Homologs in group_2212

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16915 FBDBKF_16915 76.5 Morganella morganii S1 tatC Sec-independent protein translocase subunit TatC
EHELCC_16675 EHELCC_16675 76.5 Morganella morganii S2 tatC Sec-independent protein translocase subunit TatC
NLDBIP_16885 NLDBIP_16885 76.5 Morganella morganii S4 tatC Sec-independent protein translocase subunit TatC
LHKJJB_16585 LHKJJB_16585 76.5 Morganella morganii S3 tatC Sec-independent protein translocase subunit TatC
HKOGLL_17550 HKOGLL_17550 76.5 Morganella morganii S5 tatC Sec-independent protein translocase subunit TatC
F4V73_RS18385 F4V73_RS18385 74.5 Morganella psychrotolerans tatC Sec-independent protein translocase subunit TatC

Distribution of the homologs in the orthogroup group_2212

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2212

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FBI6 2.13e-140 397 72 1 259 3 tatC Sec-independent protein translocase protein TatC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69423 5.46e-140 396 72 1 259 1 tatC Sec-independent protein translocase protein TatC Escherichia coli (strain K12)
P69424 5.46e-140 396 72 1 259 3 tatC Sec-independent protein translocase protein TatC Escherichia coli O157:H7
P44560 7.23e-114 330 60 0 253 3 tatC Sec-independent protein translocase protein TatC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54085 5.94e-102 300 57 1 252 3 tatC Sec-independent protein translocase protein TatC Azotobacter chroococcum mcd 1
D0KWI6 3.73e-66 213 54 0 227 3 tatC Sec-independent protein translocase protein TatC Halothiobacillus neapolitanus (strain ATCC 23641 / c2)
A0L833 1.16e-58 190 41 0 232 3 tatC Sec-independent protein translocase protein TatC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
C0QD59 1.05e-53 177 32 2 258 3 tatC Sec-independent protein translocase protein TatC Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q3A8D5 5.76e-51 170 39 1 245 3 tatC Sec-independent protein translocase protein TatC Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
O67305 3.09e-48 162 39 4 244 1 tatC Sec-independent protein translocase protein TatC Aquifex aeolicus (strain VF5)
Q9ZM59 1.55e-41 145 32 4 258 3 tatC Sec-independent protein translocase protein TatC Helicobacter pylori (strain J99 / ATCC 700824)
Q9PHT8 1.99e-39 140 33 3 244 3 tatC Sec-independent protein translocase protein TatC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
D5AT98 5.56e-39 140 30 3 246 3 tatC Sec-independent protein translocase protein TatC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O25701 1.7e-38 138 33 2 231 3 tatC Sec-independent protein translocase protein TatC Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZCG6 4.95e-38 136 35 4 232 3 tatC Sec-independent protein translocase protein TatC Rickettsia prowazekii (strain Madrid E)
Q9RW63 4.15e-36 132 32 4 251 3 tatC Sec-independent protein translocase protein TatC Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
O21266 2.3e-35 130 31 2 233 3 YMF16 Uncharacterized tatC-like protein ymf16 Reclinomonas americana
O05523 7.76e-35 128 28 5 259 1 tatC2 Sec-independent protein translocase protein TatCy Bacillus subtilis (strain 168)
Q1IN69 2.71e-34 127 30 5 252 3 tatC Sec-independent protein translocase protein TatC Koribacter versatilis (strain Ellin345)
P42252 6.27e-31 118 31 3 244 1 tatC1 Sec-independent protein translocase protein TatCd Bacillus subtilis (strain 168)
P54086 2.72e-30 116 32 3 228 3 tatC Sec-independent protein translocase protein TatC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WG97 7.17e-30 117 29 6 272 1 tatC Sec-independent protein translocase protein TatC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG96 7.17e-30 117 29 6 272 3 tatC Sec-independent protein translocase protein TatC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66896 7.17e-30 117 29 6 272 3 tatC Sec-independent protein translocase protein TatC Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9Z9P4 1.02e-29 115 29 6 251 3 tatC Sec-independent protein translocase protein TatC Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92ES8 1.43e-28 112 30 3 213 3 tatC Sec-independent protein translocase protein TatC Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P54078 6.26e-28 111 31 8 273 3 tatC Sec-independent protein translocase protein TatC Mycobacterium leprae (strain TN)
Q9SJV5 9.32e-28 112 35 2 222 1 TATC Sec-independent protein translocase protein TATC, chloroplastic Arabidopsis thaliana
Q3ADS0 1.15e-27 109 32 2 185 3 tatC Sec-independent protein translocase protein TatC Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2J9S4 1.52e-27 111 30 8 273 3 tatC Sec-independent protein translocase protein TatC Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
D2BJS8 1.7e-27 109 29 4 246 3 tatC Sec-independent protein translocase protein TatC Dehalococcoides mccartyi (strain VS)
B2UN92 8.63e-26 106 35 3 212 3 tatC Sec-independent protein translocase protein TatC Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q94G17 1.3e-25 106 34 2 219 1 TATC Sec-independent protein translocase protein TATC, chloroplastic Pisum sativum
Q9AVE6 1.37e-25 106 33 1 181 2 TATC Sec-independent protein translocase protein TATC, chloroplastic Oryza sativa subsp. japonica
D1BTU8 9.78e-24 99 30 4 246 3 tatC Sec-independent protein translocase protein TatC Xylanimonas cellulosilytica (strain DSM 15894 / JCM 12276 / CECT 5975 / KCTC 9989 / LMG 20990 / NBRC 107835 / XIL07)
C4IZX0 1.85e-23 100 33 1 165 2 TATC Sec-independent protein translocase protein TATC, chloroplastic Zea mays
Q6B8S9 1.41e-22 95 27 3 233 3 ycf43 Uncharacterized tatC-like protein ycf43 Gracilaria tenuistipitata var. liui
P51264 1.39e-20 90 30 5 233 3 ycf43 Uncharacterized tatC-like protein ycf43 Porphyra purpurea
Q9TLS5 2.06e-19 87 28 3 236 3 ycf43 Uncharacterized tatC-like protein ycf43 Cyanidium caldarium
Q9TC94 2.08e-19 87 26 2 236 3 YMF16 Uncharacterized tatC-like protein ymf16 Nephroselmis olivacea
D0J948 3.22e-19 87 26 7 266 3 tatC Sec-independent protein translocase protein TatC Blattabacterium sp. subsp. Periplaneta americana (strain BPLAN)
O78493 6.69e-19 87 25 1 207 3 ycf43 Uncharacterized tatC-like protein ycf43 Guillardia theta
Q1XDM3 9.17e-18 83 34 1 166 3 ycf43 Uncharacterized tatC-like protein ycf43 Neopyropia yezoensis
Q0W5V8 1.67e-17 82 28 2 228 3 tatC Sec-independent protein translocase protein TatC Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P49538 4.21e-15 76 29 5 228 3 ycf43 Uncharacterized tatC-like protein ycf43 Trieres chinensis
A0RW14 3.19e-14 73 25 5 261 3 tatC Sec-independent protein translocase protein TatC Cenarchaeum symbiosum (strain A)
C4LIK6 4.68e-13 71 29 2 183 3 tatC Sec-independent protein translocase protein TatC Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
D2NT99 2.89e-12 68 24 6 256 3 tatC Sec-independent protein translocase protein TatC Rothia mucilaginosa (strain DY-18)
P93312 3.76e-09 59 22 3 224 2 YMF16 Uncharacterized tatC-like protein ymf16 Arabidopsis thaliana
D4GZD0 5.99e-09 59 27 5 174 3 tatCo Sec-independent protein translocase protein TatCo Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
D4GZC9 1.17e-07 55 31 1 98 3 tatCt Sec-independent protein translocase protein TatCt Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P38459 2.54e-06 50 22 4 222 3 YMF16 Uncharacterized tatC-like protein ymf16 Marchantia polymorpha

