Homologs in group_276

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05760 FBDBKF_05760 25.9 Morganella morganii S1 punC purine nucleoside transporter PunC
EHELCC_11830 EHELCC_11830 25.9 Morganella morganii S2 punC purine nucleoside transporter PunC
NLDBIP_12170 NLDBIP_12170 25.9 Morganella morganii S4 punC purine nucleoside transporter PunC
LHKJJB_12030 LHKJJB_12030 25.9 Morganella morganii S3 punC purine nucleoside transporter PunC
HKOGLL_10645 HKOGLL_10645 25.9 Morganella morganii S5 punC purine nucleoside transporter PunC
F4V73_RS03565 F4V73_RS03565 26.3 Morganella psychrotolerans punC purine nucleoside transporter PunC
PMI_RS06765 PMI_RS06765 27.2 Proteus mirabilis HI4320 punC purine nucleoside transporter PunC

Distribution of the homologs in the orthogroup group_276

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_276

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O34307 8.49e-82 259 36 2 353 3 yvmA Uncharacterized MFS-type transporter YvmA Bacillus subtilis (strain 168)
P37597 8.95e-28 116 30 4 272 1 ydhC Inner membrane transport protein YdhC Escherichia coli (strain K12)
Q1RI77 8.9e-24 105 28 8 360 3 RBE_0856 Uncharacterized transporter RBE_0856 Rickettsia bellii (strain RML369-C)
O31762 2.26e-23 103 23 9 392 1 ymfD Bacillibactin exporter Bacillus subtilis (strain 168)
P45123 1.09e-21 99 25 2 261 3 bcr Bicyclomycin resistance protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6FJH4 2.15e-20 96 33 2 180 2 DTR1 Multidrug transporter DTR1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A0A254TZW7 3.26e-20 95 25 8 353 3 cex1 Citrate exporter 1 Aspergillus niger
G3Y4N5 3.26e-20 95 25 8 353 3 cex1 Citrate exporter 1 Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q4UMJ9 3.61e-20 94 25 9 364 3 RF_0358 Uncharacterized transporter RF_0358 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P53943 2.56e-19 93 33 2 168 1 AQR1 Probable transporter AQR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FNQ2 3.77e-19 92 32 2 168 3 AQR1 Multidrug transporter AQR1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A0A0U2UXG3 5.51e-19 92 27 6 303 3 ITP1 Itaconate transport protein Ustilago maydis
P32482 2.67e-18 89 30 1 174 3 cmlA Chloramphenicol resistance protein Pseudomonas aeruginosa
B7M562 3.49e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O8 (strain IAI1)
A7ZTR5 3.49e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YWK3 3.69e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Shigella sonnei (strain Ss046)
Q31UW4 3.69e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Shigella boydii serotype 4 (strain Sb227)
B2TUR5 3.69e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IX28 3.69e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6H2 3.69e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O9:H4 (strain HS)
Q0SYP9 3.8e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Shigella flexneri serotype 5b (strain 8401)
Q83PL6 3.83e-18 89 30 0 169 3 mdtL Multidrug resistance protein MdtL Shigella flexneri
B6I3U3 4.59e-18 88 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain SE11)
P31462 4.59e-18 88 30 0 169 1 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12)
B1X9T9 4.59e-18 88 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12 / DH10B)
C4ZYY8 4.59e-18 88 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain K12 / MC4100 / BW2952)
B7L855 4.59e-18 88 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain 55989 / EAEC)
A8ACM0 7.85e-18 87 30 0 171 3 mdtL Multidrug resistance protein MdtL Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LK52 1.04e-17 87 28 0 180 3 mdtL Multidrug resistance protein MdtL Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MJT5 1.13e-17 87 29 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q328Z8 1.74e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Shigella dysenteriae serotype 1 (strain Sd197)
Q1R4M4 1.74e-17 86 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain UTI89 / UPEC)
A1AHP3 1.74e-17 86 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O1:K1 / APEC
B7MGD1 1.74e-17 86 30 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8FBV0 2.53e-17 86 29 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N2F5 2.53e-17 86 29 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O81 (strain ED1a)
B7NR12 2.78e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXB4 2.89e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XB24 2.89e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Escherichia coli O157:H7
B1LL36 2.92e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Escherichia coli (strain SMS-3-5 / SECEC)
B8MKZ7 3.07e-17 86 23 7 417 1 tstL MFS-type transporter phiL Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B7NF27 3.08e-17 86 30 0 164 3 mdtL Multidrug resistance protein MdtL Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4TAV4 3.49e-17 85 28 0 167 3 mdtL Multidrug resistance protein MdtL Salmonella heidelberg (strain SL476)
B7UMH7 3.93e-17 85 29 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q6FSQ7 4.16e-17 86 30 0 173 2 QDR2 Multidrug transporter QDR2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q0TAZ8 4.53e-17 85 29 0 169 3 mdtL Multidrug resistance protein MdtL Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5BIM0 5.16e-17 85 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi A (strain AKU_12601)
