Homologs in group_1422

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08460 FBDBKF_08460 85.2 Morganella morganii S1 hflX ribosome rescue GTPase HflX
EHELCC_13065 EHELCC_13065 85.2 Morganella morganii S2 hflX ribosome rescue GTPase HflX
NLDBIP_13405 NLDBIP_13405 85.2 Morganella morganii S4 hflX ribosome rescue GTPase HflX
LHKJJB_13150 LHKJJB_13150 85.2 Morganella morganii S3 hflX ribosome rescue GTPase HflX
HKOGLL_11880 HKOGLL_11880 85.2 Morganella morganii S5 hflX ribosome rescue GTPase HflX
F4V73_RS09680 F4V73_RS09680 83.8 Morganella psychrotolerans hflX ribosome rescue GTPase HflX

Distribution of the homologs in the orthogroup group_1422

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1422

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P25519 0.0 718 81 1 427 1 hflX GTPase HflX Escherichia coli (strain K12)
Q0I442 0.0 519 61 1 412 3 hflX GTPase HflX Histophilus somni (strain 129Pt)
A0L4B2 1.74e-88 278 48 5 362 3 hflX GTPase HflX Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A6H294 2.84e-85 269 44 2 308 3 hflX GTPase HflX Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8RAS5 1.1e-84 268 43 2 389 3 hflX GTPase HflX Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
E0RQS7 3.88e-81 258 39 5 409 3 hflX GTPase HflX Spirochaeta thermophila (strain ATCC 49972 / DSM 6192 / RI 19.B1)
D3FTV4 2.01e-79 254 45 3 347 3 hflX GTPase HflX Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
D9R4W7 1.61e-77 249 43 2 371 3 hflX GTPase HflX Lacrimispora saccharolytica (strain ATCC 35040 / DSM 2544 / NRCC 2533 / WM1)
P94478 1.82e-75 244 41 4 382 3 hflX GTPase HflX Bacillus subtilis (strain 168)
C1F407 2.39e-71 234 45 2 350 3 hflX GTPase HflX Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q9Z873 4.8e-71 234 40 4 360 1 hflX GTPase HflX Chlamydia pneumoniae
Q73J26 7.97e-69 226 38 5 353 3 hflX GTPase HflX Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q3AFV0 9.07e-67 221 39 2 368 3 hflX GTPase HflX Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B2UPE7 2.09e-65 218 42 3 336 3 hflX GTPase HflX Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q04PB3 7.94e-64 215 38 1 325 3 hflX GTPase HflX Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A9H253 1.86e-58 201 34 7 441 3 hflX GTPase HflX Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q5JGB4 2.75e-49 176 38 5 300 3 hflX GTPase HflX Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q58526 2.01e-42 157 31 12 403 3 hflX GTPase HflX Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A9A623 2.09e-41 153 32 9 353 3 hflX GTPase HflX Nitrosopumilus maritimus (strain SCM1)
O43824 3.49e-39 150 31 8 377 1 GTPBP6 Putative GTP-binding protein 6 Homo sapiens
Q0WTB4 6.27e-39 151 36 5 303 2 At3g49725 GTP-binding protein At3g49725, chloroplastic Arabidopsis thaliana
Q6DCC6 2.22e-38 148 33 6 321 2 gtpbp6 Putative GTP-binding protein 6 Xenopus laevis
A1RY30 5.96e-38 145 34 4 316 3 hflX GTPase HflX Thermofilum pendens (strain DSM 2475 / Hrk 5)
A2BLW4 3.28e-37 142 32 10 354 3 hflX GTPase HflX Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q980M3 5.88e-33 130 29 10 313 1 hflX GTPase HflX Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q3U6U5 8.1e-27 115 30 6 316 1 Gtpbp6 Putative GTP-binding protein 6 Mus musculus
O67849 2.2e-13 74 33 4 172 3 obg GTPase Obg Aquifex aeolicus (strain VF5)
Q6MEQ6 6.81e-13 72 32 4 175 3 obg GTPase Obg Protochlamydia amoebophila (strain UWE25)
Q5SHE9 2.67e-12 71 35 6 171 1 obg GTPase Obg Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B1LA53 4.47e-12 71 36 6 169 3 obg GTPase Obg Thermotoga sp. (strain RQ2)
Q72HR4 4.62e-12 70 35 6 171 3 obg GTPase Obg Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q022G3 6.27e-12 70 30 6 174 3 obg GTPase Obg Solibacter usitatus (strain Ellin6076)
Q9WXV3 7.06e-12 70 36 6 169 3 obg GTPase Obg Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5IKX2 1.03e-11 70 32 6 206 3 obg GTPase Obg Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B9L101 2.07e-11 69 34 11 210 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B8FUR9 4.05e-11 68 31 4 173 3 obg GTPase Obg Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C0QUB5 6.09e-11 67 30 5 178 3 obg GTPase Obg Persephonella marina (strain DSM 14350 / EX-H1)
Q8Y3H5 7.44e-11 67 31 6 197 3 mnmE tRNA modification GTPase MnmE Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q24SP0 1.01e-10 67 30 4 173 3 obg GTPase Obg Desulfitobacterium hafniense (strain Y51)
A0LCZ3 1.91e-10 65 25 6 210 3 obg GTPase Obg Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q2LR77 2.97e-10 65 30 5 177 3 obg GTPase Obg Syntrophus aciditrophicus (strain SB)
B8GQQ3 3.9e-10 64 33 7 182 3 obg GTPase Obg Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A9KMF5 4.93e-10 64 28 6 172 3 obg GTPase Obg Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A0Q1T4 7.26e-10 64 29 6 188 3 obg GTPase Obg Clostridium novyi (strain NT)
Q493U5 8.16e-10 63 32 3 132 3 obg GTPase Obg Blochmanniella pennsylvanica (strain BPEN)
Q58803 8.69e-10 63 32 5 159 3 MJ1408 Uncharacterized protein MJ1408 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B2V968 1e-09 63 27 4 206 3 obg GTPase Obg Sulfurihydrogenibium sp. (strain YO3AOP1)
B3EP74 1.03e-09 63 31 6 169 3 obg GTPase Obg Chlorobium phaeobacteroides (strain BS1)
Q1LH94 1.32e-09 63 29 8 205 3 mnmE tRNA modification GTPase MnmE Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A7NRU6 1.64e-09 63 30 7 198 3 obg GTPase Obg Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q2Y807 1.7e-09 62 32 7 197 3 obg GTPase Obg Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A5CX17 1.85e-09 62 37 7 154 3 obg GTPase Obg Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3AF51 1.93e-09 62 30 6 190 3 obg GTPase Obg Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B9K736 1.95e-09 62 33 5 162 3 obg GTPase Obg Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
A9BK05 2e-09 62 30 6 184 3 obg GTPase Obg Petrotoga mobilis (strain DSM 10674 / SJ95)
