q6 1.38e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.38e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.38e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.38e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XCA4 1.83e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5X627 1.84e-74 238 45 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
P0CZ35 1.93e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 1.93e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 1.93e-74 238 37 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q4L5B3 2.31e-74 237 36 7 353 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q8CPN0 2.6e-74 237 36 6 343 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7W9U5 3.16e-74 236 43 4 274 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q38VW6 3.76e-74 237 36 7 349 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
A3CMQ7 3.96e-74 237 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q98HF7 5.24e-74 236 37 5 347 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8DPC2 9.16e-74 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 9.16e-74 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 9.16e-74 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7WGW1 1.14e-73 235 43 4 274 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8DZJ0 1.2e-73 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.2e-73 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.2e-73 236 38 8 354 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q7VZE5 1.66e-73 235 43 4 274 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9X196 1.8e-73 235 37 5 310 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8DUF7 2.04e-73 235 37 7 358 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q7A169 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 2.27e-73 235 38 7 334 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 2.27e-73 235 38 7 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q7N6Z2 3.36e-73 234 41 3 290 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NWX3 3.77e-73 234 44 7 288 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q92UV5 4.46e-73 235 37 6 351 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q49WM4 4.61e-73 234 34 8 358 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8Z0H0 6e-73 233 45 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q609Q1 7.89e-73 233 45 2 254 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7NX01 1.04e-72 233 42 6 285 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q160M2 1.18e-72 233 46 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0SML1 1.85e-72 232 45 1 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
P31134 3.78e-72 232 40 3 294 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q660M8 4.99e-72 231 46 1 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q6D201 5.13e-72 230 44 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O51587 5.21e-72 231 45 1 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q5LT05 7.93e-72 231 38 6 342 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P63354 8.87e-72 230 42 2 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 8.87e-72 230 42 2 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8A883 9.12e-72 234 42 3 266 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q0RAT5 9.19e-72 234 49 0 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q89UD2 9.51e-72 230 36 7 340 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P55453 1.14e-71 229 47 1 235 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9JZW0 1.6e-71 230 37 5 327 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8EBC3 1.64e-71 230 38 7 357 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9I6T2 1.89e-71 230 39 6 328 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9MUN1 2.06e-71 229 39 3 288 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9JUX4 2.51e-71 229 37 5 327 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q0AGF4 2.95e-71 229 38 8 330 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q5L222 3.29e-71 229 36 6 341 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q7NIW1 3.86e-71 228 44 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q64SQ6 4.35e-71 232 42 3 266 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q9G4F5 4.59e-71 228 41 5 286 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q110U3 5.52e-71 229 42 3 277 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
P77795 7.13e-71 228 41 3 281 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q03ZQ0 8.3e-71 228 38 4 330 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q5LBT4 8.81e-71 231 42 3 266 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9TKX3 1.07e-70 227 44 2 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8UH62 1.1e-70 227 39 4 299 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8E8K8 1.19e-70 227 39 6 307 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q4K681 1.3e-70 228 37 7 342 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O31339 2.82e-70 226 38 6 311 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
P14788 3.08e-70 226 44 3 246 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q82TL6 4.56e-70 226 43 2 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3MAR5 5.39e-70 226 47 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YM92 6.06e-70 226 47 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q73XU8 7.7e-70 226 46 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q87DT9 7.93e-70 225 41 3 287 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q57293 8.19e-70 225 42 5 281 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q93DX8 8.33e-70 222 43 4 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q65T42 8.52e-70 225 35 8 358 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9PDN2 1.03e-69 225 41 3 287 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