Q5PKV6 5.16e-17 85 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5XZP2 6.5e-17 85 30 0 164 3 mdtL Multidrug resistance protein MdtL Klebsiella pneumoniae (strain 342)
C0Q2L5 7.09e-17 85 30 0 164 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi C (strain RKS4594)
Q57HZ5 7.09e-17 85 30 0 164 3 mdtL Multidrug resistance protein MdtL Salmonella choleraesuis (strain SC-B67)
Q8Z2N9 1.01e-16 84 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella typhi
B5QUQ6 1.03e-16 84 29 0 164 3 mdtL Multidrug resistance protein MdtL Salmonella enteritidis PT4 (strain P125109)
B5FN15 1.03e-16 84 29 0 164 3 mdtL Multidrug resistance protein MdtL Salmonella dublin (strain CT_02021853)
A9MX86 1.14e-16 84 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYB3 1.14e-16 84 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella newport (strain SL254)
B5EYX7 1.14e-16 84 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella agona (strain SL483)
B4TN12 1.2e-16 84 28 0 166 3 mdtL Multidrug resistance protein MdtL Salmonella schwarzengrund (strain CVM19633)
P28246 1.37e-16 84 27 3 236 1 bcr Bicyclomycin resistance protein Escherichia coli (strain K12)
A6TG19 1.48e-16 84 30 0 164 3 mdtL Multidrug resistance protein MdtL Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8ZKY1 1.94e-16 84 29 0 164 3 mdtL Multidrug resistance protein MdtL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P31442 5.21e-16 82 26 0 182 1 emrD Multidrug resistance protein D Escherichia coli (strain K12)
Q68WD6 7.45e-16 82 25 6 348 3 RT0591 Uncharacterized transporter RT0591 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P62967 1.05e-15 82 26 5 238 3 tet Tetracycline resistance protein Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P02983 1.05e-15 82 26 5 238 3 tet Tetracycline resistance protein Staphylococcus aureus
Q9ZCV6 2.07e-15 80 32 0 170 3 RP603 Uncharacterized transporter RP603 Rickettsia prowazekii (strain Madrid E)
G4MWA9 2.38e-15 81 28 2 196 2 MFS1 MFS-type efflux transporter MFS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P57538 5.39e-15 79 24 9 356 3 BU466 Uncharacterized transporter BU466 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q59YT1 1.58e-14 78 25 6 299 3 QDR2 MFS antiporter QDR2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P23054 1.59e-14 78 21 11 441 3 tetB Tetracycline resistance protein Bacillus subtilis (strain 168)
Q180E3 2.29e-14 77 26 1 183 1 ribZ Riboflavin transporter RibZ Clostridioides difficile (strain 630)
P40475 3.82e-14 77 27 0 173 1 QDR1 Quinidine resistance protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59XM0 5.31e-14 77 25 1 191 2 QDR3 MFS antiporter QDR3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q87FV4 1.25e-13 75 27 1 196 3 mdtL Multidrug resistance protein MdtL Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0D153 1.77e-13 75 31 0 152 2 ATEG_00331 MFS-type transporter ATEG_00331 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A411KUX1 3.15e-13 74 31 1 186 3 ucsD MFS-type transporter ucsD Acremonium sp.
Q5A6P6 4.26e-13 74 25 10 299 2 QDR MFS antiporter QDR1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P54585 4.86e-13 73 24 2 199 3 yhcA Uncharacterized MFS-type transporter YhcA Bacillus subtilis (strain 168)
A0A4P8W7F5 5.13e-13 73 37 0 112 3 pyiT MFS-type efflux transporter pyiT Pyricularia grisea
A0A7L8UVD5 5.15e-13 73 28 1 156 3 ffsH MFS-type efflux transporter ffsH Aspergillus flavipes
A0A345BJP9 2.7e-12 71 23 4 213 3 clz19 MFS-type transporter clz19 Cochliobolus lunatus
A0A3G1DIQ9 2.83e-12 71 25 0 165 3 R5 MFS-type transporter R5 Phoma sp. (strain ATCC 20986 / MF5453)
A4WCC3 3.08e-12 71 23 5 248 3 mdtD Putative multidrug resistance protein MdtD Enterobacter sp. (strain 638)
P96709 3.29e-12 70 27 2 202 3 ydgK Uncharacterized MFS-type transporter YdgK Bacillus subtilis (strain 168)
P36890 3.64e-12 71 29 1 150 3 tet Tetracycline resistance protein Staphylococcus hyicus
P07561 4.13e-12 70 29 1 150 3 tet Tetracycline resistance protein Geobacillus stearothermophilus
P0A4K6 4.16e-12 70 29 1 150 3 tet Tetracycline resistance protein Streptococcus pneumoniae
P0A4K8 4.16e-12 70 29 1 150 3 tet Tetracycline resistance protein Bacillus subtilis
P0A4K7 4.16e-12 70 29 1 150 3 tet Tetracycline resistance protein Bacillus cereus
P40474 6.53e-12 70 28 0 173 1 QDR2 Quinidine resistance protein 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8K902 6.71e-12 70 26 3 226 3 BUsg_567 Uncharacterized transporter BUsg_567 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
D5B5U5 7.58e-12 70 25 6 269 3 mdfA Multidrug transporter MdfA Yersinia pestis (strain Z176003)
A9R4E0 7.58e-12 70 25 6 269 3 mdfA Multidrug transporter MdfA Yersinia pestis bv. Antiqua (strain Angola)
D0JKF6 7.58e-12 70 25 6 269 3 mdfA Multidrug transporter MdfA Yersinia pestis (strain D106004)
D0JUX5 7.58e-12 70 25 6 269 3 mdfA Multidrug transporter MdfA Yersinia pestis (strain D182038)
A8AEE4 1.07e-11 69 26 2 189 3 mdtD Putative multidrug resistance protein MdtD Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A0A4Q4NJ90 1.4e-11 69 22 3 233 2 MFS19 MFS-type transporter MFS19 Alternaria alternata
Q8TFD3 1.53e-11 69 31 2 164 2 dotC Efflux pump dotC Dothistroma septosporum
M2YI75 1.58e-11 69 31 2 164 2 dotC Efflux pump dotC Dothistroma septosporum (strain NZE10 / CBS 128990)
A0L190 1.81e-11 68 28 0 162 3 mdtL Multidrug resistance protein MdtL Shewanella sp. (strain ANA-3)
A0A8F4NV97 1.92e-11 69 29 1 176 3 pydD MFS-type transporter pydD Acremonium sp.
