Homologs in group_2206

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16885 FBDBKF_16885 59.1 Morganella morganii S1 fadB fatty acid oxidation complex subunit alpha FadB
EHELCC_19545 EHELCC_19545 59.1 Morganella morganii S2 fadB fatty acid oxidation complex subunit alpha FadB
NLDBIP_16915 NLDBIP_16915 59.1 Morganella morganii S4 fadB fatty acid oxidation complex subunit alpha FadB
LHKJJB_16555 LHKJJB_16555 59.1 Morganella morganii S3 fadB fatty acid oxidation complex subunit alpha FadB
HKOGLL_17520 HKOGLL_17520 59.1 Morganella morganii S5 fadB fatty acid oxidation complex subunit alpha FadB
F4V73_RS18355 F4V73_RS18355 58.0 Morganella psychrotolerans fadB fatty acid oxidation complex subunit alpha FadB

Distribution of the homologs in the orthogroup group_2206

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2206

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MZ92 0.0 1046 70 1 728 3 fadB Fatty acid oxidation complex subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8G8D1 0.0 994 67 1 715 3 fadB Fatty acid oxidation complex subunit alpha Serratia proteamaculans (strain 568)
A1JIG4 0.0 993 67 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FDF2 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JP63 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TR27 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis (strain Pestoides F)
Q1CN99 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
A9R754 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAN0 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis
Q1C2C4 0.0 979 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
Q66FR8 0.0 978 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K0Z6 0.0 978 66 2 729 3 fadB Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B7UNH4 0.0 978 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83PG1 0.0 975 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Shigella flexneri
Q0SZ36 0.0 975 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Shigella flexneri serotype 5b (strain 8401)
Q3YVC1 0.0 974 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Shigella sonnei (strain Ss046)
P21177 0.0 974 66 2 721 1 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12)
B1XAK8 0.0 974 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / DH10B)
C5A020 0.0 974 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / MC4100 / BW2952)
B7NFE7 0.0 974 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NV20 0.0 974 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q6DAP5 0.0 973 65 1 718 3 fadB Fatty acid oxidation complex subunit alpha Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5YY93 0.0 972 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X8I2 0.0 972 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7
Q5E8X6 0.0 967 65 1 717 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FEW8 0.0 966 65 1 717 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain MJ11)
A8ACZ4 0.0 964 67 2 721 3 fadB Fatty acid oxidation complex subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WFX4 0.0 962 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Enterobacter sp. (strain 638)
B1LM32 0.0 959 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain SMS-3-5 / SECEC)
A8A6V1 0.0 958 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O9:H4 (strain HS)
Q8FBI2 0.0 957 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7MQP0 0.0 957 67 1 716 3 fadB Fatty acid oxidation complex subunit alpha Cronobacter sakazakii (strain ATCC BAA-894)
B5RFL6 0.0 957 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW85 0.0 957 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella enteritidis PT4 (strain P125109)
B5EZW0 0.0 957 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella agona (strain SL483)
Q9L6L5 0.0 956 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYB0 0.0 956 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57HM6 0.0 956 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella choleraesuis (strain SC-B67)
B2TVJ5 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B4TNZ1 0.0 956 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella schwarzengrund (strain CVM19633)
B7LTY9 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1IW61 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TAL0 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7M649 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O8 (strain IAI1)
B7L9A7 0.0 956 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain 55989 / EAEC)
B6I4I6 0.0 955 65 2 722 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain SE11)
Q32A21 0.0 955 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Shigella dysenteriae serotype 1 (strain Sd197)
B7N2F2 0.0 955 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O81 (strain ED1a)
B5XYH0 0.0 954 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae (strain 342)
Q8Z3C6 0.0 953 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella typhi
Q1R466 0.0 953 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli (strain UTI89 / UPEC)
B7MHD1 0.0 953 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O45:K1 (strain S88 / ExPEC)
A6TGM4 0.0 952 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4SZ85 0.0 952 66 2 721 3 fadB Fatty acid oxidation complex subunit alpha Salmonella newport (strain SL254)
B5BIZ0 0.0 950 66 1 716 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain AKU_12601)
Q5PKQ2 0.0 950 66 1 716 3 fadB Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7ZU51 0.0 949 65 2 721 3 fadB Fatty acid oxidation complex subunit alpha Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6LW06 0.0 948 65 1 714 3 fadB Fatty acid oxidation complex subunit alpha Photobacterium profundum (strain SS9)
B6EGU2 0.0 944 64 1 715 3 fadB Fatty acid oxidation complex subunit alpha Aliivibrio salmonicida (strain LFI1238)
Q9F0Y7 0.0 940 64 2 721 3 fadB Fatty acid oxidation complex subunit alpha Enterobacter cloacae
C3LSI3 0.0 930 64 2 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain M66-2)
Q9KNI1 0.0 930 64 2 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F465 0.0 930 64 2 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MQH9 0.0 922 64 1 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain YJ016)
Q8DDK6 0.0 920 64 1 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain CMCP6)
B7VGL4 0.0 917 63 1 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio atlanticus (strain LGP32)
Q87TN9 0.0 915 63 1 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N1D2 0.0 913 62 1 715 3 fadB Fatty acid oxidation complex subunit alpha Vibrio campbellii (strain ATCC BAA-1116)
