Homologs in group_1653

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10495 FBDBKF_10495 85.3 Morganella morganii S1 actP Na+(or H+)/acetate symporter ActP
EHELCC_14830 EHELCC_14830 85.3 Morganella morganii S2 actP Na+(or H+)/acetate symporter ActP
NLDBIP_14660 NLDBIP_14660 85.3 Morganella morganii S4 actP Na+(or H+)/acetate symporter ActP
LHKJJB_14685 LHKJJB_14685 85.3 Morganella morganii S3 actP Na+(or H+)/acetate symporter ActP
HKOGLL_13305 HKOGLL_13305 85.3 Morganella morganii S5 actP Na+(or H+)/acetate symporter ActP
F4V73_RS14205 F4V73_RS14205 85.8 Morganella psychrotolerans - cation acetate symporter

Distribution of the homologs in the orthogroup group_1653

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1653

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7NA72 0.0 929 87 0 532 3 actP Cation/acetate symporter ActP Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JIK1 0.0 925 83 0 551 3 actP Cation/acetate symporter ActP Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JNK6 0.0 914 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FN0 0.0 914 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K137 0.0 914 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FNG3 0.0 914 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TS08 0.0 912 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pestis (strain Pestoides F)
Q1CE35 0.0 912 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Nepal516)
A9R563 0.0 912 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJ73 0.0 912 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pestis
Q1C0M8 0.0 912 82 0 551 3 actP Cation/acetate symporter ActP Yersinia pestis bv. Antiqua (strain Antiqua)
C6D930 0.0 893 81 0 542 3 actP Cation/acetate symporter ActP Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D913 0.0 890 81 0 542 3 actP Cation/acetate symporter ActP Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VKE4 0.0 876 80 0 536 3 actP Cation/acetate symporter ActP Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8AN31 0.0 855 79 1 532 3 actP Cation/acetate symporter ActP Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5R937 0.0 855 80 1 530 3 actP Cation/acetate symporter ActP Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZ97 0.0 854 80 1 530 3 actP Cation/acetate symporter ActP Salmonella enteritidis PT4 (strain P125109)
B5FRF0 0.0 854 80 1 530 3 actP Cation/acetate symporter ActP Salmonella dublin (strain CT_02021853)
A9MGK8 0.0 854 80 1 530 3 actP Cation/acetate symporter ActP Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4T1W9 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella newport (strain SL254)
Q8ZKF8 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRK2 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella schwarzengrund (strain CVM19633)
B5BJZ5 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain AKU_12601)
A9N1R2 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJ05 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TEB2 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella heidelberg (strain SL476)
B5F2E9 0.0 853 80 1 530 3 actP Cation/acetate symporter ActP Salmonella agona (strain SL483)
Q57GV4 0.0 852 80 1 530 3 actP Cation/acetate symporter ActP Salmonella choleraesuis (strain SC-B67)
C0Q552 0.0 851 80 1 530 3 actP Cation/acetate symporter ActP Salmonella paratyphi C (strain RKS4594)
Q1R3J9 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain UTI89 / UPEC)
B6I5T5 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain SE11)
P32705 0.0 851 80 1 532 1 actP Cation/acetate symporter ActP Escherichia coli (strain K12)
B1IUI4 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A1AIQ8 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O1:K1 / APEC
B1XCV3 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / DH10B)
C5A160 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain K12 / MC4100 / BW2952)
B7MSH6 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O81 (strain ED1a)
B7LB16 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain 55989 / EAEC)
B7MJT5 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UPN5 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZUU1 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LMN9 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8A7G7 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O9:H4 (strain HS)
B7M7Y0 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O8 (strain IAI1)
B5Z1C8 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5T7 0.0 851 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O157:H7
A4W5I3 0.0 850 82 1 532 3 actP Cation/acetate symporter ActP Enterobacter sp. (strain 638)
B1LPN2 0.0 850 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli (strain SMS-3-5 / SECEC)
Q0T9Y2 0.0 850 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NSM7 0.0 850 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q31TS7 0.0 849 80 1 532 3 actP Cation/acetate symporter ActP Shigella boydii serotype 4 (strain Sb227)
B7NG10 0.0 849 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8Z1R2 0.0 849 79 1 530 3 actP Cation/acetate symporter ActP Salmonella typhi
B2TXA0 0.0 848 79 1 532 3 actP Cation/acetate symporter ActP Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3YUR7 0.0 848 80 1 532 3 actP Cation/acetate symporter ActP Shigella sonnei (strain Ss046)