Q8XB84 2.02e-11 68 23 1 209 3 mdtM Multidrug resistance protein MdtM Escherichia coli O157:H7
Q8EA87 3.21e-11 68 25 0 178 3 mdtL Multidrug resistance protein MdtL Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P39386 3.5e-11 67 23 1 209 1 mdtM Multidrug resistance protein MdtM Escherichia coli (strain K12)
A1JKW8 3.92e-11 68 26 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77726 3.93e-11 67 24 13 364 1 yajR Inner membrane transport protein YajR Escherichia coli (strain K12)
P9WJW9 4.63e-11 67 25 2 170 2 jefA Drug efflux pump JefA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJW8 4.63e-11 67 25 2 170 3 jefA Drug efflux pump JefA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P37498 5.43e-11 67 28 4 171 3 yybF Uncharacterized MFS-type transporter YybF Bacillus subtilis (strain 168)
P38776 5.64e-11 67 25 1 175 1 YHK8 Probable drug/proton antiporter YHK8 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C6DBD0 7.43e-11 67 26 2 182 3 mdtD Putative multidrug resistance protein MdtD Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A0A3G1DIJ8 7.53e-11 67 24 1 185 3 M6 MFS-type transporter M6 Phoma sp. (strain ATCC 20986 / MF5453)
P13924 8.27e-11 67 28 1 150 3 tet Tetracycline resistance protein Streptococcus agalactiae
P38125 1.22e-10 66 28 2 167 1 DTR1 Dityrosine transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38227 1.31e-10 66 25 1 198 1 QDR3 Quinidine resistance protein 3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6D2A9 1.97e-10 65 26 2 182 3 mdtD Putative multidrug resistance protein MdtD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
O32182 2.29e-10 65 29 2 172 3 yusP Uncharacterized MFS-type transporter YusP Bacillus subtilis (strain 168)
B6HIC2 4.06e-10 65 24 4 215 3 paaT MFS-rype transporter paaT Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q668C4 4.72e-10 64 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype I (strain IP32953)
P9WG88 4.88e-10 64 24 1 211 3 emrB Multidrug resistance protein B homolog Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8MKZ1 5.11e-10 64 20 6 340 1 tstD MFS-type transporter tstD Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A345BJN8 5.74e-10 65 24 1 185 3 clz9 MFS-type transporter clz9 Cochliobolus lunatus
P0AEJ0 5.86e-10 64 29 3 171 1 emrB Multidrug export protein EmrB Escherichia coli (strain K12)
P0AEJ1 5.86e-10 64 29 3 171 3 emrB Multidrug export protein EmrB Escherichia coli O157:H7
P9WG89 6.21e-10 64 24 1 211 3 emrB Multidrug resistance protein B homolog Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
B4TNI8 6.57e-10 64 26 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella schwarzengrund (strain CVM19633)
Q59RG0 6.82e-10 64 30 2 147 2 NAG4 Major facilitator superfamily multidrug transporter NAG4 Candida albicans (strain SC5314 / ATCC MYA-2876)
A8GHR1 7.09e-10 64 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Serratia proteamaculans (strain 568)
B1JSD2 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMR4 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis (strain Pestoides F)
Q1CK62 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZU7 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Angola)
Q7CJL1 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis
B2K9M2 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5L8 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pestis bv. Antiqua (strain Antiqua)
A7FG15 7.5e-10 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2TXF2 9.73e-10 63 28 6 204 3 oryF MFS-type transporter oryF Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B5FMU8 1.09e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella dublin (strain CT_02021853)
B5XPB7 1.19e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Klebsiella pneumoniae (strain 342)
A6TBH6 1.31e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5BF67 1.38e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi A (strain AKU_12601)
Q5PDW9 1.38e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SXW2 1.45e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella newport (strain SL254)
B5R0C2 1.45e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella enteritidis PT4 (strain P125109)
B5EXV9 1.45e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella agona (strain SL483)
Q8Z5F5 1.55e-09 63 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella typhi