A4STF2 0.0 882 62 1 715 3 fadB Fatty acid oxidation complex subunit alpha Aeromonas salmonicida (strain A449)
Q08A39 0.0 873 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella frigidimarina (strain NCIMB 400)
A0KEL1 0.0 867 62 1 715 3 fadB Fatty acid oxidation complex subunit alpha Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1RDW6 0.0 855 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain W3-18-1)
A4Y1B6 0.0 855 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3Q8U4 0.0 855 61 1 715 3 fadB Fatty acid oxidation complex subunit alpha Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9KU91 0.0 855 59 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS195)
B0TLB9 0.0 855 59 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella halifaxensis (strain HAW-EB4)
A6WHA0 0.0 854 59 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS185)
A3CYJ4 0.0 854 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E3R3 0.0 854 59 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS223)
A1S1I8 0.0 853 61 2 716 3 fadB Fatty acid oxidation complex subunit alpha Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B8CH91 0.0 845 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella piezotolerans (strain WP3 / JCM 13877)
A8GYG0 0.0 844 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B1KCZ3 0.0 841 61 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella woodyi (strain ATCC 51908 / MS32)
A8FP63 0.0 839 61 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sediminis (strain HAW-EB3)
Q8EKR9 0.0 838 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HPB7 0.0 836 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-4)
A0KR50 0.0 836 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain ANA-3)
Q0I0T3 0.0 833 60 1 714 3 fadB Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-7)
Q489W3 0.0 795 54 1 721 3 fadB Fatty acid oxidation complex subunit alpha Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5QXH7 0.0 783 55 3 715 3 fadB Fatty acid oxidation complex subunit alpha Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q48GW3 0.0 773 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C3K613 0.0 768 55 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain SBW25)
Q87ZB2 0.0 763 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4KFC4 0.0 762 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q88L02 0.0 762 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q93Q12 0.0 761 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas oleovorans
Q3K9D8 0.0 760 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fluorescens (strain Pf0-1)
A5W6H0 0.0 759 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4ZRA0 0.0 759 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas syringae pv. syringae (strain B728a)
B0KH74 0.0 759 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain GB-1)
Q1I7D4 0.0 759 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas entomophila (strain L48)
B1J5A5 0.0 758 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida (strain W619)
Q9HZJ2 0.0 756 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PH8 0.0 756 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYR6 0.0 756 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain LESB58)
A6V382 0.0 755 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas aeruginosa (strain PA7)
Q9AHY3 0.0 755 54 3 715 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas putida
A4VKA3 0.0 751 53 3 715 3 fadB Fatty acid oxidation complex subunit alpha Stutzerimonas stutzeri (strain A1501)
A4XSM8 0.0 751 54 4 717 3 fadB Fatty acid oxidation complex subunit alpha Pseudomonas mendocina (strain ymp)
P28793 0.0 750 54 3 715 1 fadB Fatty acid oxidation complex subunit alpha Pseudomonas fragi
A5WH99 0.0 747 52 5 719 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter sp. (strain PRwf-1)
Q4FQC6 0.0 732 52 5 717 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q8J9 0.0 719 52 5 717 3 fadB Fatty acid oxidation complex subunit alpha Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6FF68 0.0 714 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0VE45 0.0 705 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AYE)
B7I3P1 0.0 705 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AB0057)
B7H1I0 0.0 705 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain AB307-0294)
B2I2J9 0.0 703 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain ACICU)
B0VLX4 0.0 701 51 5 717 3 fadB Fatty acid oxidation complex subunit alpha Acinetobacter baumannii (strain SDF)
A8A2L0 9.52e-123 386 35 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O9:H4 (strain HS)
A3D684 2.85e-121 382 37 19 723 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WQ25 1.14e-120 380 37 19 723 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella baltica (strain OS185)
A1RI92 5.43e-120 378 37 18 722 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain W3-18-1)
A4Y897 1.06e-119 377 37 19 723 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1S7L6 2.82e-119 376 37 15 711 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7MIS5 5.25e-119 376 35 13 692 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain YJ016)
Q8DB47 8.29e-119 375 35 13 692 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio vulnificus (strain CMCP6)
Q8FFG4 3.05e-117 371 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7LLD0 7.13e-117 370 35 16 705 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0HKD1 1.48e-116 369 36 18 718 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-4)
A0KV76 1.77e-116 369 36 18 720 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain ANA-3)
A9N453 2.53e-116 369 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57LW6 2.53e-116 369 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella choleraesuis (strain SC-B67)
B7NP24 2.71e-116 369 35 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q0HWN3 2.79e-116 369 36 17 717 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella sp. (strain MR-7)
A4WCW6 3.07e-116 369 35 14 694 3 fadJ Fatty acid oxidation complex subunit alpha Enterobacter sp. (strain 638)
Q8Z4Z0 4e-116 369 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella typhi
B4SZR0 4.22e-116 369 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella newport (strain SL254)
B4TCA8 4.89e-116 368 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella heidelberg (strain SL476)
B5EZR9 4.89e-116 368 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella agona (strain SL483)