A5UDJ7 2.23e-09 62 25 9 260 3 obg GTPase Obg Haemophilus influenzae (strain PittEE)
Q5WSF0 2.24e-09 62 30 8 195 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Lens)
B3R898 2.28e-09 62 33 7 178 3 obg GTPase Obg Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A8F478 2.3e-09 62 26 7 235 3 obg GTPase Obg Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q3ZAJ2 2.79e-09 62 30 7 180 3 obg GTPase Obg Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B2A6B7 2.83e-09 62 26 6 200 3 obg GTPase Obg Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q7NZS1 3.01e-09 62 34 6 150 3 obg GTPase Obg Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A5UI23 3.16e-09 62 25 9 260 3 obg GTPase Obg Haemophilus influenzae (strain PittGG)
Q6MGS5 4e-09 61 29 3 144 3 obg GTPase Obg Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
A4J7I9 4.25e-09 61 25 6 189 3 obg GTPase Obg Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q89AE7 4.71e-09 61 29 2 127 3 obg GTPase Obg Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A5UZ80 4.85e-09 61 31 7 198 3 obg GTPase Obg Roseiflexus sp. (strain RS-1)
Q1LIQ0 5.06e-09 61 32 7 176 3 obg GTPase Obg Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0K6P6 5.39e-09 61 32 7 178 3 obg GTPase Obg Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5X0M3 5.99e-09 61 30 9 195 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Paris)
Q67SC6 7.37e-09 61 28 5 169 3 obg GTPase Obg Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q1IW72 7.85e-09 60 32 11 223 3 obg GTPase Obg Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q0AWJ4 8.21e-09 60 32 5 159 3 obg GTPase Obg Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3MHG6 8.53e-09 60 31 4 138 2 GTPBP10 GTP-binding protein 10 Bos taurus
B8FM68 8.53e-09 60 30 4 169 3 obg GTPase Obg Desulfatibacillum aliphaticivorans
B2UQ30 8.66e-09 60 31 6 180 3 obg GTPase Obg Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q6AK07 8.68e-09 60 29 7 187 3 obg GTPase Obg Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B8D7S4 9.24e-09 60 29 5 154 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57469 9.24e-09 60 29 5 154 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9H2 9.24e-09 60 29 5 154 3 obg GTPase Obg Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A3DBS5 1.13e-08 60 28 6 170 3 obg GTPase Obg Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A6LJZ0 1.16e-08 60 26 7 217 3 obg GTPase Obg Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q1DC95 1.3e-08 60 28 7 188 3 obg GTPase Obg Myxococcus xanthus (strain DK1622)
B6JD21 1.32e-08 60 31 5 173 3 obg GTPase Obg Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q3ZW89 1.38e-08 60 30 7 179 3 obg GTPase Obg Dehalococcoides mccartyi (strain CBDB1)
A5FP49 1.38e-08 60 30 7 179 3 obg GTPase Obg Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q4FP46 1.52e-08 59 35 4 137 3 obg GTPase Obg Pelagibacter ubique (strain HTCC1062)
Q1GZ53 1.57e-08 59 33 5 140 3 obg GTPase Obg Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q39QR4 1.61e-08 59 27 6 227 3 obg GTPase Obg Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B1I5V8 1.64e-08 60 30 5 166 3 obg GTPase Obg Desulforudis audaxviator (strain MP104C)
Q2G983 1.7e-08 59 32 7 188 3 obg GTPase Obg Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q82V20 2.1e-08 59 34 6 154 3 obg GTPase Obg Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AHG5 2.15e-08 59 31 4 154 3 obg GTPase Obg Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q47AD0 2.43e-08 59 30 8 210 3 obg GTPase Obg Dechloromonas aromatica (strain RCB)
Q1IVS5 2.5e-08 59 29 8 212 3 obg GTPase Obg Koribacter versatilis (strain Ellin345)
A2SD36 2.57e-08 59 30 7 197 3 obg GTPase Obg Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5IIK3 2.92e-08 59 29 8 195 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila (strain Corby)
Q9Z808 3.22e-08 58 30 7 185 3 obg GTPase Obg Chlamydia pneumoniae
Q8K013 3.49e-08 58 29 7 199 2 Gtpbp10 GTP-binding protein 10 Mus musculus
Q6AFY1 3.95e-08 58 30 9 217 3 obg GTPase Obg Leifsonia xyli subsp. xyli (strain CTCB07)
Q8XVL0 4.48e-08 58 32 7 178 3 obg GTPase Obg Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
C0QLE9 4.5e-08 58 28 4 174 3 obg GTPase Obg Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q3SKG2 4.94e-08 58 29 8 200 3 obg GTPase Obg Thiobacillus denitrificans (strain ATCC 25259)
Q5WTF1 5.02e-08 58 30 2 134 3 obg GTPase Obg Legionella pneumophila (strain Lens)
C1F9K2 5.15e-08 58 29 7 176 3 obg GTPase Obg Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q5X1P1 5.29e-08 58 30 2 130 3 obg GTPase Obg Legionella pneumophila (strain Paris)
A5D410 5.39e-08 58 30 5 172 3 obg GTPase Obg Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5LRY4 5.51e-08 58 33 3 130 3 obg GTPase Obg Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A4SVA3 5.62e-08 58 31 13 244 3 obg GTPase Obg Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q46X17 5.63e-08 58 31 7 176 3 obg GTPase Obg Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q747Q2 5.87e-08 57 28 9 237 3 obg GTPase Obg Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q5ZS70 5.9e-08 57 30 2 130 3 obg GTPase Obg Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q1MQQ1 5.92e-08 58 29 11 215 3 obg GTPase Obg Lawsonia intracellularis (strain PHE/MN1-00)
A1AT81 5.97e-08 57 27 6 192 3 obg GTPase Obg Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5IAS7 6.06e-08 57 30 2 130 3 obg GTPase Obg Legionella pneumophila (strain Corby)
A1KAD0 6.38e-08 58 30 7 193 3 obg GTPase Obg Azoarcus sp. (strain BH72)
B8I179 6.42e-08 58 26 5 178 3 obg GTPase Obg Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q9KDK0 6.51e-08 58 27 4 172 3 obg GTPase Obg Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B5Y805 7.49e-08 57 31 8 197 3 obg GTPase Obg Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q2RKZ8 7.83e-08 57 30 10 224 3 obg GTPase Obg Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2S3C0 8.15e-08 57 32 3 128 3 obg GTPase Obg Salinibacter ruber (strain DSM 13855 / M31)
