Homologs in group_1642

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10855 FBDBKF_10855 58.8 Morganella morganii S1 btuB TonB-dependent vitamin B12 receptor BtuB
EHELCC_19440 EHELCC_19440 58.8 Morganella morganii S2 btuB TonB-dependent vitamin B12 receptor BtuB
NLDBIP_15020 NLDBIP_15020 58.8 Morganella morganii S4 btuB TonB-dependent vitamin B12 receptor BtuB
LHKJJB_14325 LHKJJB_14325 58.8 Morganella morganii S3 btuB TonB-dependent vitamin B12 receptor BtuB
HKOGLL_12945 HKOGLL_12945 58.8 Morganella morganii S5 btuB TonB-dependent vitamin B12 receptor BtuB
F4V73_RS16895 F4V73_RS16895 57.4 Morganella psychrotolerans btuB TonB-dependent vitamin B12 receptor BtuB

Distribution of the homologs in the orthogroup group_1642

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1642

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7MYE3 0.0 748 57 5 625 3 btuB Vitamin B12 transporter BtuB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4TRG0 0.0 711 56 10 634 3 btuB Vitamin B12 transporter BtuB Yersinia pestis (strain Pestoides F)
Q1CNP0 0.0 711 56 10 634 3 btuB Vitamin B12 transporter BtuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAA1 0.0 711 56 10 634 3 btuB Vitamin B12 transporter BtuB Yersinia pestis
Q1CBU1 0.0 711 56 10 634 3 btuB Vitamin B12 transporter BtuB Yersinia pestis bv. Antiqua (strain Antiqua)
A7ML93 0.0 682 54 9 626 3 btuB Vitamin B12 transporter BtuB Cronobacter sakazakii (strain ATCC BAA-894)
Q66G57 0.0 679 55 9 633 3 btuB Vitamin B12 transporter BtuB Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FD14 0.0 679 55 9 633 3 btuB Vitamin B12 transporter BtuB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6CZB5 0.0 678 54 11 626 3 btuB Vitamin B12 transporter BtuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4WG45 0.0 669 53 7 623 3 btuB Vitamin B12 transporter BtuB Enterobacter sp. (strain 638)
Q5PK67 0.0 665 53 7 622 3 btuB Vitamin B12 transporter BtuB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H87 0.0 665 53 7 622 3 btuB Vitamin B12 transporter BtuB Salmonella choleraesuis (strain SC-B67)
Q8Z314 0.0 664 53 7 622 3 btuB Vitamin B12 transporter BtuB Salmonella typhi
P37409 0.0 663 53 7 622 3 btuB Vitamin B12 transporter BtuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1R3U1 0.0 650 53 9 619 3 btuB Vitamin B12 transporter BtuB Escherichia coli (strain UTI89 / UPEC)
A1AIE8 0.0 650 53 9 619 3 btuB Vitamin B12 transporter BtuB Escherichia coli O1:K1 / APEC
Q0TA90 0.0 649 53 9 619 3 btuB Vitamin B12 transporter BtuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8CVJ0 0.0 648 53 9 619 3 btuB Vitamin B12 transporter BtuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A774 0.0 648 52 7 617 3 btuB Vitamin B12 transporter BtuB Escherichia coli O9:H4 (strain HS)
Q3YV10 0.0 648 52 7 617 3 btuB Vitamin B12 transporter BtuB Shigella sonnei (strain Ss046)
P06129 0.0 648 52 7 617 1 btuB Vitamin B12 transporter BtuB Escherichia coli (strain K12)
Q32AE6 0.0 647 52 9 619 3 btuB Vitamin B12 transporter BtuB Shigella dysenteriae serotype 1 (strain Sd197)
Q8X714 0.0 647 53 9 619 3 btuB Vitamin B12 transporter BtuB Escherichia coli O157:H7
A7ZUI6 0.0 646 52 7 617 3 btuB Vitamin B12 transporter BtuB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SY25 0.0 645 52 7 617 3 btuB Vitamin B12 transporter BtuB Shigella flexneri serotype 5b (strain 8401)
O52903 0.0 643 53 8 617 3 btuB Vitamin B12 transporter BtuB Citrobacter freundii
Q83IS4 0.0 641 52 7 617 3 btuB Vitamin B12 transporter BtuB Shigella flexneri
Q93SE0 0.0 641 51 7 622 3 btuB Vitamin B12 transporter BtuB Escherichia coli
C3LPZ6 1.53e-117 365 37 13 602 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain M66-2)
Q9KVI9 1.53e-117 365 37 13 602 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4P6 1.53e-117 365 37 13 602 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6LLU3 2.76e-113 354 36 14 626 3 btuB Vitamin B12 transporter BtuB Photobacterium profundum (strain SS9)
A7MXY8 9.86e-104 330 33 13 633 3 btuB Vitamin B12 transporter BtuB Vibrio campbellii (strain ATCC BAA-1116)
Q87KN9 1.58e-102 327 33 14 618 3 btuB Vitamin B12 transporter BtuB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8DD41 2.73e-100 320 31 11 624 3 btuB Vitamin B12 transporter BtuB Vibrio vulnificus (strain CMCP6)
Q7MQ42 3.48e-90 294 31 13 608 3 btuB Vitamin B12 transporter BtuB Vibrio vulnificus (strain YJ016)
P17315 7.86e-43 167 24 24 684 1 cirA Colicin I receptor Escherichia coli (strain K12)
P0C6R0 4.21e-27 120 25 27 672 3 irgA Iron-regulated outer membrane virulence protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F9G0 1.34e-26 118 25 27 672 3 irgA Iron-regulated outer membrane virulence protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9I527 5.14e-24 110 24 28 688 1 pirA Ferric enterobactin receptor PirA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P31499 1.69e-12 74 38 5 136 2 hemR Hemin receptor Yersinia enterocolitica
D0C8V9 2.48e-12 73 31 6 170 1 pirA Probable TonB-dependent siderophore receptor PirA Acinetobacter baumannii (strain ATCC 19606 / DSM 30007 / JCM 6841 / CCUG 19606 / CIP 70.34 / NBRC 109757 / NCIMB 12457 / NCTC 12156 / 81)