D4AXV8 1.67e-09 63 27 4 237 3 MFS1 MFS-type efflux pump MFS1 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
B3FWT8 1.77e-09 63 30 3 167 3 rdc3 Efflux pump rdc3 Metacordyceps chlamydosporia
C5H884 1.86e-09 62 28 1 168 3 radE Efflux pump radE Floropilus chiversii
Q2UPC1 1.96e-09 62 29 1 158 3 aclA MFS efflux transporter aclA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
F2SH39 2.05e-09 62 27 4 237 2 MFS1 MFS-type efflux pump MFS1 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q8ZNQ0 2.13e-09 62 27 3 188 3 mdtD Putative multidrug resistance protein MdtD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A2V5HGL3 2.21e-09 62 23 2 190 3 ungB MFS-type transporter ungB Aspergillus violaceofuscus (strain CBS 115571)
Q00538 2.29e-09 62 25 14 375 3 mmr Methylenomycin A resistance protein Bacillus subtilis (strain 168)
O34724 2.34e-09 62 24 10 365 3 yceJ Uncharacterized MFS-type transporter YceJ Bacillus subtilis (strain 168)
P9WG87 4.04e-09 62 28 0 153 3 Rv1250 Uncharacterized MFS-type transporter Rv1250 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG86 4.04e-09 62 28 0 153 3 MT1289 Uncharacterized MFS-type transporter MT1289 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P94422 4.72e-09 61 24 0 150 3 ycnB Uncharacterized MFS-type transporter YcnB Bacillus subtilis (strain 168)
P02980 5.84e-09 61 24 6 193 1 tetA Tetracycline resistance protein, class B Escherichia coli
A9N7L0 7.95e-09 60 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P39637 9.58e-09 60 23 3 210 3 ywfA Uncharacterized MFS-type transporter YwfA Bacillus subtilis (strain 168)
B4T9U3 9.66e-09 60 25 2 189 3 mdtD Putative multidrug resistance protein MdtD Salmonella heidelberg (strain SL476)
O06473 1e-08 60 23 7 357 2 yfmO Multidrug efflux protein YfmO Bacillus subtilis (strain 168)
K2RYB6 1.08e-08 60 23 1 176 3 mpsC MFS-type transporper mpsC Macrophomina phaseolina (strain MS6)
P39886 1.26e-08 60 27 2 160 3 tcmA Tetracenomycin C resistance and export protein Streptomyces glaucescens
D7PHY8 1.77e-08 59 26 0 142 1 vrtL Efflux pump vrtL Penicillium aethiopicum
P96712 1.82e-08 59 32 1 149 1 bmr3 Multidrug resistance protein 3 Bacillus subtilis (strain 168)
Q5HFY7 1.94e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain COL)
A8Z415 1.96e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain USA300 / TCH1516)
Q6G9C6 1.96e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MSSA476)
A6QGY6 1.96e-08 59 33 0 105 2 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Newman)
Q2FYJ5 1.96e-08 59 33 0 105 1 norB Quinolone resistance protein NorB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH03 1.96e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain USA300)
Q8NWQ5 2.01e-08 59 33 0 105 1 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MW2)
Q7A5M0 2.05e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain N315)
Q99U52 2.05e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ISW7 2.05e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain JH9)
A6U1Q6 2.05e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain JH1)
A7X2C6 2.05e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9D2V8 2.06e-08 59 23 15 373 1 Mfsd10 Major facilitator superfamily domain-containing protein 10 Mus musculus
Q6GGX2 2.16e-08 59 33 0 105 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain MRSA252)
B8MYS8 2.51e-08 59 22 3 195 2 mfs2 Probable efflux pump mfs2 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q6C8F0 3.22e-08 59 25 2 187 3 CEX1 Citrate exporter 1 Yarrowia lipolytica (strain CLIB 122 / E 150)
A2RJJ9 3.59e-08 58 29 0 144 1 uriP Uridine/deoxyuridine transporter Lactococcus lactis subsp. cremoris (strain MG1363)
P0A0J9 3.61e-08 58 29 1 127 1 qacA Antiseptic resistance protein Staphylococcus aureus
P0A0J8 3.61e-08 58 29 1 127 3 qacA Antiseptic resistance protein Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A1D8PQG0 4.24e-08 58 27 2 148 2 NAG3 Major facilitator superfamily multidrug transporter NAG3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P44927 4.4e-08 58 28 3 160 3 emrB Multidrug export protein EmrB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A8F4NW86 4.78e-08 58 26 2 182 3 gkaD MFS-type transporter gkaD Penicillium citrinum