B4TQC2 6.11e-116 368 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella schwarzengrund (strain CVM19633)
B7N5V2 6.14e-116 368 35 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q9KT58 6.35e-116 368 34 11 676 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FPN1 6.65e-116 368 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella dublin (strain CT_02021853)
B5RCL3 6.87e-116 368 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5YXY4 6.98e-116 368 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7 (strain EC4115 / EHEC)
B5R3R9 8.86e-116 367 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella enteritidis PT4 (strain P125109)
B1IXA5 1e-115 367 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q87MM3 1.06e-115 367 33 14 701 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ZNA7 1.27e-115 367 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BBA1 1.31e-115 367 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain AKU_12601)
Q5PCX6 1.31e-115 367 35 12 692 3 fadJ Fatty acid oxidation complex subunit alpha Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q07ZP8 1.5e-115 367 36 16 713 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella frigidimarina (strain NCIMB 400)
Q8XCP2 1.51e-115 367 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O157:H7
B1LME7 1.63e-115 367 35 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain SMS-3-5 / SECEC)
A5F2P2 1.93e-115 367 34 11 676 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8ECP7 2.4e-115 366 36 17 717 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5QXM1 6.97e-115 365 35 16 716 3 fadJ Fatty acid oxidation complex subunit alpha Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B7LBJ5 7.42e-115 365 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain 55989 / EAEC)
A7ZPF8 1.03e-114 365 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MY16 1.25e-114 365 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O81 (strain ED1a)
B7UFZ8 1.25e-114 365 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B6I6Q4 1.53e-114 364 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain SE11)
A7MH81 1.89e-114 364 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Cronobacter sakazakii (strain ATCC BAA-894)
Q1R972 1.99e-114 364 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain UTI89 / UPEC)
A1ADI8 1.99e-114 364 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O1:K1 / APEC
B7MGV7 2.16e-114 364 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O45:K1 (strain S88 / ExPEC)
B7M6M2 3.34e-114 363 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O8 (strain IAI1)
Q3YZM2 3.88e-114 363 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Shigella sonnei (strain Ss046)
Q83QQ0 3.88e-114 363 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Shigella flexneri
Q0T2E6 4.5e-114 363 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Shigella flexneri serotype 5b (strain 8401)
B2TWV4 4.5e-114 363 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P40939 4.56e-114 364 33 13 689 1 HADHA Trifunctional enzyme subunit alpha, mitochondrial Homo sapiens
B0TL21 1.03e-113 362 36 16 714 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella halifaxensis (strain HAW-EB4)
P77399 1.3e-113 362 34 12 699 1 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12)
B1X9L4 1.3e-113 362 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / DH10B)
C4ZVN2 1.3e-113 362 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli (strain K12 / MC4100 / BW2952)
Q31YB7 1.37e-113 362 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Shigella boydii serotype 4 (strain Sb227)
A8ADP2 3.34e-113 361 36 15 694 3 fadJ Fatty acid oxidation complex subunit alpha Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32DJ4 4.53e-113 360 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Shigella dysenteriae serotype 1 (strain Sd197)
Q0TFA6 6.42e-113 360 34 12 699 3 fadJ Fatty acid oxidation complex subunit alpha Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1JK30 8.1e-113 361 36 14 707 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GH86 1.94e-112 359 33 12 696 3 fadJ Fatty acid oxidation complex subunit alpha Serratia proteamaculans (strain 568)
Q6D2L7 1.76e-111 357 34 16 710 3 fadJ Fatty acid oxidation complex subunit alpha Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAL7 5.21e-111 355 34 16 703 3 fadJ Fatty acid oxidation complex subunit alpha Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q1CHK2 1.59e-110 355 35 16 730 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD45 1.59e-110 355 35 16 730 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis
Q1C660 1.59e-110 355 35 16 730 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGK1 1.59e-110 355 35 16 730 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TM82 2.53e-110 355 35 16 731 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pestis (strain Pestoides F)
Q6LTK3 2.86e-110 353 34 15 701 3 fadJ Fatty acid oxidation complex subunit alpha Photobacterium profundum (strain SS9)
Q668V1 5.41e-110 353 35 16 736 3 fadJ Fatty acid oxidation complex subunit alpha Yersinia pseudotuberculosis serotype I (strain IP32953)
A7MS61 9.17e-110 352 33 13 695 3 fadJ Fatty acid oxidation complex subunit alpha Vibrio campbellii (strain ATCC BAA-1116)
A6TC19 2.07e-109 351 34 17 707 3 fadJ Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q29554 8.23e-109 351 32 13 703 2 HADHA Trifunctional enzyme subunit alpha, mitochondrial Sus scrofa
Q5E3U1 4.15e-108 347 35 16 680 3 fadJ Fatty acid oxidation complex subunit alpha Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q64428 8.62e-108 348 32 15 705 1 Hadha Trifunctional enzyme subunit alpha, mitochondrial Rattus norvegicus
B5XVW2 9.9e-108 347 35 15 678 3 fadJ Fatty acid oxidation complex subunit alpha Klebsiella pneumoniae (strain 342)
Q8BMS1 3.35e-107 347 32 15 705 1 Hadha Trifunctional enzyme subunit alpha, mitochondrial Mus musculus
A3QFP3 4.24e-107 345 35 18 720 3 fadJ Fatty acid oxidation complex subunit alpha Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q7N288 6.82e-107 345 35 14 709 3 fadJ Fatty acid oxidation complex subunit alpha Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q39659 5.81e-106 342 31 9 695 1 None Glyoxysomal fatty acid beta-oxidation multifunctional protein MFP-a Cucumis sativus
Q9ZPI5 8.71e-105 339 33 10 657 1 MFP2 Peroxisomal fatty acid beta-oxidation multifunctional protein MFP2 Arabidopsis thaliana
O49809 7.7e-103 334 32 7 653 2 None Glyoxysomal fatty acid beta-oxidation multifunctional protein MFP-a Brassica napus