P44600 1.65e-11 70 32 6 178 1 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44600 8.71e-06 52 22 17 354 1 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q05098 1.85e-11 70 34 7 168 1 pfeA Ferric enterobactin receptor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05098 3.89e-05 50 24 11 307 1 pfeA Ferric enterobactin receptor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q56989 1.94e-11 70 38 5 136 3 hmuR Hemin receptor Yersinia pestis
Q8YZR0 1.97e-11 70 35 5 132 1 schT Schizokinen transporter SchT Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q4QNS6 1.5e-10 67 32 6 178 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain 86-028NP)
Q4QNS6 8.48e-07 55 21 14 345 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain 86-028NP)
P05825 2.24e-10 67 34 5 143 1 fepA Ferrienterobactin receptor Escherichia coli (strain K12)
P05825 9.12e-06 52 22 11 315 1 fepA Ferrienterobactin receptor Escherichia coli (strain K12)
P45357 2.55e-10 67 31 6 178 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae
P45357 0.000273 47 21 16 365 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae
Q01674 8.76e-09 62 29 4 175 3 foxA Ferrioxamine receptor Yersinia enterocolitica
Q1REC0 6.79e-08 59 25 5 183 3 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain UTI89 / UPEC)
Q1REC0 0.000239 48 23 14 260 3 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain UTI89 / UPEC)
Q8CW90 6.85e-08 59 25 5 183 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8CW90 0.000161 48 24 14 260 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P75780 8.64e-08 59 24 6 204 1 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain K12)
P75780 0.000584 46 23 14 260 1 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain K12)
Q8X7W7 8.64e-08 59 24 6 204 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O157:H7
Q8X7W7 0.000642 46 23 14 260 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O157:H7
P44970 2.24e-07 57 28 4 177 3 tbpA Transferrin-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JWA2 8.79e-07 55 32 1 85 3 hpuB Hemoglobin-haptoglobin utilization protein B Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P96949 8.94e-07 55 32 1 85 3 hpuB Hemoglobin-haptoglobin utilization protein B Neisseria meningitidis serogroup C
P13036 1.21e-06 55 27 4 125 1 fecA Fe(3+) dicitrate transport protein FecA Escherichia coli (strain K12)
P81549 1.26e-06 55 28 6 163 1 bfrD Probable TonB-dependent receptor BfrD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P48632 1.62e-06 55 23 6 219 1 fpvA Ferripyoverdine receptor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9Z3Q5 1.96e-06 54 31 8 157 3 rhtA Rhizobactin receptor Rhizobium meliloti (strain 1021)
P06971 1.58e-05 52 24 3 128 1 fhuA Ferrichrome outer membrane transporter/phage receptor Escherichia coli (strain K12)
P25184 1.92e-05 51 27 3 144 1 pupA Ferric-pyoverdine 358 receptor Pseudomonas putida
P76115 2.37e-05 51 27 5 169 1 pqqU Pyrroloquinoline quinone transporter Escherichia coli (strain K12)
Q06987 2.74e-05 51 26 5 184 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B
Q48153 4.17e-05 50 28 5 166 3 hhuA Hemoglobin-haptoglobin-binding protein A Haemophilus influenzae
P0CL48 4.19e-05 50 22 5 168 3 foxA Ferrioxamine B receptor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W8M5 4.26e-05 50 22 5 168 3 foxA Ferrioxamine B receptor Salmonella typhimurium (strain SL1344)
Q01996 4.91e-05 50 25 7 240 3 tbpA Transferrin-binding protein A Neisseria gonorrhoeae
Q47162 4.93e-05 50 28 3 126 3 fct Ferrichrysobactin receptor Dickeya dadantii (strain 3937)
Q9K0U9 7.6e-05 49 26 5 184 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q09056 7.72e-05 49 26 5 184 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B
P44795 8.08e-05 49 28 4 157 1 HI_0635 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JZN9 0.000143 48 24 5 185 1 NMB0964 Probable TonB-dependent receptor NMB0964 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0C2M9 0.000224 48 27 5 145 2 fyuA Pesticin receptor Yersinia enterocolitica
A1JTG3 0.000226 48 27 5 145 3 fyuA Pesticin receptor Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P44809 0.000292 47 26 3 126 1 HI_0661 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46359 0.000423 47 27 5 145 1 fyuA Pesticin receptor Yersinia pestis
Q6U607 0.000483 47 28 6 132 1 iutA Ferric aerobactin receptor Klebsiella pneumoniae
Q06379 0.000543 47 26 4 183 2 lbpA Lactoferrin-binding protein A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q8YQ14 0.000619 46 23 6 185 1 iacT Iron and copper transporter IacT Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS16050
Feature type CDS
Gene btuB
Product TonB-dependent vitamin B12 receptor BtuB
Location 3566925 - 3568778 (strand: 1)
Length 1854 (nucleotides) / 617 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1642
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00593 TonB dependent receptor-like, beta-barrel
PF07715 TonB-dependent Receptor Plug Domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4771 Inorganic ion transport and metabolism (P) P Outer membrane receptor for ferrienterochelin and colicins