Q8RBA5 8.58e-08 57 26 9 252 3 obg GTPase Obg Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B2FTD3 8.62e-08 57 33 5 134 3 obg GTPase Obg Stenotrophomonas maltophilia (strain K279a)
Q07U75 8.66e-08 57 31 6 171 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisA53)
B8IEL9 9.2e-08 57 32 7 170 3 obg GTPase Obg Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A7IH06 9.88e-08 57 31 6 164 3 obg GTPase Obg Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q5ZR82 9.91e-08 57 29 8 195 3 mnmE tRNA modification GTPase MnmE Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A1TTD3 9.95e-08 57 32 7 178 3 obg GTPase Obg Paracidovorax citrulli (strain AAC00-1)
B4SP14 1.02e-07 57 32 4 134 3 obg GTPase Obg Stenotrophomonas maltophilia (strain R551-3)
Q0VSE6 1.03e-07 57 34 7 172 3 obg GTPase Obg Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q5QZJ5 1.08e-07 57 29 9 195 3 mnmE tRNA modification GTPase MnmE Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B3QRD8 1.14e-07 57 32 6 167 3 obg GTPase Obg Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A4D1E9 1.14e-07 57 27 8 201 1 GTPBP10 GTP-binding protein 10 Homo sapiens
Q1QQU0 1.14e-07 57 30 7 172 3 obg GTPase Obg Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q0D3S3 1.15e-07 57 32 3 131 3 OBGC1 Probable GTP-binding protein OBGC1, chloroplastic Oryza sativa subsp. japonica
A2YPR8 1.15e-07 57 32 3 131 3 OBGC1 Probable GTP-binding protein OBGC1, chloroplastic Oryza sativa subsp. indica
A9NBL5 1.16e-07 57 30 3 130 3 obg GTPase Obg Coxiella burnetii (strain RSA 331 / Henzerling II)
Q0BRE9 1.18e-07 57 30 6 174 3 obg GTPase Obg Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q21YZ9 1.25e-07 57 33 10 180 3 obg GTPase Obg Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B6J9K2 1.27e-07 57 30 3 130 3 obg GTPase Obg Coxiella burnetii (strain CbuK_Q154)
Q83ED8 1.29e-07 56 30 3 130 3 obg GTPase Obg Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KEJ7 1.29e-07 56 30 3 130 3 obg GTPase Obg Coxiella burnetii (strain Dugway 5J108-111)
B6J1S8 1.29e-07 56 30 3 130 3 obg GTPase Obg Coxiella burnetii (strain CbuG_Q212)
B9MDZ7 1.3e-07 57 32 7 178 3 obg GTPase Obg Acidovorax ebreus (strain TPSY)
Q8RHS8 1.31e-07 57 25 4 155 3 obg GTPase Obg Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q0KFG6 1.32e-07 57 27 6 196 3 mnmE tRNA modification GTPase MnmE Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8EPQ0 1.44e-07 57 28 5 175 3 obg GTPase Obg Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9JXE5 1.52e-07 56 30 3 133 3 obg GTPase Obg Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1IPH6 1.52e-07 56 30 3 133 3 obg GTPase Obg Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RQP4 1.57e-07 56 30 3 133 3 obg GTPase Obg Neisseria gonorrhoeae (strain NCCP11945)
Q5F5D9 1.57e-07 56 30 3 133 1 obg GTPase Obg Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4QM31 1.72e-07 56 27 6 180 3 obg GTPase Obg Haemophilus influenzae (strain 86-028NP)
A1KWG2 1.75e-07 56 30 3 133 3 obg GTPase Obg Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B0TWK7 1.89e-07 56 31 6 179 3 obg GTPase Obg Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q3SVI2 2.04e-07 56 31 7 173 3 obg GTPase Obg Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B2SEA8 2.22e-07 56 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. mediasiatica (strain FSC147)
Q605N2 2.3e-07 56 36 5 136 3 obg GTPase Obg Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B1VGL9 2.3e-07 56 30 8 196 3 obg GTPase Obg Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
P44915 2.34e-07 56 27 6 180 3 obg GTPase Obg Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9AXD9 2.38e-07 56 30 6 158 3 obg GTPase Obg Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A8F2Y3 2.38e-07 55 25 7 206 3 obg GTPase Obg Rickettsia massiliae (strain Mtu5)
B7GNK1 2.38e-07 56 28 12 275 3 obg GTPase Obg Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
A5GD29 2.49e-07 55 27 3 173 3 obg GTPase Obg Geotalea uraniireducens (strain Rf4)
A1AW67 2.57e-07 55 33 5 143 3 obg GTPase Obg Ruthia magnifica subsp. Calyptogena magnifica
C0R5N5 2.58e-07 55 33 4 130 3 obg GTPase Obg Wolbachia sp. subsp. Drosophila simulans (strain wRi)
B1YSU7 2.66e-07 55 31 7 179 3 obg GTPase Obg Burkholderia ambifaria (strain MC40-6)
A4IVW3 2.73e-07 55 35 4 130 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain WY96-3418)
Q89ZI9 2.74e-07 55 28 4 175 3 obg GTPase Obg Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A0Q8K2 2.75e-07 55 35 4 130 3 obg GTPase Obg Francisella tularensis subsp. novicida (strain U112)
B4SBR3 2.76e-07 55 32 9 179 3 obg GTPase Obg Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1W4B0 2.88e-07 55 30 7 181 3 obg GTPase Obg Acidovorax sp. (strain JS42)
Q6D9C3 3.01e-07 55 31 3 129 3 obg GTPase Obg Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0BIH8 3.04e-07 55 31 7 179 3 obg GTPase Obg Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q5NEB0 3.12e-07 55 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FR3 3.12e-07 55 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. tularensis (strain FSC 198)
Q3J6S0 3.12e-07 55 30 7 180 3 obg GTPase Obg Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1ZL15 3.14e-07 55 29 6 189 3 obg GTPase Obg Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1Y280 3.28e-07 55 34 6 134 3 obg GTPase Obg Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A8MHK8 3.34e-07 55 25 6 208 3 obg GTPase Obg Alkaliphilus oremlandii (strain OhILAs)
Q3A1D8 3.37e-07 55 30 5 162 3 obg GTPase Obg Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8G4U0 3.42e-07 56 28 11 271 3 obg GTPase Obg Bifidobacterium longum (strain NCC 2705)
Q6DHF7 3.52e-07 55 26 7 199 2 gtpbp10 GTP-binding protein 10 Danio rerio
A9AI60 3.62e-07 55 31 7 179 3 obg GTPase Obg Burkholderia multivorans (strain ATCC 17616 / 249)