Q9ZPI6 1.19e-93 310 30 12 705 1 AIM1 Peroxisomal fatty acid beta-oxidation multifunctional protein AIM1 Arabidopsis thaliana
Q8W1L6 1.63e-92 306 30 13 699 1 MFP Peroxisomal fatty acid beta-oxidation multifunctional protein Oryza sativa subsp. japonica
Q6NYL3 3.53e-82 279 30 14 702 2 ehhadh Peroxisomal bifunctional enzyme Danio rerio
Q5R5M8 7.41e-80 273 29 16 690 2 EHHADH Peroxisomal bifunctional enzyme Pongo abelii
Q08426 3.67e-78 268 29 16 689 1 EHHADH Peroxisomal bifunctional enzyme Homo sapiens
P55100 3.05e-75 260 30 12 693 2 EHHADH Peroxisomal bifunctional enzyme Cavia porcellus
Q9DBM2 2.74e-73 255 29 15 709 1 Ehhadh Peroxisomal bifunctional enzyme Mus musculus
P07896 2.02e-72 253 29 16 710 1 Ehhadh Peroxisomal bifunctional enzyme Rattus norvegicus
Q9RVG1 2.97e-50 180 38 5 282 3 hbd Probable 3-hydroxybutyryl-CoA dehydrogenase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0AVM2 1e-48 176 35 2 276 1 Swol_1935 3-hydroxybutyryl-CoA dehydrogenase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P45856 5.69e-48 174 38 5 285 2 mmgB Probable 3-hydroxybutyryl-CoA dehydrogenase Bacillus subtilis (strain 168)
P00348 2.25e-47 173 37 8 298 1 HADH Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial Sus scrofa
Q16836 4.92e-47 172 37 8 296 1 HADH Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial Homo sapiens
Q9WVK7 1.49e-46 171 37 5 289 2 Hadh Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial Rattus norvegicus
P77851 2.32e-46 169 36 2 280 3 hbd 3-hydroxybutyryl-CoA dehydrogenase Thermoanaerobacterium thermosaccharolyticum (strain ATCC 7956 / DSM 571 / NCIMB 9385 / NCA 3814 / NCTC 13789 / WDCM 00135 / 2032)
Q61425 2.13e-45 168 36 5 289 1 Hadh Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial Mus musculus
P34439 9.28e-45 166 32 3 285 1 F54C8.1 Probable 3-hydroxyacyl-CoA dehydrogenase F54C8.1 Caenorhabditis elegans
P41938 2.06e-44 165 33 4 299 3 B0272.3 Probable 3-hydroxyacyl-CoA dehydrogenase B0272.3 Caenorhabditis elegans
Q45223 1.91e-43 162 34 4 293 3 hbdA 3-hydroxybutyryl-CoA dehydrogenase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P52041 1.26e-42 159 34 3 284 1 hbd 3-hydroxybutyryl-CoA dehydrogenase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P45364 2.57e-40 152 32 2 279 3 hbd 3-hydroxybutyryl-CoA dehydrogenase Clostridioides difficile
P9WNP7 2.16e-37 144 33 5 283 1 fadB2 3-hydroxybutyryl-CoA dehydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNP6 2.16e-37 144 33 5 283 3 fadB2 3-hydroxybutyryl-CoA dehydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P76083 2.96e-37 149 30 3 286 1 paaH 3-hydroxyadipyl-CoA dehydrogenase Escherichia coli (strain K12)
A4YI89 1.6e-31 127 38 1 184 1 Msed_2001 3-hydroxypropionyl-coenzyme A dehydratase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
P52046 7.29e-31 125 38 3 186 1 crt Short-chain-enoyl-CoA hydratase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q988C8 4.61e-29 121 29 10 300 1 fhmpcd1 5-formyl-3-hydroxy-2-methylpyridine 4-carboxylate 5-dehydrogenase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4PEN0 6.29e-29 120 43 2 150 1 fer4 Enoyl-CoA isomerase/hydratase fer4 Ustilago maydis (strain 521 / FGSC 9021)
P9WNN9 2.25e-28 118 35 5 195 1 echA8 Probable enoyl-CoA hydratase EchA8 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN8 2.25e-28 118 35 5 195 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64017 2.25e-28 118 35 5 195 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q54HG7 4.4e-28 118 35 5 234 3 auh Methylglutaconyl-CoA hydratase, mitochondrial Dictyostelium discoideum
P94549 5e-28 117 39 1 156 2 fadB Probable enoyl-CoA hydratase Bacillus subtilis (strain 168)
Q1ZXF1 9.16e-27 114 36 4 194 3 echs1 Probable enoyl-CoA hydratase, mitochondrial Dictyostelium discoideum
F9XMX6 1.3e-26 114 40 3 165 3 MYCGRDRAFT_76805 Enoyl-CoA isomerase/hydratase MYCGRDRAFT_76805 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q0AVM1 5.28e-26 111 34 3 175 1 Swol_1936 Crotonyl-CoA hydratase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3TLP5 5.6e-26 112 38 2 171 1 Echdc2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Mus musculus
Q52995 1.6e-25 109 33 5 217 3 fadB1 Probable enoyl-CoA hydratase Rhizobium meliloti (strain 1021)
O32178 1.96e-24 112 27 18 447 2 fadN Probable 3-hydroxyacyl-CoA dehydrogenase Bacillus subtilis (strain 168)
O07137 3.05e-24 105 30 5 218 3 echA8 Probable enoyl-CoA hydratase echA8 Mycobacterium leprae (strain TN)
O34893 3.62e-24 105 37 3 179 3 yngF Putative enoyl-CoA hydratase/isomerase YngF Bacillus subtilis (strain 168)
Q2TBT3 4.06e-24 106 37 2 171 2 ECHDC2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Bos taurus
F4JML5 5.72e-24 106 33 3 189 2 At4g16800 Probable enoyl-CoA hydratase 2, mitochondrial Arabidopsis thaliana
Q8BH95 5.97e-24 105 31 5 219 1 Echs1 Enoyl-CoA hydratase, mitochondrial Mus musculus
P14604 1.69e-23 104 30 6 231 1 Echs1 Enoyl-CoA hydratase, mitochondrial Rattus norvegicus
Q86YB7 3.44e-23 103 36 2 171 1 ECHDC2 Enoyl-CoA hydratase domain-containing protein 2, mitochondrial Homo sapiens
Q5R646 4.74e-23 103 31 6 229 2 ECHS1 Enoyl-CoA hydratase, mitochondrial Pongo abelii
Q58DM8 8.29e-23 102 30 5 226 2 ECHS1 Enoyl-CoA hydratase, mitochondrial Bos taurus
P34559 1.28e-22 102 29 3 198 3 ech-6 Probable enoyl-CoA hydratase, mitochondrial Caenorhabditis elegans
Q9ZCZ1 1.6e-22 106 30 14 327 3 RP560 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia prowazekii (strain Madrid E)
Q9ZCZ1 4.51e-09 63 31 2 132 3 RP560 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia prowazekii (strain Madrid E)
P30084 1.62e-22 102 30 7 260 1 ECHS1 Enoyl-CoA hydratase, mitochondrial Homo sapiens
Q4UL32 3.35e-22 105 29 10 316 3 RF_0890 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q4UL32 2.14e-08 61 29 2 136 3 RF_0890 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68WH7 5.42e-22 105 29 16 355 3 RT0547 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q68WH7 6.93e-09 63 29 2 136 3 RT0547 Putative fatty acid oxidation complex trifunctional enzyme Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P76082 1.76e-21 97 31 4 216 1 paaF 2,3-dehydroadipyl-CoA hydratase Escherichia coli (strain K12)
A0A481WNM8 1.34e-20 100 32 3 186 3 claC Enoyl-CoA isomerase/hydratase claC Penicillium crustosum
Q9JLZ3 2.33e-20 95 38 2 175 1 Auh Methylglutaconyl-CoA hydratase, mitochondrial Mus musculus
Q5R4W0 2.54e-20 95 30 2 195 2 ECHDC1 Ethylmalonyl-CoA decarboxylase Pongo abelii
Q9NTX5 2.65e-20 95 30 2 195 1 ECHDC1 Ethylmalonyl-CoA decarboxylase Homo sapiens