P9WG90 5.83e-08 58 30 3 164 3 stp Multidrug resistance protein Stp Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O34367 6.43e-08 57 22 3 271 3 ytbD Uncharacterized MFS-type transporter YtbD Bacillus subtilis (strain 168)
P37594 7.27e-08 57 29 1 145 3 smvA Methyl viologen resistance protein SmvA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZXQ3 7.27e-08 57 29 1 145 1 smvA Methyl viologen resistance protein SmvA Salmonella typhimurium (strain 14028s / SGSC 2262)
B3FWS2 7.62e-08 57 27 1 180 3 hpm6 Efflux pump hmp6 Hypomyces subiculosus
P31474 8.05e-08 57 25 0 190 1 hsrA Probable transport protein HsrA Escherichia coli (strain K12)
Q89AA9 9.13e-08 57 27 4 195 3 bbp_411 Uncharacterized transporter bbp_411 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q796Q1 9.19e-08 57 25 1 152 3 yitG Uncharacterized MFS-type transporter YitG Bacillus subtilis (strain 168)
M1WCQ0 1e-07 57 27 1 170 2 tcpA MFS thioclapurine efflux transporter tcpA Claviceps purpurea (strain 20.1)
Q7CP73 1.02e-07 57 24 0 181 3 mdtM Multidrug resistance protein MdtM Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFG0 1.02e-07 57 24 0 181 1 mdtM Multidrug resistance protein MdtM Salmonella typhi
Q9P3V5 1.25e-07 57 24 7 196 3 SPAC1348.05 Uncharacterized transporter C1348.05 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CU10 1.26e-07 57 24 7 196 3 SPAC750.02c Uncharacterized transporter SPAC750.02c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CU11 1.26e-07 57 24 7 196 3 SPBPB2B2.16c Uncharacterized transporter SPBPB2B2.16c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USN4 1.47e-07 57 27 2 181 3 SPCC1529.01 Uncharacterized transporter C1529.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
F2T0J9 1.66e-07 57 25 3 183 2 MFS2 MFS-type efflux pump MFS2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P02982 1.89e-07 56 24 11 286 3 tetA Tetracycline resistance protein, class A Escherichia coli
Q2YY45 2.07e-07 56 33 1 112 3 norB Quinolone resistance protein NorB Staphylococcus aureus (strain bovine RF122 / ET3-1)
F5HN69 2.2e-07 56 25 2 212 3 cpaT MFS transporter cpaT Aspergillus oryzae
P9WG91 2.48e-07 56 30 3 164 1 stp Multidrug resistance protein Stp Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O35018 2.61e-07 56 24 4 185 3 lmrB Lincomycin resistance protein LmrB Bacillus subtilis (strain 168)
Q6GIU7 2.89e-07 55 22 11 400 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MRSA252)
A0A4Q4NMP3 3.59e-07 55 28 3 191 2 MFS54 MFS-type transporter MFS54 Alternaria alternata
S0EEY7 3.96e-07 55 23 1 180 2 FUS6 Efflux pump FUS6 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A6J4B6H5 4.14e-07 55 23 1 180 3 LUC4 MFS-type efflux pump LUC4 Fusarium sp.
E0T2N0 4.2e-07 55 22 5 268 3 mdfA Multidrug transporter MdfA Edwardsiella tarda (strain FL6-60)
D0ZHC6 4.2e-07 55 22 5 268 3 mdfA Multidrug transporter MdfA Edwardsiella tarda (strain EIB202)
P33335 4.5e-07 55 24 2 181 1 SGE1 Protein SGE1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
W7MLD3 5.58e-07 55 23 1 190 3 FUS6 Efflux pump FUS6 Gibberella moniliformis (strain M3125 / FGSC 7600)
P11545 6.44e-07 55 22 1 160 3 mmr Methylenomycin A resistance protein Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A348HAX9 6.85e-07 55 24 0 165 1 phiD MFS-type transporter phiD Fungal sp. (strain ATCC 74256)
K5B8L6 7.06e-07 54 28 3 136 1 C731_2106 Triacylglyceride transporter MHAS_02168/C731_2106 Mycolicibacterium hassiacum (strain DSM 44199 / CIP 105218 / JCM 12690 / 3849)
Q6GBD5 7.56e-07 54 23 14 399 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MSSA476)
Q5HHX4 1.01e-06 53 23 14 399 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain COL)
C5BC70 1.39e-06 53 22 5 267 3 mdfA Multidrug transporter MdfA Edwardsiella ictaluri (strain 93-146)
Q3E9A0 1.46e-06 53 25 5 216 2 ANTR6 Probable anion transporter 6, chloroplastic Arabidopsis thaliana
Q323U7 1.55e-06 53 23 7 275 3 mdfA Multidrug transporter MdfA Shigella boydii serotype 4 (strain Sb227)
P43531 1.66e-06 53 24 2 170 1 ynfM Inner membrane transport protein YnfM Escherichia coli (strain K12)
Q8K999 1.68e-06 53 30 3 157 3 BUsg_450 Uncharacterized transporter BUsg_450 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0A0J6 1.86e-06 53 23 14 399 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain MW2)
P0A0J7 1.86e-06 53 23 14 399 1 norA Quinolone resistance protein NorA Staphylococcus aureus
P0A0J5 1.86e-06 53 23 14 399 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain N315)