Q8FAZ0 0.0 848 80 1 532 3 actP Cation/acetate symporter ActP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83P94 0.0 846 79 1 532 3 actP Cation/acetate symporter ActP Shigella flexneri
A6TGZ7 0.0 846 82 1 532 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XXT7 0.0 846 82 1 532 3 actP Cation/acetate symporter ActP Klebsiella pneumoniae (strain 342)
P39599 5.76e-147 435 45 5 521 3 ywcA Uncharacterized symporter YwcA Bacillus subtilis (strain 168)
Q8NS49 2.64e-126 384 43 9 552 1 mctC Monocarboxylic acid transporter Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q49YU6 3.3e-29 124 25 11 458 3 putP2 Sodium/proline symporter 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q53584 1.1e-26 117 25 16 505 3 putP Sodium/proline symporter Staphylococcus aureus
A8Z2R6 3.51e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300 / TCH1516)
Q2FFJ3 3.51e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain USA300)
Q7A0H2 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain MW2)
Q6G831 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain MSSA476)
Q7A4Q7 3.96e-26 115 26 16 505 1 putP Sodium/proline symporter Staphylococcus aureus (strain N315)
Q99SY5 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEM0 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain COL)
A5IU69 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH9)
Q2FWY7 3.96e-26 115 26 16 505 1 putP Sodium/proline symporter Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U307 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain JH1)
A7X430 3.96e-26 115 26 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8CNP2 5.14e-26 115 25 16 520 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q2YU74 5.28e-26 115 26 16 500 3 putP Sodium/proline symporter Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GFF5 1.26e-25 114 26 17 506 3 putP Sodium/proline symporter Staphylococcus aureus (strain MRSA252)
Q5HN32 1.55e-25 113 25 17 523 3 putP Sodium/proline symporter Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O06493 2.45e-25 112 25 14 498 1 opuE Osmoregulated proline transporter OpuE Bacillus subtilis (strain 168)
A6QID0 3.26e-25 112 25 16 505 3 putP Sodium/proline symporter Staphylococcus aureus (strain Newman)
Q4A070 2.1e-24 110 24 15 527 3 putP1 Sodium/proline symporter 1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P94392 3.24e-24 109 26 12 428 1 putP High-affinity proline transporter PutP Bacillus subtilis (strain 168)
Q4L7L6 3.26e-23 106 24 14 530 3 putP Sodium/proline symporter Staphylococcus haemolyticus (strain JCSC1435)
P31640 1.34e-22 105 32 4 184 3 H16_A2524 Uncharacterized symporter H16_A2524 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P31640 5.03e-11 69 27 8 224 3 H16_A2524 Uncharacterized symporter H16_A2524 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P45174 5.08e-22 102 25 13 475 3 putP Sodium/proline symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P10502 7.74e-17 87 23 11 466 1 putP Sodium/proline symporter Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07117 1.61e-15 82 23 11 446 1 putP Sodium/proline symporter Escherichia coli (strain K12)
O34745 1.68e-11 70 24 21 476 2 yodF Uncharacterized symporter YodF Bacillus subtilis (strain 168)
P16256 1.07e-10 67 23 18 485 1 panF Sodium/pantothenate symporter Escherichia coli (strain K12)
P96169 1.13e-10 67 23 22 487 1 sglT Sodium/glucose cotransporter Vibrio parahaemolyticus
Q5E733 6.71e-10 65 20 9 400 3 nanT Sodium/sialic acid symporter NanT Aliivibrio fischeri (strain ATCC 700601 / ES114)
P44963 1.52e-08 60 23 14 472 3 panF Sodium/pantothenate symporter Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B4EZY7 2.46e-08 60 19 4 282 1 siaT Sodium/sialic acid symporter SiaT Proteus mirabilis (strain HI4320)
Q92911 6.61e-08 59 23 2 182 1 SLC5A5 Sodium/iodide cotransporter Homo sapiens
Q63008 1.94e-07 57 25 2 181 1 Slc5a5 Sodium/iodide cotransporter Rattus norvegicus
Q9GZV3 6.3e-07 55 22 20 524 1 SLC5A7 High affinity choline transporter 1 Homo sapiens
Q99PN0 5.72e-06 52 24 2 181 1 Slc5a5 Sodium/iodide cotransporter Mus musculus
Q1M7A2 6.19e-06 52 23 8 279 1 mctP Monocarboxylate transport permease protein Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q49B93 6.75e-06 52 21 22 486 1 Slc5a12 Sodium-coupled monocarboxylate transporter 2 Mus musculus
P53793 4.74e-05 50 21 15 487 3 SLC5A3 Sodium/myo-inositol cotransporter Bos taurus
Q5SWY8 8.94e-05 48 21 11 381 1 Slc5a10 Sodium/mannose cotransporter SLC5A10 Mus musculus
Q8VDT1 0.00012 48 20 12 381 1 Slc5a9 Sodium/glucose cotransporter 4 Mus musculus
Q9JKZ2 0.000137 48 20 15 491 1 Slc5a3 Sodium/myo-inositol cotransporter Mus musculus
P31637 0.000404 47 20 15 487 1 SLC5A3 Sodium/myo-inositol cotransporter Canis lupus familiaris
Q1EHB4 0.000537 46 22 6 195 1 SLC5A12 Sodium-coupled monocarboxylate transporter 2 Homo sapiens
O07556 0.000799 45 21 18 460 3 yhjB Uncharacterized symporter YhjB Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS15035
Feature type CDS
Gene -
Product cation acetate symporter
Location 3335430 - 3337085 (strand: 1)
Length 1656 (nucleotides) / 551 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1653
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00474 Sodium:solute symporter family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4147 Energy production and conversion (C) C Na+(or H+)/acetate symporter ActP