B5ZBV6 3.71e-07 55 28 7 205 3 obg GTPase Obg Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
A6LQR9 3.84e-07 55 27 6 196 3 obg GTPase Obg Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6VMU1 3.87e-07 55 27 7 205 3 obg GTPase Obg Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q64XA5 3.88e-07 55 28 5 188 3 obg GTPase Obg Bacteroides fragilis (strain YCH46)
Q5LGG9 3.9e-07 55 28 5 188 3 obg GTPase Obg Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q7MYX6 4.08e-07 55 31 3 129 3 obg GTPase Obg Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1R0C0 4.08e-07 55 32 6 170 3 obg GTPase Obg Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B2KAW2 4.09e-07 55 27 9 228 3 obg GTPase Obg Elusimicrobium minutum (strain Pei191)
A0LPF9 4.21e-07 55 30 5 175 3 obg GTPase Obg Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8KAF0 4.41e-07 55 28 6 183 3 obg GTPase Obg Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q46VM0 4.43e-07 55 28 7 197 3 mnmE tRNA modification GTPase MnmE Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2GK25 4.47e-07 55 28 6 182 3 obg GTPase Obg Anaplasma phagocytophilum (strain HZ)
Q65GM7 4.49e-07 55 26 4 170 3 obg GTPase Obg Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q9PQ29 4.51e-07 55 28 5 175 3 obg GTPase Obg Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJA2 4.51e-07 55 28 5 175 3 obg GTPase Obg Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
B2IQ29 4.56e-07 55 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae (strain CGSP14)
A7Z781 4.69e-07 55 27 4 159 3 obg GTPase Obg Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9RY66 4.7e-07 55 31 11 228 3 obg GTPase Obg Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q5M8V6 5.02e-07 55 37 2 93 2 gtpbp10 GTP-binding protein 10 Xenopus tropicalis
A6T2D5 5.08e-07 55 27 7 205 3 obg GTPase Obg Janthinobacterium sp. (strain Marseille)
A9M061 5.22e-07 55 30 3 133 3 obg GTPase Obg Neisseria meningitidis serogroup C (strain 053442)
Q2L062 5.32e-07 55 31 8 198 3 obg GTPase Obg Bordetella avium (strain 197N)
Q97QW8 5.32e-07 55 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1IBL9 5.32e-07 55 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae (strain Hungary19A-6)
B5E4J4 5.32e-07 55 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae serotype 19F (strain G54)
Q5FUL2 5.59e-07 54 29 4 174 3 obg GTPase Obg Gluconobacter oxydans (strain 621H)
Q1BZE0 5.62e-07 55 31 7 179 3 obg GTPase Obg Burkholderia orbicola (strain AU 1054)
B4E5X0 5.62e-07 55 31 7 179 3 obg GTPase Obg Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1JVA1 5.67e-07 55 31 7 179 3 obg GTPase Obg Burkholderia orbicola (strain MC0-3)
A0K4B0 5.67e-07 55 31 7 179 3 obg GTPase Obg Burkholderia cenocepacia (strain HI2424)
B2GGD9 5.74e-07 55 29 10 236 3 obg GTPase Obg Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q5U528 5.79e-07 55 30 6 185 2 gtpbp10 GTP-binding protein 10 Xenopus laevis
B3E609 5.89e-07 54 28 5 171 3 obg GTPase Obg Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B7GIR2 5.95e-07 55 27 7 206 3 obg GTPase Obg Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1IF13 6e-07 55 28 6 210 3 obg GTPase Obg Pseudomonas entomophila (strain L48)
B2UCV3 6.08e-07 54 31 8 199 3 obg GTPase Obg Ralstonia pickettii (strain 12J)
Q89X89 6.13e-07 54 30 6 171 3 obg GTPase Obg Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B5YJ65 6.36e-07 54 26 4 171 3 obg GTPase Obg Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q73HQ3 6.79e-07 54 33 4 130 3 obg GTPase Obg Wolbachia pipientis wMel
A1SMB4 7.14e-07 55 29 11 264 3 obg GTPase Obg Nocardioides sp. (strain ATCC BAA-499 / JS614)
A7HT67 7.19e-07 54 27 6 188 3 obg GTPase Obg Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A8M0Y9 7.51e-07 55 31 7 182 3 obg GTPase Obg Salinispora arenicola (strain CNS-205)
Q18B27 7.64e-07 54 26 5 183 3 obg GTPase Obg Clostridioides difficile (strain 630)
A9BDI4 7.9e-07 54 29 5 168 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9211)
Q8PBH0 8.06e-07 54 33 5 134 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RY32 8.06e-07 54 33 5 134 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain B100)
Q4US36 8.06e-07 54 33 5 134 3 obg GTPase Obg Xanthomonas campestris pv. campestris (strain 8004)
A5EVP4 8.08e-07 54 29 6 182 3 obg GTPase Obg Dichelobacter nodosus (strain VCS1703A)
B0TBW1 8.71e-07 54 25 8 209 3 obg GTPase Obg Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q0SR54 8.78e-07 54 26 6 190 3 obg GTPase Obg Clostridium perfringens (strain SM101 / Type A)
Q8XIJ2 8.78e-07 54 26 6 190 3 obg GTPase Obg Clostridium perfringens (strain 13 / Type A)
Q0TNI5 8.78e-07 54 26 6 190 3 obg GTPase Obg Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A4G8R4 8.82e-07 54 26 7 205 3 obg GTPase Obg Herminiimonas arsenicoxydans
Q5WHD9 8.88e-07 53 26 6 168 3 era GTPase Era Shouchella clausii (strain KSM-K16)
Q04EZ8 8.92e-07 54 28 6 164 3 obg GTPase Obg Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q65S59 9.28e-07 54 28 5 174 3 obg GTPase Obg Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q2J3J8 9.4e-07 54 31 6 170 3 obg GTPase Obg Rhodopseudomonas palustris (strain HaA2)
A8GTZ9 9.93e-07 53 26 8 207 3 obg GTPase Obg Rickettsia rickettsii (strain Sheila Smith)
B0BVJ1 9.93e-07 53 26 8 207 3 obg GTPase Obg Rickettsia rickettsii (strain Iowa)
Q8K9G1 1.04e-06 53 28 5 152 3 obg GTPase Obg Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B3Q731 1.07e-06 53 30 6 171 3 obg GTPase Obg Rhodopseudomonas palustris (strain TIE-1)
A8L1V6 1.09e-06 54 28 4 177 3 obg GTPase Obg Parafrankia sp. (strain EAN1pec)
A4JBB8 1.11e-06 53 30 7 179 3 obg GTPase Obg Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1JMI3 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66F73 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRJ6 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pestis (strain Pestoides F)