F1LU71 4.57e-20 95 38 2 175 1 Auh Methylglutaconyl-CoA hydratase, mitochondrial Rattus norvegicus
Q13825 8.46e-20 94 38 2 175 1 AUH Methylglutaconyl-CoA hydratase, mitochondrial Homo sapiens
F1NB38 2.98e-19 92 31 1 173 3 ECHDC1 Ethylmalonyl-CoA decarboxylase Gallus gallus
P83589 3.82e-19 93 27 8 303 1 DR_2477 Probable 3-hydroxyacyl-CoA dehydrogenase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q28C91 4.54e-19 92 30 3 216 2 echdc1 Ethylmalonyl-CoA decarboxylase Xenopus tropicalis
Q8Z9L5 6.33e-19 90 28 5 241 3 caiD Carnitinyl-CoA dehydratase Salmonella typhi
Q2HJD5 6.8e-19 91 30 2 195 2 ECHDC1 Ethylmalonyl-CoA decarboxylase Bos taurus
Q5HZQ8 6.86e-19 91 31 2 173 2 echdc1 Ethylmalonyl-CoA decarboxylase Xenopus laevis
B4T6J5 8.65e-19 90 28 5 241 3 caiD Carnitinyl-CoA dehydratase Salmonella newport (strain SL254)
G4V4T7 1.84e-18 89 29 4 227 1 dpgD Enoyl-CoA-hydratase Amycolatopsis orientalis
B5RGA4 2.36e-18 89 29 6 244 3 caiD Carnitinyl-CoA dehydratase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1Q9 2.36e-18 89 29 6 244 3 caiD Carnitinyl-CoA dehydratase Salmonella enteritidis PT4 (strain P125109)
Q8ZRX5 2.47e-18 89 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWR3 2.47e-18 89 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella schwarzengrund (strain CVM19633)
B4TIG9 2.47e-18 89 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella heidelberg (strain SL476)
B5BL54 3.41e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi A (strain AKU_12601)
C0Q4L2 3.41e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi C (strain RKS4594)
Q5PIL1 3.41e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57TJ1 3.41e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella choleraesuis (strain SC-B67)
B5F749 3.41e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella agona (strain SL483)
A9MYJ5 4.08e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5FHG4 4.08e-18 88 28 5 240 3 caiD Carnitinyl-CoA dehydratase Salmonella dublin (strain CT_02021853)
P45361 1.03e-17 84 48 1 88 3 crt Short-chain-enoyl-CoA hydratase (Fragment) Clostridioides difficile
Q6AYG5 1.53e-17 87 28 3 197 1 Echdc1 Ethylmalonyl-CoA decarboxylase Rattus norvegicus
Q8XA35 2.32e-17 86 32 4 177 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O157:H7
Q9KJE7 3.59e-17 85 29 6 225 1 bbsH (E)-benzylidenesuccinyl-CoA hydratase Thauera aromatica
A8ALR7 4.45e-17 85 32 3 169 3 caiD Carnitinyl-CoA dehydratase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MR28 6.73e-17 84 27 4 240 3 caiD Carnitinyl-CoA dehydratase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P59395 1.09e-16 84 31 4 177 3 caiD Carnitinyl-CoA dehydratase Shigella flexneri
P31551 1.42e-16 84 31 4 177 1 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain K12)
B1IRE0 1.42e-16 84 31 4 177 3 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FLA6 1.83e-16 83 31 4 177 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLV3 1.83e-16 83 31 4 177 3 caiD Carnitinyl-CoA dehydratase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q73VC7 2.63e-16 82 33 1 162 3 echA17 Probable enoyl-CoA hydratase echA17 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QJH8 3.14e-16 82 32 1 162 3 echA17 Probable enoyl-CoA hydratase echA17 Mycobacterium avium (strain 104)
Q4V182 3.42e-16 84 29 8 246 3 hbd L-carnitine dehydrogenase Bacillus cereus (strain ZK / E33L)
Q9D9V3 7.12e-16 82 28 2 180 1 Echdc1 Ethylmalonyl-CoA decarboxylase Mus musculus
Q8GB17 8.57e-16 81 32 2 175 1 caiD Carnitinyl-CoA dehydratase Proteus sp. (strain LE138)
B4EY26 8.57e-16 81 32 2 175 3 caiD Carnitinyl-CoA dehydratase Proteus mirabilis (strain HI4320)
P9WNN3 9.68e-16 81 31 1 162 1 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN2 9.68e-16 81 31 1 162 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U753 9.68e-16 81 31 1 162 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KN36 9.68e-16 81 31 1 162 3 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TXE1 9.68e-16 81 31 1 162 1 echA17 Probable enoyl-CoA hydratase EchA17 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1LFW9 1.36e-15 80 37 1 114 3 caiD Carnitinyl-CoA dehydratase Escherichia coli (strain SMS-3-5 / SECEC)
Q869N6 1.44e-15 81 31 0 187 3 DDB_G0271866 3-hydroxybutyryl-CoA dehydratase-like protein, mitochondrial Dictyostelium discoideum
Q8CUW0 1.84e-15 81 28 6 239 3 OB0997 L-carnitine dehydrogenase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
F1R6N4 1.57e-14 78 26 1 185 3 echdc1 Ethylmalonyl-CoA decarboxylase Danio rerio
P42126 3.44e-14 77 32 4 179 1 ECI1 Enoyl-CoA delta isomerase 1, mitochondrial Homo sapiens
Q54SS0 8.64e-14 76 27 2 181 3 ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Dictyostelium discoideum
Q5SKU3 1.11e-13 75 30 2 192 1 TTHA0550 Putative enoyl-CoA hydratase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q92NF5 3.53e-13 76 28 6 227 1 bcoE-bcoF L-carnitine dehydrogenase/betainyl-CoA thioesterase Rhizobium meliloti (strain 1021)
O87873 8.23e-13 72 28 2 159 1 dch Cyclohexa-1,5-dienecarbonyl-CoA hydratase Thauera aromatica
Q93RX5 1.12e-12 73 29 4 192 3 SCO6297 L-carnitine dehydrogenase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q62DG4 1.22e-12 73 28 7 194 3 BMAA0492 L-carnitine dehydrogenase Burkholderia mallei (strain ATCC 23344)
Q6NL24 1.24e-12 72 28 2 202 1 ECHIA Probable enoyl-CoA hydratase 1, peroxisomal Arabidopsis thaliana
Q63MT0 1.58e-12 72 29 7 191 3 BPSS0568 L-carnitine dehydrogenase Burkholderia pseudomallei (strain K96243)
Q3MIE0 2.18e-12 72 26 2 190 2 Echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Rattus norvegicus
I6Y3U6 2.22e-12 71 29 4 179 1 echA20 (7aS)-7a-methyl-1,5-dioxo-2,3,5,6,7,7a-hexahydro-1H-indene-carboxyl-CoA hydrolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q88R32 3.05e-12 72 29 4 208 3 lcdH L-carnitine dehydrogenase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P53526 3.41e-12 71 29 5 206 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium leprae (strain TN)
P42125 3.69e-12 71 30 4 181 1 Eci1 Enoyl-CoA delta isomerase 1, mitochondrial Mus musculus
A0PJR5 4e-12 71 23 4 196 2 echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Danio rerio
Q9Y2S2 4.6e-12 71 28 5 221 1 CRYL1 Lambda-crystallin homolog Homo sapiens
Q5RDZ2 5.04e-12 71 28 5 221 2 CRYL1 Lambda-crystallin homolog Pongo abelii
Q5LLW6 5.77e-12 70 26 3 193 1 dmdD Methylthioacryloyl-CoA hydratase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8CQB9 8.11e-12 70 28 4 224 3 SE_0220 L-carnitine dehydrogenase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
D7URM0 9.47e-12 70 28 3 205 1 Xt-cdh L-carnitine dehydrogenase Pseudomonas sp.