P0A0J4 1.86e-06 53 23 14 399 3 norA Quinolone resistance protein NorA Staphylococcus aureus (strain Mu50 / ATCC 700699)
D0CCT2 2.09e-06 53 23 1 173 1 craA Chloramphenicol resistance protein CraA Acinetobacter baumannii (strain ATCC 19606 / DSM 30007 / JCM 6841 / CCUG 19606 / CIP 70.34 / NBRC 109757 / NCIMB 12457 / NCTC 12156 / 81)
B6HN82 2.12e-06 53 22 2 174 3 penM MFS-type transporter penM Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
P0A4K5 2.12e-06 53 23 18 403 3 pmrA Multi-drug resistance efflux pump PmrA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4K4 2.12e-06 53 23 18 403 3 pmrA Multi-drug resistance efflux pump PmrA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P94131 2.2e-06 53 22 18 382 3 mucK Cis,cis-muconate transport protein Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
D3Z5L6 2.28e-06 53 24 5 203 1 Slc18b1 MFS-type transporter SLC18B1 Mus musculus
B4EYY4 2.42e-06 52 24 15 385 3 mdtG Multidrug resistance protein MdtG Proteus mirabilis (strain HI4320)
P76269 2.44e-06 53 24 1 165 3 yebQ Uncharacterized transporter YebQ Escherichia coli (strain K12)
P0AEY8 2.48e-06 52 23 7 275 1 mdfA Multidrug transporter MdfA Escherichia coli (strain K12)
P0AEY9 2.48e-06 52 23 7 275 3 mdfA Multidrug transporter MdfA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEZ0 2.48e-06 52 23 7 275 3 mdfA Multidrug transporter MdfA Escherichia coli O157:H7
Q6UEH3 2.54e-06 53 25 6 283 2 aflT Efflux pump aflT Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
P9WG85 2.93e-06 53 24 1 157 3 Rv1877 Uncharacterized MFS-type transporter Rv1877 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG84 2.93e-06 53 24 1 157 3 MT1926 Uncharacterized MFS-type transporter MT1926 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8J0F3 3.41e-06 52 26 3 247 1 mlcE Efflux pump mlcE Penicillium citrinum
Q8Y9K8 3.91e-06 52 25 2 131 3 lmrB Lincomycin resistance protein LmrB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0A8K1AW52 4.19e-06 52 26 5 170 3 tndD MFS-type transporter tndD Aspergillus flavipes
Q92EE1 4.2e-06 52 25 2 131 3 lmrB Lincomycin resistance protein LmrB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0A1L9UQW4 5.57e-06 52 26 2 202 3 bfoC Efflux pump bfoC Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
Q4WS70 5.57e-06 52 26 5 191 2 mdrA Major facilitator superfamily multidrug transporter mdrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P94574 5.97e-06 52 26 5 193 3 ywoD Uncharacterized MFS-type transporter YwoD Bacillus subtilis (strain 168)
A0A2Z1U8L7 6.02e-06 52 26 5 248 1 pigP MFS-type transporter pigP Monascus ruber
A0A0C1C354 6.21e-06 52 27 3 190 3 opaD MFS-type transporter opaD Aspergillus ustus
P50080 6.27e-06 52 27 2 160 1 AZR1 Azole resistance protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08C75 6.39e-06 52 23 15 389 2 slc18a3a Probable vesicular acetylcholine transporter-A Danio rerio
A0A142I724 6.88e-06 52 27 2 179 3 phomT MFS-type transporter phomT Diaporthe leptostromiformis
Q0P5M9 7.68e-06 51 20 13 392 2 MFSD10 Major facilitator superfamily domain-containing protein 10 Bos taurus
Q9XXQ9 8.68e-06 51 25 2 127 2 hmit-1.2 Proton myo-inositol cotransporter hmit-1.2 Caenorhabditis elegans
A0A2L0P0L8 1e-05 51 25 1 148 3 TwmF MFS-type transporter TwmF Talaromyces wortmannii
P57648 1.43e-05 50 26 1 162 3 BU588 Uncharacterized transporter BU588 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A0A1V6PBC8 1.5e-05 50 24 6 281 1 calB MFS-type transporter calB Penicillium decumbens
G3XSI4 1.69e-05 50 26 1 187 3 aunc Efflux pump aunC Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P36172 1.77e-05 50 24 5 182 3 VBA5 Vacuolar basic amino acid transporter 5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0V6Q0 1.78e-05 50 33 0 96 3 phmH MFS-type efflux transporter phmH Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P39843 1.83e-05 50 25 5 200 3 blt Multidrug resistance protein 2 Bacillus subtilis (strain 168)
A0A6F8RNA5 1.96e-05 50 28 4 193 3 grgE MFS-type transporter grgE Penicillium sp.
D4A9K4 2.01e-05 50 24 6 211 1 Slc18b1 MFS-type transporter SLC18B1 Rattus norvegicus
P10870 2.07e-05 50 28 4 169 1 SNF3 Low glucose sensor SNF3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A2Z5XAK5 2.08e-05 50 24 2 158 3 phm3 MFS-type transporter phm3 Pyrenochaetopsis sp.