Q1CEK0 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Nepal516)
A9R591 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Angola)
Q7CKJ6 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pestis
B2K2P2 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBZ4 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMT5 1.12e-06 54 27 5 166 3 obg GTPase Obg Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A0LSX1 1.14e-06 54 30 5 155 3 obg GTPase Obg Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B2TK70 1.14e-06 54 30 3 132 3 obg GTPase Obg Clostridium botulinum (strain Eklund 17B / Type B)
Q39JU7 1.15e-06 53 30 8 182 3 obg GTPase Obg Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B8ZPS8 1.2e-06 54 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B3DPS4 1.22e-06 54 27 11 271 3 obg GTPase Obg Bifidobacterium longum (strain DJO10A)
Q88Q08 1.22e-06 53 30 8 212 3 obg GTPase Obg Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYC6 1.22e-06 53 30 8 212 3 obg GTPase Obg Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5H2E5 1.25e-06 53 33 5 134 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2STC0 1.25e-06 53 33 5 134 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P5B4 1.25e-06 53 33 5 134 3 obg GTPase Obg Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P20964 1.25e-06 53 28 5 162 1 obg GTPase Obg Bacillus subtilis (strain 168)
Q87BL2 1.31e-06 53 27 4 158 3 obg GTPase Obg Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6V6 1.31e-06 53 27 4 158 3 obg GTPase Obg Xylella fastidiosa (strain M23)
Q9PAS3 1.33e-06 53 27 4 158 3 obg GTPase Obg Xylella fastidiosa (strain 9a5c)
B0K414 1.38e-06 53 27 9 216 3 obg GTPase Obg Thermoanaerobacter sp. (strain X514)
B0KAB8 1.38e-06 53 27 9 216 3 obg GTPase Obg Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B5E958 1.38e-06 53 31 8 181 3 obg GTPase Obg Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q97JL4 1.43e-06 53 26 5 186 3 obg GTPase Obg Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6TQJ6 1.46e-06 53 29 2 131 3 obg GTPase Obg Alkaliphilus metalliredigens (strain QYMF)
C6E2H7 1.49e-06 53 30 4 160 3 era GTPase Era Geobacter sp. (strain M21)
Q8L7L0 1.5e-06 54 31 3 133 2 OBGL GTP-binding protein OBGC, chloroplastic Arabidopsis thaliana
A4XAG1 1.5e-06 53 31 7 176 3 obg GTPase Obg Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B2V0A8 1.5e-06 53 31 3 132 3 obg GTPase Obg Clostridium botulinum (strain Alaska E43 / Type E3)
B9M3W3 1.51e-06 53 28 6 177 3 obg GTPase Obg Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q5L6R9 1.52e-06 53 31 7 180 3 obg GTPase Obg Chlamydia abortus (strain DSM 27085 / S26/3)
B5XSV8 1.55e-06 53 23 5 203 3 obg GTPase Obg Klebsiella pneumoniae (strain 342)
Q824F3 1.61e-06 53 31 7 180 3 obg GTPase Obg Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A1VK90 1.69e-06 53 30 10 206 3 obg GTPase Obg Polaromonas naphthalenivorans (strain CJ2)
Q2JJ90 1.72e-06 53 31 3 131 3 obg GTPase Obg Synechococcus sp. (strain JA-2-3B'a(2-13))
A8HS51 1.74e-06 53 30 6 171 3 obg GTPase Obg Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8DPV8 1.77e-06 53 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KK7 1.77e-06 53 26 6 199 3 obg GTPase Obg Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A7HIF8 1.85e-06 53 30 6 176 3 obg GTPase Obg Anaeromyxobacter sp. (strain Fw109-5)
Q1GHD0 1.85e-06 53 30 3 130 3 obg GTPase Obg Ruegeria sp. (strain TM1040)
Q6NDE6 1.87e-06 53 30 6 171 3 obg GTPase Obg Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q31DJ0 1.9e-06 53 27 8 224 3 mnmE tRNA modification GTPase MnmE Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q3K6K9 1.91e-06 53 32 9 201 3 obg GTPase Obg Pseudomonas fluorescens (strain Pf0-1)
Q8DGG4 1.95e-06 53 28 6 180 3 obg GTPase Obg Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6A9H8 2e-06 53 31 6 172 3 obg GTPase Obg Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5P7Z4 2.04e-06 53 28 9 217 3 obg GTPase Obg Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q253F8 2.06e-06 53 29 7 186 3 obg GTPase Obg Chlamydia felis (strain Fe/C-56)
B2VGT5 2.09e-06 53 27 2 130 3 obg GTPase Obg Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2YT86 2.11e-06 53 27 4 159 3 obg GTPase Obg Staphylococcus aureus (strain bovine RF122 / ET3-1)
B0KMF6 2.13e-06 53 30 8 212 3 obg GTPase Obg Pseudomonas putida (strain GB-1)
Q6GG60 2.13e-06 53 27 4 159 3 obg GTPase Obg Staphylococcus aureus (strain MRSA252)
B1JF57 2.15e-06 53 28 6 210 3 obg GTPase Obg Pseudomonas putida (strain W619)
Q12F99 2.15e-06 53 31 11 204 3 obg GTPase Obg Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q6F9D8 2.17e-06 53 28 3 132 3 obg GTPase Obg Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1GXL7 2.17e-06 53 28 7 194 3 mnmE tRNA modification GTPase MnmE Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q7VDW9 2.18e-06 52 28 5 169 3 obg GTPase Obg Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A5E965 2.2e-06 53 28 5 173 3 obg GTPase Obg Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A6U7A9 2.31e-06 52 28 7 192 3 era GTPase Era Sinorhizobium medicae (strain WSM419)
Q92G19 2.33e-06 52 26 8 207 3 obg GTPase Obg Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A1TYY4 2.35e-06 53 31 6 171 3 obg GTPase Obg Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5RDW1 2.36e-06 53 32 6 171 2 MTG2 Mitochondrial ribosome-associated GTPase 2 Pongo abelii
A0AIY6 2.36e-06 53 28 6 173 3 obg GTPase Obg Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92BH7 2.58e-06 53 28 6 173 3 obg GTPase Obg Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9CNS4 2.59e-06 53 27 6 184 3 obg GTPase Obg Pasteurella multocida (strain Pm70)
Q13U15 2.66e-06 52 33 5 133 3 obg GTPase Obg Paraburkholderia xenovorans (strain LB400)
Q2IH84 2.75e-06 52 29 6 177 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-C)
Q88VG4 2.78e-06 53 28 9 207 3 obg GTPase Obg Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A4YKF3 2.82e-06 52 29 5 161 3 obg GTPase Obg Bradyrhizobium sp. (strain ORS 278)