Q96DC8 9.73e-12 70 26 3 190 1 ECHDC3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Homo sapiens
Q98CR3 9.85e-12 70 31 4 161 3 mlr5041 L-carnitine dehydrogenase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9D7J9 1.04e-11 70 26 3 191 1 Echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Mus musculus
Q96VB3 1.11e-11 69 30 2 176 3 AFT3-1 Enoyl-CoA hydratase AFT3-1 Alternaria alternata
D7B2S5 1.2e-11 70 29 5 195 3 Ndas_1341 L-carnitine dehydrogenase Nocardiopsis dassonvillei (strain ATCC 23218 / DSM 43111 / CIP 107115 / JCM 7437 / KCTC 9190 / NBRC 14626 / NCTC 10488 / NRRL B-5397 / IMRU 509)
B1VLT7 1.31e-11 70 27 5 205 3 SGR_6649 L-carnitine dehydrogenase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q9P4U9 1.59e-11 69 29 2 176 3 AKT3-1 Enoyl-CoA hydratase AKT3-1 Alternaria alternata
Q7U004 1.75e-11 68 28 4 189 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
D7UNT2 1.87e-11 70 28 7 231 1 Rs-cdh L-carnitine dehydrogenase/betainyl-CoA thioesterase Rhizobium sp.
Q4WF54 2.25e-11 68 29 3 190 1 sidH Mevalonyl-coenzyme A hydratase sidH Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A9JS71 2.29e-11 68 25 2 181 2 echdc3 Enoyl-CoA hydratase domain-containing protein 3, mitochondrial Xenopus laevis
P9WNN7 2.49e-11 68 28 4 189 1 echA12 Probable enoyl-CoA hydratase EchA12 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN6 2.49e-11 68 28 4 189 3 echA12 Probable enoyl-CoA hydratase echA12 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P23965 3.94e-11 68 29 3 177 1 Eci1 Enoyl-CoA delta isomerase 1, mitochondrial Rattus norvegicus
O69762 5.57e-11 67 25 2 196 1 None Hydroxycinnamoyl-CoA hydratase-lyase Pseudomonas fluorescens
Q9HTH8 1.08e-10 67 27 4 194 1 cdhA L-carnitine dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q62651 1.21e-10 67 22 3 193 1 Ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Rattus norvegicus
Q589W8 1.23e-10 66 29 2 176 3 ACTT3 Enoyl-CoA hydratase ACTT3 Alternaria alternata
O53561 1.57e-10 65 26 2 185 1 echA19 Enoyl-CoA hydratase EchA19 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P77467 3.76e-10 64 28 1 189 1 paaG 1,2-epoxyphenylacetyl-CoA isomerase Escherichia coli (strain K12)
Q9FHR8 3.78e-10 65 23 2 234 1 DCI1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, peroxisomal Arabidopsis thaliana
O35459 5.18e-10 65 23 2 191 1 Ech1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Mus musculus
A5JTM5 5.98e-10 64 23 4 246 1 None 4-chlorobenzoyl coenzyme A dehalogenase Pseudomonas sp. (strain CBS-3)
P9WNP1 6.9e-10 63 28 4 159 1 echA6 Probable enoyl-CoA hydratase EchA6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNP0 6.9e-10 63 28 4 159 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64015 6.9e-10 63 28 4 159 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5RFG0 8.13e-10 64 21 3 196 2 ECH1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Pongo abelii
Q9P4U7 1.01e-09 63 29 2 174 3 AKT3-2 Enoyl-CoA hydratase AKT3-2 Alternaria alternata
P23966 1.13e-09 63 26 5 215 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Bacillus subtilis (strain 168)
Q4L549 1.46e-09 63 25 2 190 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus haemolyticus (strain JCSC1435)
Q7A6A9 1.94e-09 62 25 2 190 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain N315)
Q99V48 1.94e-09 62 25 2 190 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q13011 1.95e-09 63 21 3 196 1 ECH1 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial Homo sapiens
Q8DSN0 2.99e-09 62 27 1 184 3 fabM Trans-2-decenoyl-[acyl-carrier-protein] isomerase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P14755 3.46e-09 62 27 6 236 1 CRYL1 Lambda-crystallin Oryctolagus cuniculus
Q1PEY5 3.65e-09 63 29 4 179 2 At2g30650 Probable 3-hydroxyisobutyryl-CoA hydrolase 2 Arabidopsis thaliana
Q8CPQ4 4.74e-09 61 24 4 197 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQC3 5.1e-09 61 24 4 197 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0R4Q3 6.59e-09 61 25 2 185 3 echA19 Enoyl-CoA hydratase EchA19 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P44960 8.15e-09 61 25 3 194 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92HC9 8.24e-09 58 28 3 149 5 RC0842 Putative uncharacterized protein RC0842 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6GI37 8.61e-09 60 24 2 190 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MRSA252)
Q5HH38 8.61e-09 60 24 2 190 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain COL)
Q99KP3 1.3e-08 60 27 4 193 1 Cryl1 Lambda-crystallin homolog Mus musculus
Q9LKJ1 1.38e-08 61 27 4 188 1 CHY1 3-hydroxyisobutyryl-CoA hydrolase 1 Arabidopsis thaliana
Q811X6 1.51e-08 60 27 6 236 1 Cryl1 Lambda-crystallin homolog Rattus norvegicus
Q4ZSC0 1.65e-08 60 23 3 207 3 Psyr_2918 L-carnitine dehydrogenase Pseudomonas syringae pv. syringae (strain B728a)
Q8NXA0 2.13e-08 59 24 2 190 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MW2)
Q6GAG7 2.13e-08 59 24 2 190 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus aureus (strain MSSA476)
Q49WG8 2.21e-08 59 31 0 103 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8SPX7 2.33e-08 60 26 4 217 2 CRYL1 Lambda-crystallin homolog Bos taurus
Q50130 2.72e-08 58 23 4 176 3 echA6 Probable enoyl-CoA hydratase echA6 Mycobacterium leprae (strain TN)
P52045 2.82e-08 58 25 6 208 1 scpB Methylmalonyl-CoA decarboxylase Escherichia coli (strain K12)
Q7CQ56 3.91e-08 58 25 3 194 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9LCU3 3.98e-08 58 26 5 180 1 fcbB2 4-chlorobenzoyl coenzyme A dehalogenase-2 Arthrobacter sp.
Q0S7P8 4.49e-08 58 27 3 176 1 echA20 (7aS)-7a-methyl-1,5-dioxo-2,3,5,6,7,7a-hexahydro-1H-indene-carboxyl-CoA hydrolase Rhodococcus jostii (strain RHA1)
O85078 6.35e-08 58 26 5 180 1 fcbB1 4-chlorobenzoyl coenzyme A dehalogenase-1 Arthrobacter sp.