P9WQM1 1.21e-69 225 45 1 234 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 1.21e-69 225 45 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 1.21e-69 225 45 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q60AI1 1.28e-69 226 45 1 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7NQN5 2.6e-69 224 39 3 295 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q14Q07 1.1e-68 222 34 5 344 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8PC11 1.1e-68 222 38 6 309 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q02Z10 1.21e-68 224 36 6 344 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q668K6 1.66e-68 222 40 4 295 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q81GU1 1.75e-68 222 41 4 267 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8D0W8 2.49e-68 222 40 4 295 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q9CGD4 2.61e-68 224 36 6 344 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
P16676 2.64e-68 222 39 4 297 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q8FFB3 2.75e-68 222 39 4 297 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBJ8 2.97e-68 221 39 4 297 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q82WT5 3.38e-68 221 38 7 322 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8XZP8 3.69e-68 221 40 5 277 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
O83658 4.02e-68 222 40 3 297 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q9HY19 8.3e-68 220 41 4 290 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PNN4 9.06e-68 219 38 4 309 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q02R79 9.65e-68 220 41 4 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7UC29 1.05e-67 220 39 4 297 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q9KUI0 1.09e-67 220 46 2 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q62K82 1.13e-67 219 45 3 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q63TY1 1.21e-67 219 45 3 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8D653 1.95e-67 219 44 2 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q92XW1 2e-67 219 41 3 278 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
P74548 3.5e-67 218 36 6 337 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P40860 1.51e-66 217 40 3 282 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z4V6 1.96e-66 217 40 3 282 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P56344 2e-66 213 43 1 234 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q97UY8 2.74e-66 216 34 9 359 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q04G50 3.6e-66 216 36 5 327 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q92VJ2 5.13e-66 216 41 5 280 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q98K23 5.67e-66 215 41 3 278 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6F0V4 6.42e-66 215 37 4 293 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6MCV4 8.09e-66 216 41 1 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q8F6Z1 1.04e-65 215 36 6 322 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.04e-65 215 36 6 322 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q6MU19 1.15e-65 214 34 5 345 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9A7X1 1.25e-65 214 37 5 322 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A3DDF6 1.29e-65 214 39 4 279 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8U4K3 1.36e-65 214 36 7 340 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q2SSS4 2.17e-65 214 33 5 345 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2YAD6 3.6e-65 214 37 4 298 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8UA73 1.4e-64 211 35 6 338 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8RI39 3.31e-64 211 32 6 358 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
O57896 7.22e-63 207 35 5 322 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5JEB0 2.97e-62 205 40 2 263 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P75264 8.56e-61 208 42 3 255 1 MPN_134 Putative ABC transporter ATP-binding protein MG187 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75264 6.34e-21 97 43 0 102 1 MPN_134 Putative ABC transporter ATP-binding protein MG187 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P96063 2.31e-60 201 37 9 354 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ7 2.98e-60 201 37 10 355 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z8W8 3.54e-60 201 37 11 357 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q57SD6 1.89e-59 199 37 10 355 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q9V2C0 2.24e-58 195 37 5 285 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q0RYP7 3.76e-57 192 33 9 347 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q0SBZ1 6.56e-57 192 33 9 347 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
P44513 6.98e-57 192 35 6 305 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QP85 4.69e-56 189 35 6 305 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q4KC87 1.92e-55 188 33 9 347 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6D2F6 2.41e-55 187 38 5 273 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0S0Z3 3.73e-55 187 32 9 347 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q3KCC5 3.25e-53 182 33 8 351 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q45460 4.93e-53 182 40 3 240 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
O34992 2.41e-52 181 40 3 240 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
O86751 2.85e-52 179 39 0 222 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P47433 3.45e-52 185 40 1 234 3 MG187 Putative ABC transporter ATP-binding protein MG187 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47433 1.12e-21 99 44 1 110 3 MG187 Putative ABC transporter ATP-binding protein MG187 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q82JY6 7.89e-52 178 32 3 325 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q4W575 8.39e-51 176 40 3 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 8.39e-51 176 40 3 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q98G43 4.51e-50 174 33 6 291 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5FA19 4.87e-50 174 39 3 235 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P21410 1.56e-49 172 35 8 296 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