Q0BK24 2.83e-06 52 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1B4 2.83e-06 52 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain LVS)
A7NEQ3 2.83e-06 52 31 6 179 3 obg GTPase Obg Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A3NDS7 2.83e-06 52 31 7 178 3 obg GTPase Obg Burkholderia pseudomallei (strain 668)
Q0BZ39 2.89e-06 52 27 4 185 3 obg GTPase Obg Hyphomonas neptunium (strain ATCC 15444)
Q13DL7 2.94e-06 52 30 6 172 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB5)
Q5GTG3 3.19e-06 52 30 4 130 3 obg GTPase Obg Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q2SZG0 3.26e-06 52 30 7 179 3 obg GTPase Obg Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1XT35 3.36e-06 52 29 13 244 3 obg GTPase Obg Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q1AVU3 3.39e-06 52 33 7 156 3 obg GTPase Obg Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q8Y6Z3 3.48e-06 52 28 6 173 3 obg GTPase Obg Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZD3 3.48e-06 52 28 6 173 3 obg GTPase Obg Listeria monocytogenes serotype 4b (strain F2365)
B5YEQ1 3.49e-06 52 28 9 217 3 obg GTPase Obg Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B8JBP2 3.56e-06 52 29 6 177 3 obg GTPase Obg Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q63QM0 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia pseudomallei (strain K96243)
Q3JNG0 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia pseudomallei (strain 1710b)
A3NZJ0 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia pseudomallei (strain 1106a)
A1V0P1 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia mallei (strain SAVP1)
Q62GV4 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia mallei (strain ATCC 23344)
A2S5R8 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10229)
A3MR90 3.59e-06 52 31 7 178 3 obg GTPase Obg Burkholderia mallei (strain NCTC 10247)
B8DHL1 3.61e-06 52 28 6 173 3 obg GTPase Obg Listeria monocytogenes serotype 4a (strain HCC23)
A1R787 3.76e-06 52 30 7 188 3 obg GTPase Obg Paenarthrobacter aurescens (strain TC1)
C0ZAL7 3.84e-06 52 31 9 179 3 obg GTPase Obg Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A8FFS8 3.94e-06 52 28 2 127 3 obg GTPase Obg Bacillus pumilus (strain SAFR-032)
B3PIU9 3.97e-06 52 31 4 132 3 obg GTPase Obg Cellvibrio japonicus (strain Ueda107)
B4UIU2 4.1e-06 52 29 6 177 3 obg GTPase Obg Anaeromyxobacter sp. (strain K)
Q0AAD6 4.12e-06 52 31 8 209 3 obg GTPase Obg Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5HFB9 4.16e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q15PF0 4.22e-06 52 28 3 130 3 obg GTPase Obg Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q4UJV1 4.24e-06 52 29 5 163 3 obg GTPase Obg Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1H0I4 4.3e-06 52 30 7 177 3 obg GTPase Obg Endomicrobium trichonymphae
A9IFF9 4.32e-06 52 28 7 198 3 obg GTPase Obg Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q892N8 4.55e-06 52 27 6 196 3 obg GTPase Obg Clostridium tetani (strain Massachusetts / E88)
B0U3R3 4.61e-06 52 27 4 161 3 obg GTPase Obg Xylella fastidiosa (strain M12)
A8F063 4.67e-06 52 24 7 206 3 obg GTPase Obg Rickettsia canadensis (strain McKiel)
B2SYV2 4.78e-06 52 30 7 179 3 obg GTPase Obg Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q4ZYK1 5.05e-06 52 32 8 185 3 obg GTPase Obg Pseudomonas syringae pv. syringae (strain B728a)
Q48NL2 5.05e-06 52 32 8 185 3 obg GTPase Obg Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7A0Q3 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 5.14e-06 52 26 6 198 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 5.14e-06 52 26 6 198 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)
B0BC53 5.54e-06 51 28 6 180 3 obg GTPase Obg Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7Y8 5.54e-06 51 28 6 180 3 obg GTPase Obg Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q6LV46 5.7e-06 52 26 2 130 3 obg GTPase Obg Photobacterium profundum (strain SS9)
Q9KD52 5.77e-06 51 26 5 169 3 era GTPase Era Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5CR32 5.78e-06 52 31 4 138 3 obg GTPase Obg Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A5FMX0 6.07e-06 51 31 1 126 3 obg GTPase Obg Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B9DNE7 6.08e-06 52 25 4 177 3 obg GTPase Obg Staphylococcus carnosus (strain TM300)
Q054P6 6.22e-06 51 28 4 165 3 obg GTPase Obg Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04Q90 6.22e-06 51 28 4 165 3 obg GTPase Obg Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A9BP68 6.38e-06 51 30 7 178 3 obg GTPase Obg Delftia acidovorans (strain DSM 14801 / SPH-1)
B7J2L5 6.54e-06 51 32 4 124 3 era GTPase Era Borreliella burgdorferi (strain ZS7)
O51604 6.54e-06 51 32 4 124 3 era GTPase Era Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q5WHS8 6.8e-06 51 25 4 173 3 obg GTPase Obg Shouchella clausii (strain KSM-K16)
B1KZR3 6.99e-06 51 24 4 174 3 obg GTPase Obg Clostridium botulinum (strain Loch Maree / Type A3)
Q83Q14 7.05e-06 51 27 2 129 3 obg GTPase Obg Shigella flexneri
Q0T0A1 7.05e-06 51 27 2 129 3 obg GTPase Obg Shigella flexneri serotype 5b (strain 8401)
Q31W60 7.05e-06 51 27 2 129 3 obg GTPase Obg Shigella boydii serotype 4 (strain Sb227)
B2U1Z4 7.05e-06 51 27 2 129 3 obg GTPase Obg Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LR50 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LFT3 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain SMS-3-5 / SECEC)
B6I1Q6 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain SE11)
B7NDG7 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IQU0 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FD82 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCS7 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG86 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O1:K1 / APEC
A8A4Z8 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O9:H4 (strain HS)