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS17600
Feature type CDS
Gene tatC
Product Sec-independent protein translocase subunit TatC
Location 3862241 - 3863026 (strand: 1)
Length 786 (nucleotides) / 261 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2212
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00902 Sec-independent protein translocase protein (TatC)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0805 Intracellular trafficking, secretion, and vesicular transport (U) U Twin-arginine protein secretion pathway component TatC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03118 sec-independent protein translocase protein TatC Protein export
Bacterial secretion system
-

Protein Sequence

MAVNDTQPLISHLIELRKRLMYSLVSVLVVFLALVYFSNDIYQLISAPLLDKLPQGSNMSATDVASTFLTPIKLTIMVSVFASVPVILYQVWAFIAPALYKHERRLMLPLLVSSTVLFYLGMAFAYFVVFPLAFGFFVNTTPEGVNFIPDISKYLSFVMTLFMAFGAAFEVPIAIILLCWSGVTTPDALKKKRPYILVGAFVIGMVLTPPDVFSQTLLAIPMYLLFEIGVLVSRFYVNNGRRKTPEEEAEEAEAQATEQQK

Flanking regions ( +/- flanking 50bp)

TAACAGTAGAGAAGAAAACAACTGATCAGGCAAATGGTGAGCACTAAAACATGGCAGTAAATGATACCCAACCGCTGATCAGCCATTTAATAGAACTGCGTAAGCGTCTAATGTACAGCTTAGTTTCAGTTCTAGTGGTTTTTCTGGCTTTGGTTTATTTTTCTAACGATATCTATCAATTAATCTCGGCACCTTTACTTGATAAGTTGCCACAGGGGTCAAATATGAGTGCGACTGATGTTGCCTCAACTTTTTTGACACCGATTAAATTGACTATTATGGTATCCGTTTTTGCTTCTGTTCCTGTGATCCTTTATCAGGTATGGGCTTTTATCGCACCAGCACTGTATAAACATGAACGCCGCTTAATGTTACCGTTACTGGTTTCAAGTACCGTATTATTTTATCTCGGTATGGCGTTTGCGTATTTTGTTGTGTTTCCACTTGCATTTGGTTTCTTTGTGAATACTACCCCTGAAGGGGTTAACTTTATTCCAGATATCAGTAAGTATTTAAGTTTCGTAATGACGCTGTTTATGGCGTTTGGGGCCGCATTTGAAGTTCCTATTGCGATCATCTTGCTGTGTTGGAGTGGTGTCACAACACCTGATGCATTAAAGAAAAAACGTCCTTATATCTTAGTGGGTGCTTTTGTTATTGGCATGGTATTAACGCCACCTGATGTTTTTTCTCAAACATTATTAGCAATACCGATGTATTTATTGTTTGAGATTGGTGTCTTGGTGTCCCGTTTTTATGTCAATAATGGCAGAAGAAAAACACCAGAAGAAGAAGCTGAAGAGGCTGAGGCGCAAGCAACAGAACAGCAGAAATAATTTTAGGAAGTGAGTTTTCTAAAAACATAATTTATTAACCCAGCTAAGGC