P10091 3.02e-49 172 38 0 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q56927 2.18e-48 169 32 10 355 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q1CJS9 3.74e-48 169 32 12 360 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 3.74e-48 169 32 12 360 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 3.74e-48 169 32 12 360 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 4.82e-48 169 32 12 360 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
A0A0H2ZLL3 5.22e-48 165 40 2 219 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9KIF7 2.05e-46 166 39 3 221 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q85A69 5.49e-46 164 37 0 220 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q9KHT9 7.81e-46 164 37 3 233 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 7.81e-46 164 37 3 233 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q50966 8.95e-46 163 37 3 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
P27675 2.81e-45 158 39 6 236 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
E0SCY1 3.05e-44 160 37 1 223 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
O30144 3.56e-44 155 41 4 229 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q5MZ54 6.72e-44 164 39 3 225 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 6.72e-44 164 39 3 225 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8ZPK4 1.45e-43 157 36 3 241 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q58762 1.71e-43 155 38 3 221 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P10346 2.26e-43 153 39 7 245 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P17328 3.07e-43 157 39 2 223 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14175 4.11e-43 157 39 2 223 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q0K9I2 4.36e-43 154 41 3 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P39459 5.75e-43 153 38 3 209 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q5LT65 1.02e-42 154 37 5 232 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q4FL37 1.35e-42 154 36 6 248 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q46ZU5 1.67e-42 152 41 7 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1CDR0 5.57e-42 150 40 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 5.57e-42 150 40 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 5.57e-42 150 40 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q6FFZ1 8.69e-42 150 39 3 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q665B6 9.56e-42 150 40 4 215 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7MPC5 1.82e-41 148 37 1 214 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain YJ016)
Q8DE95 1.82e-41 148 37 1 214 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio vulnificus (strain CMCP6)
Q16BJ3 2.29e-41 149 40 6 215 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q57855 3.44e-41 148 39 3 204 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4QLQ1 4.56e-41 146 38 2 199 3 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain 86-028NP)
Q8XZQ4 6.51e-41 148 42 5 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8RQL7 7.04e-41 147 34 4 238 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P44986 1.05e-40 145 38 2 199 1 thiQ Thiamine import ATP-binding protein ThiQ Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87SV4 1.17e-40 146 40 0 195 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5WBL0 1.9e-40 145 38 3 210 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q1LNM0 3.22e-40 146 42 6 207 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q28K97 5.37e-40 145 40 7 216 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q55462 6.45e-40 152 38 2 208 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2J1U0 8.13e-40 147 38 1 207 3 modC Molybdenum import ATP-binding protein ModC Rhodopseudomonas palustris (strain HaA2)
O34677 1.35e-39 143 37 5 230 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
P73265 2.79e-39 143 41 4 194 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13CI6 3.17e-39 146 38 3 216 3 modC Molybdenum import ATP-binding protein ModC Rhodopseudomonas palustris (strain BisB5)
P45769 3.49e-39 142 35 6 240 3 yhdZ Uncharacterized amino-acid ABC transporter ATP-binding protein YhdZ Escherichia coli (strain K12)
Q1MFL8 3.98e-39 143 37 3 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q4ZSS5 4.08e-39 145 33 4 256 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. syringae (strain B728a)
P48243 4.78e-39 142 35 4 238 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q39CJ6 5.22e-39 142 38 6 234 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BT84 5.56e-39 142 37 4 231 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
A0KAV6 5.56e-39 142 37 4 231 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
P33360 5.56e-39 144 36 2 228 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q7VI92 7.59e-39 144 34 3 229 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q5NN23 8.27e-39 141 40 4 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q0I354 9.65e-39 140 38 4 202 3 thiQ Thiamine import ATP-binding protein ThiQ Histophilus somni (strain 129Pt)
Q5LVM5 1.14e-38 142 38 7 216 3 tauB Taurine import ATP-binding protein TauB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P38046 1.29e-38 142 36 3 212 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O26096 1.41e-38 143 32 1 239 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZJ34 1.68e-38 143 32 3 240 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q8U648 1.72e-38 141 39 3 199 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q55463 1.94e-38 141 33 3 224 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9PR37 1.99e-38 147 35 8 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9PR37 1.13e-20 96 40 0 110 3 potA Spermidine/putrescine import ATP-binding protein PotA Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q21BU8 2.09e-38 143 33 5 261 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q6LV32 2.57e-38 140 32 2 219 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