Q9CLV5 8.87e-08 57 24 5 193 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Pasteurella multocida (strain Pm70)
P0ABU0 9.98e-08 57 25 5 208 1 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Escherichia coli (strain K12)
P0ABU1 9.98e-08 57 25 5 208 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q55GS6 1.64e-07 57 26 2 153 3 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Dictyostelium discoideum
Q6NMB0 2.21e-07 57 26 4 188 2 At2g30660 Probable 3-hydroxyisobutyryl-CoA hydrolase 3 Arabidopsis thaliana
Q8QZS1 3.87e-07 56 27 4 177 1 Hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Mus musculus
Q9TM10 5.83e-07 55 26 4 197 3 menB 1,4-dihydroxy-2-naphthoyl-CoA synthase Cyanidium caldarium
Q8KLK7 9.27e-07 55 34 2 104 1 BU52_01220 (3,5-dihydroxyphenyl)acetyl-CoA 1,2-dioxygenase Streptomyces toyocaensis
Q8GYN9 9.98e-07 55 26 5 194 1 MENB 1,4-dihydroxy-2-naphthoyl-CoA synthase, peroxisomal Arabidopsis thaliana
O87872 1.09e-06 55 25 2 182 1 oah 6-oxocyclohex-1-ene-1-carbonyl-CoA hydrolase Thauera aromatica
Q8DR19 1.54e-06 53 26 1 164 1 fabM Trans-2-decenoyl-[acyl-carrier-protein] isomerase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5LTH8 1.83e-06 54 28 3 155 3 SPO1436 L-carnitine dehydrogenase/betainyl-CoA thioesterase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O74802 2.1e-06 54 24 3 190 1 snr1 Small ribosomal subunit protein mS47 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5ZJ60 2.39e-06 54 25 3 187 2 HIBCH 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Gallus gallus
Q9WUR2 2.54e-06 54 25 2 176 1 Eci2 Enoyl-CoA delta isomerase 2 Mus musculus
A2VDC2 2.61e-06 53 26 5 178 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Xenopus laevis
Q39TV7 2.67e-06 53 26 0 131 1 bamA 6-oxocyclohex-1-ene-1-carbonyl-CoA hydrolase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
G4V4T6 2.78e-06 54 31 2 104 1 dpgC (3,5-dihydroxyphenyl)acetyl-CoA 1,2-dioxygenase Amycolatopsis orientalis
Q5XIC0 2.92e-06 53 25 2 176 1 Eci2 Enoyl-CoA delta isomerase 2 Rattus norvegicus
Q58EB4 3.9e-06 53 29 4 148 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Danio rerio
Q9XB60 4.77e-06 52 24 2 145 1 carB Carboxymethylproline synthase Pectobacterium carotovorum subsp. carotovorum
Q28FR6 5.21e-06 53 28 3 142 2 hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Xenopus tropicalis
Q5XIE6 5.99e-06 52 28 3 142 1 Hibch 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Rattus norvegicus
W7MSH6 8.06e-06 52 25 5 195 2 FVEG_12628 3-hydroxyacyl-CoA dehydrogenase FVEG_12628 Gibberella moniliformis (strain M3125 / FGSC 7600)
P28817 1.52e-05 52 24 5 186 1 EHD3 Small ribosomal subunit protein mS47 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WNN5 1.9e-05 50 26 3 229 1 echA14 Probable enoyl-CoA hydratase EchA14 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNN4 1.9e-05 50 26 3 229 3 echA14 Probable enoyl-CoA hydratase echA14 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64019 1.9e-05 50 26 3 229 1 echA14 Probable enoyl-CoA hydratase echA14 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9Y232 2.6e-05 51 24 2 169 1 CDYL Chromodomain Y-like protein Homo sapiens
Q6AYK9 3.15e-05 51 24 2 169 1 Cdyl Chromodomain Y-like protein Rattus norvegicus
Q9WTK2 4.53e-05 50 24 2 169 1 Cdyl Chromodomain Y-like protein Mus musculus
Q2LXU2 6.49e-05 49 22 2 170 1 bamA 6-oxocyclohex-1-ene-1-carbonyl-CoA hydrolase Syntrophus aciditrophicus (strain SB)
O75521 7.35e-05 49 23 4 196 1 ECI2 Enoyl-CoA delta isomerase 2 Homo sapiens
Q8SQ26 7.6e-05 49 25 4 195 2 CRYL1 Lambda-crystallin homolog Sus scrofa
Q1K7A4 0.000109 49 27 5 147 1 ehd3 Small ribosomal subunit protein mS47 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7D3B2 0.000118 48 28 4 156 3 Atu5344 L-carnitine dehydrogenase/betainyl-CoA thioesterase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6NVY1 0.000129 48 39 0 56 1 HIBCH 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial Homo sapiens
V5XZU2 0.000137 48 24 2 174 3 AKT6-1 Enoyl-CoA hydratase AKT6-1 Alternaria alternata
Q9Y6F7 0.000283 47 24 4 178 1 CDY2A Testis-specific chromodomain protein Y 2 Homo sapiens