B7M089 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O8 (strain IAI1)
B7N0W5 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O81 (strain ED1a)
B5YS72 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9K7 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O157:H7
B7LHP6 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain 55989 / EAEC)
B7MBV2 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJ76 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZS79 7.05e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O139:H28 (strain E24377A / ETEC)
Q165Y6 7.09e-06 51 29 5 184 3 obg GTPase Obg Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B9LC30 7.11e-06 51 33 8 168 3 obg GTPase Obg Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WK62 7.11e-06 51 33 8 168 3 obg GTPase Obg Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
P42641 7.12e-06 51 27 2 129 1 obgE GTPase ObgE/CgtA Escherichia coli (strain K12)
B1XHF9 7.12e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain K12 / DH10B)
Q13SH7 7.14e-06 51 30 8 205 3 mnmE tRNA modification GTPase MnmE Paraburkholderia xenovorans (strain LB400)
Q1R6F4 7.17e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli (strain UTI89 / UPEC)
Q3YX58 7.18e-06 51 27 2 129 3 obg GTPase Obg Shigella sonnei (strain Ss046)
B7NKQ0 7.31e-06 51 27 2 129 3 obg GTPase Obg Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B2JHD7 7.33e-06 51 30 8 186 3 obg GTPase Obg Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q8PN23 7.34e-06 51 30 4 139 3 obg GTPase Obg Xanthomonas axonopodis pv. citri (strain 306)
Q32BF0 7.37e-06 51 27 2 129 3 obg GTPase Obg Shigella dysenteriae serotype 1 (strain Sd197)
Q2JS78 7.42e-06 51 32 4 134 3 obg GTPase Obg Synechococcus sp. (strain JA-3-3Ab)
Q3YRX8 7.51e-06 51 32 6 134 3 obg GTPase Obg Ehrlichia canis (strain Jake)
B0RDG3 7.97e-06 51 30 4 138 3 obg GTPase Obg Clavibacter sepedonicus
Q7MW55 8.13e-06 51 28 4 192 3 obg GTPase Obg Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RIY7 8.13e-06 51 28 4 192 3 obg GTPase Obg Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q3BW46 8.39e-06 51 30 4 139 3 obg GTPase Obg Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A5I666 8.56e-06 51 24 4 174 3 obg GTPase Obg Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXU6 8.56e-06 51 24 4 174 3 obg GTPase Obg Clostridium botulinum (strain ATCC 19397 / Type A)
A9H0F1 8.56e-06 51 26 5 190 3 obg GTPase Obg Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B4F2A8 8.7e-06 51 26 3 157 3 obg GTPase Obg Proteus mirabilis (strain HI4320)
B1ILY5 8.71e-06 51 24 4 174 3 obg GTPase Obg Clostridium botulinum (strain Okra / Type B1)
Q0SM73 9.65e-06 50 31 5 132 3 obg GTPase Obg Borreliella afzelii (strain PKo)
Q04A20 9.75e-06 50 27 8 184 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9W6 9.75e-06 50 27 8 184 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A6TEK2 9.83e-06 51 26 2 129 3 obg GTPase Obg Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q11CP6 9.84e-06 50 32 5 134 3 obg GTPase Obg Chelativorans sp. (strain BNC1)
A8AQ74 1e-05 51 27 2 129 3 obg GTPase Obg Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q21D04 1.06e-05 50 31 6 173 3 obg GTPase Obg Rhodopseudomonas palustris (strain BisB18)
A5FV29 1.06e-05 50 30 2 128 3 obg GTPase Obg Acidiphilium cryptum (strain JF-5)
B2IE44 1.1e-05 50 28 5 160 3 obg GTPase Obg Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A7HJZ8 1.1e-05 51 29 6 170 3 obg GTPase Obg Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B8HU67 1.11e-05 50 31 4 134 3 obg GTPase Obg Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A4WEZ6 1.11e-05 50 26 2 129 3 obg GTPase Obg Enterobacter sp. (strain 638)
A2BUJ6 1.13e-05 50 27 6 176 3 obg GTPase Obg Prochlorococcus marinus (strain MIT 9515)
Q1GSF4 1.14e-05 50 32 4 128 3 obg GTPase Obg Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2K2X6 1.18e-05 50 27 6 194 3 obg GTPase Obg Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B2IYX1 1.2e-05 50 31 4 131 3 obg GTPase Obg Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A9NF57 1.25e-05 50 30 11 228 3 obg GTPase Obg Acholeplasma laidlawii (strain PG-8A)
C1DEA4 1.28e-05 50 33 4 133 3 obg GTPase Obg Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0CDA2 1.37e-05 50 29 2 126 3 obg GTPase Obg Acaryochloris marina (strain MBIC 11017)
A1JIV6 1.41e-05 50 30 3 128 3 obg GTPase Obg Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B0UVI2 1.42e-05 50 30 3 130 3 obg GTPase Obg Histophilus somni (strain 2336)
Q8F7U0 1.43e-05 50 29 4 150 3 obg GTPase Obg Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NQ7 1.43e-05 50 29 4 150 3 obg GTPase Obg Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q38WT4 1.44e-05 50 29 2 127 3 obg GTPase Obg Latilactobacillus sakei subsp. sakei (strain 23K)
B3PRZ3 1.46e-05 50 27 6 194 3 obg GTPase Obg Rhizobium etli (strain CIAT 652)
Q9H4K7 1.47e-05 50 31 7 174 1 MTG2 Mitochondrial ribosome-associated GTPase 2 Homo sapiens
A8G8Z4 1.47e-05 50 28 6 178 3 obg GTPase Obg Serratia proteamaculans (strain 568)
B3DVG9 1.48e-05 50 29 5 146 3 obg GTPase Obg Methylacidiphilum infernorum (isolate V4)
A7I166 1.51e-05 50 29 3 131 3 obg GTPase Obg Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2JDP2 1.53e-05 50 28 3 150 3 obg GTPase Obg Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q03QP2 1.54e-05 50 26 5 178 3 obg GTPase Obg Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q3APF4 1.59e-05 50 29 6 162 3 obg GTPase Obg Chlorobium chlorochromatii (strain CaD3)
B8CXZ0 1.65e-05 50 26 2 130 3 obg GTPase Obg Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q7VZX6 1.66e-05 50 29 5 154 3 obg GTPase Obg Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1P2 1.66e-05 50 29 5 154 3 obg GTPase Obg Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQL8 1.66e-05 50 29 5 154 3 obg GTPase Obg Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B3QZT1 1.66e-05 50 27 6 145 3 obg GTPase Obg Phytoplasma mali (strain AT)