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K16092 vitamin B12 transporter - -

Protein Sequence

MNNKKVFFLSSVALSVMTSSFNLFAQADNTLSVTANRFQQPTSSILAPVTIVDREQIDRWQSNSVLDVLRRMPGIDVAQSGGIGQMSSVFVRGTDSRHVLILIDGVRTNQAGISGSYDMSQLPLSLVQRIEYIRGPRSAVYGSDAIGGVINFITKRQNDGLTLNAGIGSHGYQNYNGSIQQKVGERTTLSAAGGYTYTKGIHATDDSVPVAAPFHDRHGFMSKSYWFGIDHIFNDNFQGYMKGYGYDNRTTYVASYPGNTDQSKTYNRNYEAGIKFSGDSYFSQLITVYSQTKDYNYISTNGRDGKGSSVDNSKQYNVQWGNTFLIPSGMISAGMDWQRQTIEANSASVPHQRTIDNTGLYLTSQKQLSSVIVEGAIRSDHHDEFNWHTTWQTSASWEFVDNYRVIASYGTAFKAPTLGQLYADNPAWNTKGNPNLKPEKSKQWEVGVEGLTQGIDWRLSLYQNDIDNLIAFRDNTYINYNKAKIKGAEWVGEMDTGLLHHQLTLQYLDARDSDNKLLSRRAKQQLKYQVDWNIADIDIGINYQYIGKRYDTDFNQYPTKRIKLGGVSLWDLTASYPITSHLSIRGRIANLFDKDYETAYGYRTPGREYFLTGSYNF