Q9Y6F8 0.00035 47 24 4 178 1 CDY1 Testis-specific chromodomain protein Y 1 Homo sapiens
Q8RXN4 0.00038 47 27 6 185 1 At4g31810 Small ribosomal subunit protein mS47 Arabidopsis thaliana
Q9SHJ8 0.000393 47 24 6 189 1 At1g06550 3-hydroxyisobutyryl-CoA hydrolase-like protein 5 Arabidopsis thaliana
P41942 0.000619 45 26 0 103 3 B0272.4 Uncharacterized protein B0272.4 Caenorhabditis elegans
C5NN19 0.000781 45 23 2 174 3 ACTT6 Enoyl-CoA hydratase ACTT6 Alternaria alternata

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17640
Feature type CDS
Gene fadB
Product fatty acid oxidation complex subunit alpha FadB
Location 3869984 - 3872164 (strand: -1)
Length 2181 (nucleotides) / 726 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2206
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00378 Enoyl-CoA hydratase/isomerase
PF00725 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain
PF02737 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1250 Lipid transport and metabolism (I) I 3-hydroxyacyl-CoA dehydrogenase

Kegg Ortholog Annotation(s)

Protein Sequence

MLYQSENIQADWVKQGIVELVFNASGSINKLDTKTVAMLSEALTVLENTSDLKGVILRSEKPAFIVGADITEFLSLFDAPVEELTQWLHFANHIFNRLEDLPVPTVSAINGYALGGGCECVLATDFRIASPDLRIGLPETKLGIMPGFGGSVRLPRLIGVDNALEIITAGKDINAETALKNGLIQAIVPVDKLKKSAISLIEQAIDGKFDWQAARQPKTVALRLTELEHKMSFAVAKGMVMKVAGPHYPAPMTAVNTIEKAAFLDRKAALELETENFVKLTRTDVAKALVGIFLNDQYVKGITKKRHASLPKQAAVLGAGIMGGGIAYQSALKGIPVTMKDINANSLELGMTEALSLLQKRQEKGRMSAVDMAKTLASIHPTLNYASVADAQIVVEAVVENPKVKASVLAETEALLADHAVLASNTSTIPISLLAKSLTRPENFCGMHFFNPVHRMPLVEIIKGEKTSEETINRIVSYASKMGKTPIIVNDCPGFFVNRVLFPYFAGFSLLLRDGADFIAVDKVMEKAFGWPMGPAYLLDVVGIDTANHAQAVMAQGFPDRMGSIDKDVIALLYQQQRYGQKNNHGFYDYTIDKRGKKQKQVDNDIHSLIEHHVGKKQEFNQDTIIARMMIPMINEVIRCLDEGIIASPAEADIALVYGLGFPPFRGGVFRYLDTIGLAQFVANAEQYSELGPLYQIPESLKQKALRNETYYPKPAKVDVNIRELA

Flanking regions ( +/- flanking 50bp)

CACACTCTAATTATCTGGTCATACCAGTTTATACTTTAGGGAGAATACAAATGCTCTATCAAAGCGAAAATATTCAAGCCGATTGGGTGAAGCAAGGTATTGTTGAGCTCGTTTTCAATGCTAGCGGTTCTATTAATAAATTAGATACAAAAACGGTGGCAATGTTAAGCGAAGCGTTAACAGTATTAGAAAATACATCTGATCTAAAAGGGGTTATTTTACGTTCAGAAAAACCCGCCTTTATTGTTGGTGCCGATATTACCGAATTTTTATCACTTTTTGATGCACCCGTTGAAGAACTGACACAATGGCTACATTTTGCTAATCATATTTTCAATCGATTAGAAGATCTCCCCGTTCCTACAGTTTCTGCCATTAATGGCTACGCCCTAGGCGGTGGCTGTGAATGTGTATTAGCAACGGATTTTCGTATTGCATCACCGGATTTACGCATTGGTTTACCCGAAACAAAACTTGGTATTATGCCGGGTTTTGGTGGCTCTGTTCGGCTACCTCGCCTTATTGGCGTTGATAATGCCTTAGAAATTATTACCGCAGGTAAAGATATTAATGCCGAAACAGCACTTAAGAATGGCTTAATTCAAGCTATTGTCCCTGTTGATAAGCTAAAAAAAAGTGCCATTTCACTGATAGAGCAAGCCATTGATGGCAAATTTGACTGGCAAGCTGCTCGTCAACCTAAAACTGTGGCATTAAGATTAACGGAACTTGAACATAAAATGTCATTTGCTGTGGCAAAAGGCATGGTGATGAAAGTCGCAGGCCCTCATTATCCAGCCCCAATGACCGCCGTTAATACGATAGAAAAAGCCGCATTTCTAGATAGAAAAGCGGCACTTGAATTGGAAACAGAAAACTTTGTCAAACTGACCCGCACCGATGTTGCCAAAGCATTAGTGGGTATTTTCCTTAATGATCAATATGTGAAAGGCATTACTAAAAAACGTCATGCTAGCTTACCAAAACAAGCGGCAGTATTAGGCGCGGGGATCATGGGTGGCGGAATTGCCTATCAATCTGCACTAAAAGGCATTCCTGTTACCATGAAAGATATTAATGCCAACTCCCTTGAATTGGGTATGACAGAAGCACTCAGCCTGTTACAAAAACGTCAAGAAAAAGGACGTATGAGTGCCGTTGATATGGCAAAAACCCTCGCCTCTATTCATCCTACCCTAAACTATGCCAGTGTAGCTGATGCACAAATTGTGGTCGAAGCGGTGGTTGAAAACCCTAAAGTAAAAGCCTCTGTACTTGCTGAAACCGAAGCGCTCCTTGCTGATCATGCTGTACTTGCTTCGAATACCTCAACAATCCCCATTTCGCTACTTGCCAAATCACTAACACGCCCTGAAAATTTCTGTGGAATGCACTTCTTTAATCCCGTTCACCGCATGCCTTTAGTTGAGATCATTAAAGGTGAAAAAACCAGCGAAGAGACGATTAATCGCATTGTCAGTTATGCTAGCAAAATGGGTAAAACGCCAATCATTGTTAATGACTGCCCGGGGTTCTTTGTCAATCGCGTGCTCTTCCCTTATTTCGCCGGATTTTCTCTTTTATTAAGAGATGGTGCTGATTTTATTGCTGTAGATAAAGTGATGGAAAAAGCCTTTGGCTGGCCAATGGGTCCGGCTTATTTACTGGATGTTGTCGGTATCGATACAGCGAATCATGCTCAAGCAGTGATGGCTCAAGGTTTCCCAGACAGAATGGGCAGTATTGATAAAGACGTTATTGCGCTTTTATATCAACAACAACGCTATGGTCAGAAAAATAATCATGGGTTCTATGACTACACTATTGATAAGCGTGGTAAAAAACAAAAGCAGGTAGATAACGATATTCACAGCCTTATTGAACATCATGTCGGCAAAAAACAGGAATTTAACCAAGACACTATTATTGCTCGTATGATGATCCCAATGATCAATGAAGTTATTCGCTGCTTAGATGAAGGCATTATCGCCTCACCTGCAGAAGCCGATATTGCATTAGTGTATGGTTTAGGCTTCCCTCCTTTCCGTGGTGGTGTCTTCCGTTACCTCGATACCATTGGATTAGCACAATTTGTTGCAAATGCAGAGCAATACTCAGAGTTAGGGCCACTTTACCAAATTCCTGAGAGCTTAAAACAAAAAGCATTACGTAACGAAACCTACTATCCAAAGCCTGCAAAAGTAGATGTTAACATCAGAGAACTCGCTTAAGGAGAGAAGAAATGGAAAAGGTTGTCATAATTGATGGTGTTCGCACCCCA