Q660L0 1.69e-05 50 31 4 124 3 era GTPase Era Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A7MJF1 1.75e-05 50 30 3 128 3 obg GTPase Obg Cronobacter sakazakii (strain ATCC BAA-894)
Q3SF39 1.76e-05 50 28 10 242 3 mnmE tRNA modification GTPase MnmE Thiobacillus denitrificans (strain ATCC 25259)
B7J0M7 1.8e-05 50 32 6 131 3 obg GTPase Obg Borreliella burgdorferi (strain ZS7)
O51722 1.8e-05 50 32 6 131 3 obg GTPase Obg Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A8F6R1 1.82e-05 50 28 4 163 3 era GTPase Era Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B0VCR5 1.83e-05 50 28 3 128 3 obg GTPase Obg Acinetobacter baumannii (strain AYE)
A3M7M2 1.83e-05 50 28 3 128 3 obg GTPase Obg Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HWM9 1.83e-05 50 28 3 128 3 obg GTPase Obg Acinetobacter baumannii (strain ACICU)
B7I557 1.83e-05 50 28 3 128 3 obg GTPase Obg Acinetobacter baumannii (strain AB0057)
B7GYV1 1.83e-05 50 28 3 128 3 obg GTPase Obg Acinetobacter baumannii (strain AB307-0294)
B2S1C3 1.83e-05 50 29 5 138 3 obg GTPase Obg Borrelia hermsii (strain HS1 / DAH)
P95758 1.91e-05 50 27 8 217 1 obg GTPase Obg Streptomyces griseus
B1VXD8 1.91e-05 50 27 8 217 3 obg GTPase Obg Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q29K06 1.92e-05 50 28 5 153 3 GA10450 GTP-binding protein 10 homolog Drosophila pseudoobscura pseudoobscura
A4W0M2 1.97e-05 50 28 6 178 3 obg GTPase Obg Streptococcus suis (strain 98HAH33)
Q1RGV9 1.97e-05 50 31 4 129 3 obg GTPase Obg Rickettsia bellii (strain RML369-C)
A8GUG0 1.97e-05 50 31 4 129 3 obg GTPase Obg Rickettsia bellii (strain OSU 85-389)
A9VYM4 2.01e-05 50 28 6 175 3 obg GTPase Obg Methylorubrum extorquens (strain PA1)
B7KSH0 2.01e-05 50 28 6 175 3 obg GTPase Obg Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B4RD64 2.06e-05 50 29 3 135 3 obg GTPase Obg Phenylobacterium zucineum (strain HLK1)
Q8Z3H1 2.07e-05 50 26 2 129 3 obg GTPase Obg Salmonella typhi
B5REP9 2.09e-05 50 26 2 129 3 obg GTPase Obg Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q0RPF6 2.11e-05 50 29 4 173 3 obg GTPase Obg Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A9MP23 2.12e-05 50 26 2 129 3 obg GTPase Obg Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B6YRA6 2.13e-05 50 27 5 188 3 obg GTPase Obg Azobacteroides pseudotrichonymphae genomovar. CFP2
Q8ZLS5 2.13e-05 50 26 2 129 1 obg GTPase Obg Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TWF3 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella schwarzengrund (strain CVM19633)
B5BGK7 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella paratyphi A (strain AKU_12601)
C0PZJ5 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella paratyphi C (strain RKS4594)
A9N750 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PLB7 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T714 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella newport (strain SL254)
B4TJ21 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella heidelberg (strain SL476)
B5R0H4 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella enteritidis PT4 (strain P125109)
B5FIN3 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella dublin (strain CT_02021853)
Q57JG7 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella choleraesuis (strain SC-B67)
B5F6V2 2.13e-05 50 26 2 129 3 obg GTPase Obg Salmonella agona (strain SL483)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16755
Feature type CDS
Gene hflX
Product GTPase HflX
Location 3693000 - 3694283 (strand: 1)
Length 1284 (nucleotides) / 427 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1422
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01926 50S ribosome-binding GTPase
PF13167 GTP-binding GTPase N-terminal
PF16360 GTP-binding GTPase Middle Region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2262 Translation, ribosomal structure and biogenesis (J) J 50S ribosomal subunit-associated GTPase HflX

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03665 GTPase - -

Protein Sequence

MFDRYEGGELAVLVHVFFSQEKDIDDLQEFESLVTSAGVKPVQIITGSRRAPHSKYYVGEGKAEEIAEAVKASGADVVLFNHALSPAQERNLERLCECRVVDRTGVILDIFAQRARTHEGKLQVELAQLRHLSTRLVRGWTHLERQKGGIGLRGPGETQLETDRRLLRGKISQILMRLGKVERQREQGRQARSKADIPTLSLVGYTNAGKSSLFNRITCADVYAADQLFATLDPTLRRIQVDDVGTVVLADTVGFIRHLPHDLVAAFKATLQETREATLLLHVIDAADSRFEENIHAVENVLEEIDAHEIPTLYVMNKIDLLEDFTPRIDRNEDNLPVRVWVSAQTGEGIPLLYQALTERLSGEIAHVELRLPPEEAGRLRSRFYQLQAIEREWIEKDGKVGLITRMPMVDWHRLCKQEPTLLDYVV

Flanking regions ( +/- flanking 50bp)

GACTTTACCTATGTTTTTCCTGTTTTTATAAAGTCCATGAGGTTTCGCCTTTGTTTGATCGTTATGAAGGTGGCGAATTAGCCGTTTTAGTGCACGTTTTCTTTTCGCAAGAAAAGGATATTGATGACTTGCAAGAGTTTGAATCTTTGGTGACATCTGCCGGTGTAAAACCAGTTCAAATTATTACAGGGAGCCGTAGAGCGCCTCACTCCAAATATTATGTGGGAGAAGGTAAAGCGGAAGAAATCGCAGAAGCAGTAAAAGCGAGTGGTGCAGATGTGGTGCTATTTAATCACGCACTCTCACCGGCACAAGAACGAAATCTGGAAAGACTTTGTGAATGTCGTGTAGTTGATCGCACGGGAGTTATCCTCGATATTTTTGCTCAACGAGCAAGAACTCACGAAGGAAAGCTACAGGTAGAACTCGCTCAGTTACGTCATTTATCAACCCGTTTAGTTCGAGGGTGGACACACTTAGAACGACAAAAAGGGGGGATTGGATTACGTGGCCCTGGCGAAACACAGCTTGAAACGGACCGACGTTTGCTCAGAGGCAAAATTAGTCAAATTCTAATGCGTCTAGGCAAAGTTGAACGTCAGCGTGAACAAGGACGACAAGCGCGAAGTAAAGCTGATATTCCAACGTTATCTCTGGTGGGTTACACCAATGCGGGTAAGTCGAGTTTATTCAATCGTATAACCTGTGCAGATGTGTATGCTGCTGATCAGTTGTTTGCGACACTGGATCCTACCTTAAGACGAATTCAGGTCGATGATGTTGGTACCGTGGTGTTAGCTGATACGGTTGGTTTTATCCGACATCTACCTCATGATCTGGTGGCGGCATTTAAGGCAACGCTACAAGAAACACGTGAAGCGACATTGCTTCTTCATGTTATTGATGCCGCTGATAGCCGTTTTGAAGAGAACATTCATGCAGTTGAAAATGTATTAGAAGAGATTGATGCTCACGAGATACCGACACTGTATGTGATGAATAAAATTGATCTTCTTGAGGACTTCACCCCAAGAATTGATCGAAATGAAGATAATTTACCTGTTAGGGTTTGGGTTTCTGCACAAACAGGTGAAGGTATTCCTCTGTTATATCAGGCGTTGACAGAGCGCCTTTCAGGTGAGATCGCACACGTTGAATTGCGTTTACCGCCAGAAGAAGCAGGGCGATTACGTAGCCGTTTTTATCAATTACAGGCTATTGAGCGTGAATGGATTGAAAAAGACGGTAAAGTTGGGCTAATCACCCGAATGCCTATGGTAGACTGGCATCGACTTTGCAAGCAGGAGCCTACTTTATTGGATTACGTGGTCTGATAATTGGCCATACTAAAGAACATTAACTGAGAGCTGGCGATGAAATCGGC