P73450 3.4e-38 148 39 4 213 3 nrtC Nitrate import ATP-binding protein NrtC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1RGD0 3.42e-38 139 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q7VV72 3.66e-38 143 35 3 231 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 3.66e-38 143 35 3 231 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 3.66e-38 143 35 3 231 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q13ZK7 3.67e-38 142 42 6 214 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q0P9X7 3.78e-38 139 34 4 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8FL82 3.93e-38 139 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLS2 4.05e-38 139 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q65SC9 4.5e-38 139 37 2 211 3 thiQ Thiamine import ATP-binding protein ThiQ Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P46920 5.14e-38 144 33 1 223 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q9RR46 6.38e-38 143 34 3 226 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q2W1R8 6.62e-38 142 32 6 264 3 modC Molybdenum import ATP-binding protein ModC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q1CR30 7.19e-38 141 31 1 239 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q48J29 7.5e-38 142 36 3 222 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P45092 8.04e-38 139 38 4 221 3 artP Arginine transport ATP-binding protein ArtP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6HHI7 9.11e-38 139 33 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63A38 9.11e-38 139 34 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q81P94 9.81e-38 139 33 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
Q881C1 1.09e-37 142 33 6 269 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1VZQ5 1.22e-37 138 33 4 239 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9I1C8 1.53e-37 141 33 1 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0BMC9 1.6e-37 141 32 2 240 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.6e-37 141 32 2 240 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q736E0 1.66e-37 138 34 5 219 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3Z5U5 1.68e-37 137 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
A0RFA4 1.79e-37 138 35 4 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis (strain Al Hakam)
Q0T8D1 1.97e-37 137 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q326G9 1.97e-37 137 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q87UI3 2.05e-37 138 36 4 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q02ME3 2.11e-37 141 33 1 239 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q21XJ9 2.61e-37 138 37 6 216 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P31548 3.41e-37 137 38 0 206 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q97JB8 3.78e-37 138 32 3 230 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q03I82 4.02e-37 138 33 9 264 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q32K28 4.04e-37 137 38 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q3K506 4.07e-37 137 36 3 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q17VE0 4.15e-37 139 31 1 239 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q3M5J9 4.23e-37 137 38 5 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q83MG3 4.26e-37 136 37 0 206 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q2RWI9 5.35e-37 140 35 3 216 3 modC Molybdenum import ATP-binding protein ModC Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q9KP42 5.38e-37 136 38 0 194 3 thiQ Thiamine import ATP-binding protein ThiQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q89ER4 5.43e-37 137 38 5 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q32IZ6 5.67e-37 137 40 4 200 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZRV2 6.07e-37 136 38 0 206 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7NB11 6.25e-37 142 33 6 268 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q7NB11 1.19e-22 102 42 0 105 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q5NFU5 6.78e-37 139 32 2 240 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q3Z542 7.07e-37 137 40 4 200 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 7.07e-37 137 40 4 200 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q48CA0 1.05e-36 137 35 4 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17985
Feature type CDS
Gene ugpC
Product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC
Location 3951675 - 3952769 (strand: -1)
Length 1095 (nucleotides) / 364 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_230
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF08402 TOBE domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3839 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, ATPase component MalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10112 multiple sugar transport system ATP-binding protein [EC:7.5.2.-] ABC transporters -

Protein Sequence

MTTVTLTNLEKRYPNGYQAISTLNLSIEQGEMVVLVGPSGCGKSTLLRMIAGLETITDGDLLIDNRRVNEHEPSERDIAMVFQNYALYPHMSVYDNMAYGLRNRKIPKAEIIARVDRAAHMLEISHLLDRKPKELSGGQRQRVAMGRAIVRDPKVFLFDEPLSNLDAKLRVQMRLEIKKLQQKLATTSVYVTHDQVEAMTLADKLVVLNQGHIEQVGSPLEIYESPASVFVATFMGSPAMNILTTHINRGIIEIADGHLAISAHSLPNGEIQLGLRPEHLLINQQNPLFHANVDFIEALGADVLIYATTCDQQSIVIRAANDHGVNVGNRIGVAIYPENLHFFDRQTQKRIERPTMLLSERLVS

Flanking regions ( +/- flanking 50bp)

TTTGATGCAAAGAGCCTTTGTTAAAGGCTTTGTTGATACGGAGAAATAATATGACTACCGTAACACTGACTAATTTAGAAAAACGTTATCCTAATGGTTATCAAGCAATTTCCACGCTCAATCTCTCTATTGAGCAAGGCGAAATGGTGGTTTTAGTAGGGCCTAGTGGTTGTGGAAAATCAACACTACTGCGCATGATAGCGGGATTAGAAACCATCACAGATGGCGATTTACTGATTGATAATCGACGCGTAAATGAACATGAGCCTAGTGAGCGAGATATTGCGATGGTTTTTCAAAATTATGCCCTCTACCCACATATGTCTGTCTATGACAATATGGCGTATGGTTTGCGTAATCGAAAAATCCCCAAAGCTGAAATCATAGCCCGAGTCGATCGCGCTGCTCATATGCTAGAAATAAGCCATTTACTGGATAGAAAACCTAAAGAGCTTTCTGGTGGACAACGCCAACGCGTTGCCATGGGCAGAGCGATTGTCCGTGATCCCAAAGTCTTCTTATTTGATGAACCGCTCTCTAACCTTGATGCCAAACTACGCGTACAAATGCGTCTTGAAATCAAAAAGCTGCAGCAAAAATTAGCCACTACTTCTGTTTATGTCACTCATGATCAAGTGGAAGCCATGACCTTGGCGGATAAATTAGTAGTACTAAACCAAGGTCATATAGAACAAGTTGGCTCCCCCTTAGAGATTTATGAAAGCCCAGCTTCTGTATTTGTGGCAACATTTATGGGATCACCGGCGATGAATATTTTAACCACTCATATCAATCGCGGTATTATTGAAATTGCGGATGGTCATCTTGCTATTTCTGCCCACTCATTACCTAATGGTGAGATCCAACTAGGATTACGTCCTGAACATTTGCTCATAAATCAACAAAATCCACTGTTTCATGCTAATGTCGATTTTATTGAAGCTTTAGGGGCTGATGTTTTAATTTACGCCACCACTTGTGACCAACAATCTATTGTTATTCGAGCCGCAAACGATCATGGTGTTAATGTGGGTAATAGAATAGGTGTTGCTATTTATCCAGAAAATCTACATTTTTTTGATCGACAAACCCAAAAACGGATTGAACGTCCTACCATGTTGTTAAGTGAACGATTAGTCTCTTAATTTATTCTCACTGTGATTCATTTTCAGTTTAATCTTAATAGCAATGTTTT