P52600 2.26e-05 50 24 2 184 2 emrY Probable multidrug resistance protein EmrY Escherichia coli (strain K12)
Q10072 2.36e-05 50 26 5 175 3 SPAC3H1.06c Uncharacterized transporter C3H1.06c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q07282 2.45e-05 49 21 13 377 3 tetA Tetracycline resistance protein, class E Escherichia coli
Q2U0J8 2.66e-05 49 24 1 166 3 hepF MFS-type transporter hepF Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P0AE24 2.89e-05 49 23 1 195 1 araE Arabinose-proton symporter Escherichia coli (strain K12)
P0AE25 2.89e-05 49 23 1 195 3 araE Arabinose-proton symporter Escherichia coli O157:H7
A8GCZ5 3.26e-05 49 26 19 397 3 mdtG Multidrug resistance protein MdtG Serratia proteamaculans (strain 568)
P33449 3.51e-05 49 21 7 365 3 bmr Multidrug resistance protein 1 Bacillus subtilis (strain 168)
P9WEP4 3.53e-05 49 25 2 193 3 olcL MFS-type transporter olcL Penicillium canescens
A0A0D1DYJ6 3.63e-05 49 29 2 178 1 MMF1 MFS-type efflux pump MMF1 Ustilago maydis (strain 521 / FGSC 9021)
P33733 3.64e-05 49 25 6 185 3 tetA Tetracycline resistance protein, class D Salmonella ordonez
Q99S97 3.64e-05 49 23 1 147 1 sdrM Multidrug efflux pump SdrM Staphylococcus aureus (strain N315)
P32071 4.26e-05 49 24 3 198 3 CYHR Cycloheximide resistance protein Candida maltosa
P44903 4.32e-05 49 25 3 164 3 hsrA Probable transport protein HsrA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04301 4.69e-05 49 23 4 191 1 VBA1 Vacuolar basic amino acid transporter 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C8VQ97 5.67e-05 48 27 3 177 3 ausY MFS-type transporter ausY Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P0AEP1 5.73e-05 48 26 2 157 1 galP Galactose-proton symporter Escherichia coli (strain K12)
P0AEP2 5.73e-05 48 26 2 157 3 galP Galactose-proton symporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A4P8DK16 5.95e-05 48 26 3 183 3 dmxR4 MFS-type transporter dmxR4 Cryptosporiopsis sp. (strain 8999)
A0A1L9WQV4 5.96e-05 48 23 1 157 2 ASPACDRAFT_1881869 Acurin A biosynthesis cluster MFS-type transporter Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A2QBE9 6.22e-05 48 26 1 187 3 aunc Efflux pump aunC Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9HDX4 8.22e-05 48 23 4 196 3 mfc1 Uncharacterized transporter mfc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A443HJZ5 0.000101 48 27 3 185 3 VdtG MFS-type transporter VdtG Byssochlamys spectabilis
Q0UI03 0.000101 48 26 0 142 2 elcC MFS-type efflux pump elcC Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A0E3D8L1 0.000107 48 24 2 191 3 PC-17 MFS-type transporter PC-17 Penicillium crustosum
G1UB37 0.000123 47 24 1 176 2 FLU1 Major facilitator superfamily multidrug transporter FLU1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q0CJ61 0.000124 47 24 1 137 3 atB Efflux pump atB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P40760 0.000134 47 23 12 354 3 yuxJ Uncharacterized MFS-type transporter YuxJ Bacillus subtilis (strain 168)
P51564 0.000141 47 28 5 178 3 tetA Tetracycline resistance protein, class H Pasteurella multocida
A0A5B8YU71 0.000156 47 23 3 198 2 GME11371 MFS-type transporter GME11371 Pestalotiopsis microspora
S0DZN4 0.000163 47 22 3 171 2 bik6 Efflux pump bik6 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q9HE13 0.000164 47 24 3 174 3 SPAC1399.02 Uncharacterized MFS-type transporter C1399.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O31563 0.000167 47 25 6 190 3 yfiU Uncharacterized MFS-type transporter YfiU Bacillus subtilis (strain 168)
A0A0U5GJZ5 0.000171 47 27 2 170 3 ausY MFS-type transporter ausY Aspergillus calidoustus
Q2TXG1 0.000177 47 22 5 220 3 oryN MFS-type transporter oryN Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A0A3G1DJG1 0.000178 47 24 4 202 2 M2 MFS-type transporter M2 Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G9H2R5 0.000181 47 25 3 181 1 cdmB MFS-type transporter cdmB Talaromyces verruculosus
A0A8F4PNE5 0.000208 47 21 6 292 3 atr4 MFS-type transporter atr4 Stereocaulon alpinum
O34456 0.00021 47 21 12 277 2 exuT Hexuronate transporter Bacillus subtilis (strain 168)