Flanking regions ( +/- flanking 50bp)

ATTTAATTTTGGCGGCATCCTGCTACTTATTTCTGTTGGATGCAGATTTCATGAATAATAAAAAAGTATTTTTTCTTTCAAGTGTTGCTTTAAGTGTTATGACGAGCAGTTTCAACCTATTTGCACAGGCTGATAATACATTGAGTGTGACTGCTAATCGTTTTCAACAACCTACCTCCTCTATTTTAGCGCCAGTGACTATTGTTGATCGTGAACAGATCGATCGCTGGCAGAGCAATAGTGTGCTTGATGTATTGCGTAGAATGCCAGGGATTGATGTAGCACAAAGTGGTGGTATAGGGCAGATGAGTTCAGTCTTTGTGCGAGGAACTGACTCAAGACATGTATTAATATTAATTGATGGTGTACGTACTAACCAAGCAGGGATTTCTGGCTCTTACGATATGAGTCAACTGCCTCTTTCTTTAGTACAACGTATTGAATATATAAGAGGCCCTCGTTCGGCTGTTTATGGCTCCGATGCGATTGGTGGGGTCATTAATTTTATAACGAAACGCCAAAATGATGGTTTAACGTTAAATGCAGGAATAGGAAGCCATGGATATCAAAATTACAATGGTTCAATACAACAAAAGGTAGGTGAGAGAACCACATTATCTGCGGCAGGTGGATATACTTATACTAAGGGAATACATGCAACGGATGATTCTGTCCCTGTTGCCGCCCCTTTTCATGACAGACATGGATTTATGAGTAAATCCTATTGGTTTGGTATCGACCATATTTTTAATGATAACTTTCAAGGCTATATGAAAGGGTATGGTTATGATAATCGTACTACTTATGTTGCATCTTATCCCGGTAATACAGATCAAAGTAAAACTTATAATCGTAATTATGAAGCGGGTATTAAGTTCAGTGGTGATTCCTATTTTAGTCAATTAATTACGGTGTATAGCCAAACTAAAGACTATAACTACATTTCAACAAATGGCCGTGATGGTAAGGGCTCTTCTGTAGATAATTCTAAACAATATAATGTTCAATGGGGGAACACCTTTTTAATTCCAAGTGGCATGATCAGCGCAGGAATGGATTGGCAAAGACAAACGATTGAAGCGAATTCAGCATCAGTACCTCATCAAAGAACAATTGATAATACAGGGCTATATCTCACATCTCAAAAACAACTTAGTTCAGTTATCGTCGAAGGCGCTATTCGTTCTGATCACCACGATGAATTTAACTGGCATACTACATGGCAAACCAGTGCAAGTTGGGAGTTCGTCGATAACTATCGAGTAATTGCTTCTTATGGTACGGCATTTAAGGCTCCTACATTGGGGCAACTTTATGCGGATAATCCTGCATGGAACACAAAAGGTAATCCCAACTTAAAACCAGAGAAAAGTAAGCAGTGGGAAGTGGGCGTTGAAGGGTTAACTCAAGGGATTGATTGGCGTTTATCTCTATATCAAAATGATATTGATAATCTGATTGCTTTTAGAGATAACACTTACATTAATTACAATAAAGCTAAAATAAAAGGTGCTGAATGGGTTGGTGAGATGGATACTGGATTATTACATCATCAATTAACATTGCAGTACCTTGATGCTAGAGATAGTGATAATAAACTATTAAGCAGAAGAGCAAAGCAACAGCTTAAGTATCAAGTAGATTGGAATATCGCAGATATAGATATTGGAATTAATTATCAATATATAGGAAAGCGCTATGATACGGACTTTAACCAATATCCTACGAAAAGAATAAAACTAGGTGGGGTAAGTCTTTGGGATTTAACTGCGTCATATCCTATTACATCTCATCTCTCAATTCGTGGTAGAATAGCCAACCTGTTTGATAAAGATTATGAGACAGCTTATGGCTATCGCACGCCAGGACGTGAATATTTCCTCACCGGAAGCTACAACTTCTGATGCACAATCTACCGCTAATCCCACTGTCTTAGTTTTTGACTCAGGGGTTG