S0AU91 0.000229 47 26 4 178 3 fsdG MFS transporter fsdG Fusarium heterosporum
P32369 0.000296 46 30 2 130 3 baiG Bile acid transporter Clostridium scindens (strain JCM 10418 / VPI 12708)
O34502 0.000297 46 27 1 160 3 yvkA Uncharacterized MFS-type transporter YvkA Bacillus subtilis (strain 168)
O59698 0.000301 46 21 4 207 1 SPBC36.01c Uncharacterized transporter C36.01c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P94774 0.000348 45 21 8 279 2 exuT Galacturonate transporter Dickeya chrysanthemi
Q3S2U5 0.000352 46 24 4 248 1 mokI Efflux pump mokI Monascus pilosus
P45598 0.000366 46 22 1 195 3 araE Arabinose-proton symporter Klebsiella oxytoca
A0A1E3B0S4 0.00041 46 21 2 154 3 criB MFS-type transporter criB Aspergillus cristatus
O24723 0.00046 45 28 1 112 3 None Probable 1-hydroxy-2-naphthoate transporter Nocardioides sp. (strain KP7)
A0A0E4AZP4 0.00052 45 21 3 179 3 fsa7 MFS transporter fsa7 Fusarium sp. (strain FN080326)
P96664 0.000526 45 23 12 393 3 ydeG Uncharacterized MFS-type transporter YdeG Bacillus subtilis (strain 168)
P46333 0.000542 45 25 7 211 1 csbC Probable metabolite transport protein CsbC Bacillus subtilis (strain 168)
A0QWU7 0.000592 45 24 6 166 1 mfs Triacylglyceride transporter MSMEG_3069/MSMEI_2992 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
M9M5N8 0.00069 45 29 2 166 1 MMF1 MFS-type efflux pump MMF1 Pseudozyma antarctica (strain T-34)
A0A348HAY7 0.00076 45 28 0 123 1 phiL MFS-type transporter phiL Fungal sp. (strain ATCC 74256)
P02981 0.00087 45 31 3 104 1 tetA Tetracycline resistance protein, class C Escherichia coli
Q14728 0.000879 45 20 11 350 1 MFSD10 Major facilitator superfamily domain-containing protein 10 Homo sapiens
Q6NT16 0.001 45 24 7 211 1 SLC18B1 MFS-type transporter SLC18B1 Homo sapiens
Q9RQ29 0.001 45 23 3 165 1 farB Fatty acid resistance protein FarB Neisseria gonorrhoeae

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17970
Feature type CDS
Gene -
Product MFS transporter
Location 3948616 - 3949803 (strand: -1)
Length 1188 (nucleotides) / 395 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_276
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF07690 Major Facilitator Superfamily

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2814 Carbohydrate transport and metabolism (G) G Predicted arabinose efflux permease AraJ, MFS family

Protein Sequence

MKLSIRSLFYLVCFSALLGSLAQNIYTPVLPLIQQQFNTTLSLVNLTVSAFTFAMAVMQLCYGSLIDKWGRKPILLSGLTISIIGALICIWANSINLLIFGRVIQAIGIAAIPVVAATILGDLYQGNERAKAMGSYQMLLALAPASGPLLGGYLAQHYHYQSIFVFLSMVGLVLLIAHLFYLPETRPEQKQSVKSLSAMRQVLAAPEGKSVFVISFMVFYNYFCLLVFLPLIAFHLYHLNSSEIGGLYVPMSIALVLGSYLYRKVCHLFSAEYGVIITSCINLAMLSLFALFWQISLPIMLILTVLYGLSLGLTMPTHTTLITSHFSSVRATAMGIYNFIRYCGMAAGPMVASYFVTDNHYQYVFYSCVILTSLALCFAIKTLLSTLKQQRQTID

Flanking regions ( +/- flanking 50bp)

TCGCTATTATCTATTTTGTTTCCATGGAAACAAAACTAAGAGGCAATATAATGAAATTATCAATCCGTAGTCTGTTTTACCTTGTTTGCTTTAGCGCTTTATTAGGCTCTCTAGCACAAAATATTTATACTCCTGTGCTGCCATTGATCCAGCAGCAATTTAATACCACATTATCACTGGTTAACCTTACGGTATCAGCTTTCACTTTTGCTATGGCTGTTATGCAGTTATGTTATGGTTCATTGATTGACAAATGGGGCAGAAAACCTATTTTGCTCAGTGGGTTAACGATTTCAATTATCGGCGCACTTATTTGTATATGGGCTAATTCTATTAACCTATTAATTTTTGGACGAGTGATCCAAGCCATAGGTATCGCTGCCATCCCTGTTGTCGCAGCAACTATTTTAGGCGATCTCTATCAAGGGAATGAGCGTGCTAAAGCAATGGGAAGTTACCAAATGTTGCTAGCATTAGCACCAGCGAGTGGTCCTTTATTAGGCGGCTATTTAGCACAACATTATCACTACCAAAGTATTTTTGTTTTCTTAAGTATGGTGGGACTTGTTTTGCTGATTGCCCATCTATTTTATTTACCTGAAACTCGCCCAGAACAAAAACAGTCCGTTAAAAGCTTATCTGCTATGCGACAAGTGCTCGCCGCCCCAGAGGGTAAATCTGTTTTTGTGATAAGTTTTATGGTGTTTTATAACTACTTCTGCCTATTAGTATTTTTACCTTTAATTGCTTTTCACCTTTATCACTTAAATAGCAGTGAAATTGGTGGGCTTTATGTTCCTATGTCCATTGCACTGGTGTTAGGCAGTTACCTTTACCGTAAGGTTTGTCATTTGTTTAGCGCTGAATATGGTGTGATCATAACTTCATGTATAAACCTTGCCATGTTGTCGTTATTTGCCCTATTTTGGCAAATCTCATTACCAATAATGTTAATATTAACGGTGTTATATGGTCTCTCTTTAGGATTAACTATGCCTACACACACGACCTTAATAACCAGCCACTTTAGTTCAGTAAGAGCAACGGCAATGGGTATTTATAATTTTATCCGCTACTGTGGTATGGCTGCAGGGCCTATGGTCGCAAGCTATTTTGTCACCGATAATCATTATCAATATGTCTTTTATTCTTGTGTGATCTTAACAAGTTTGGCATTGTGTTTTGCCATCAAAACGCTACTTTCCACATTAAAACAGCAACGACAAACCATCGACTAACAGGACATTTGATGAAACTAACCATTGAAAAACTGCCGCAGCTTTCAGCA