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14393 cation/acetate symporter - -

Protein Sequence

MKNKHYAISLLTLLSPNVLAAAITEGGEKQPINFQAIIMFLIFVGLTLYITYWASKRTRSRSDYYTAGGKITGFQNGMAIAGDFMSAASFLGISALVYTSGYDGLIYSIGFLIGWPIILFIIAERLRNLGRYTFADVVSYRLSPKPIRTLSAIGSLVVVALYLIAQMVGAGKLIELLFGLNYHIAVILVGILMVLYVLFGGMLATTWVQIIKAILLLAGATFMAVMVMKAADFNFNTLFKEAVNVHQKGFSIMSPGGLVSDPISALSLGLALMFGTAGLPHIIMRFFTVSDAKEARKSVFYATGFIGYFYILTFIIGFGAILLVSPNPLFKDAAGALIGGTNMAAVHLADAVGGNFFLGFISAVAFATILAVVAGLTLAGASAVSHDLYANVIKNGQADERQELKVSKITVVILGIVAIGLGILFEKQNIAFMVGLAFSIAASCNFPIILLSMYWKGLTTRGAVIGGWSGLIVAVTLMILGPTIWVSILGHDTPIYPYEYPALFSMIIAFIVSWLFSITDNSSLATQERMKFEAQFIRSQIGIGAEQGKPH

Flanking regions ( +/- flanking 50bp)

AATACAGAGTTTGACAAATTAACGGCAGAAATTCTTGGTGAGGTAGAAAAATGAAAAATAAACACTACGCCATATCACTATTAACGTTATTATCCCCCAATGTATTAGCCGCAGCGATAACCGAAGGGGGTGAAAAACAGCCAATTAACTTCCAAGCCATTATCATGTTTCTGATCTTTGTTGGCTTAACACTGTATATTACTTACTGGGCCTCTAAACGAACACGATCACGGTCTGATTATTACACTGCGGGTGGCAAAATTACCGGATTTCAAAATGGTATGGCTATCGCTGGTGATTTTATGTCTGCCGCCTCCTTTTTAGGAATTTCAGCGTTAGTATACACTTCTGGCTATGATGGACTTATCTACTCTATTGGCTTTTTAATCGGCTGGCCAATCATTCTATTTATTATCGCTGAACGTTTGCGTAATTTAGGACGCTATACTTTTGCTGATGTTGTCTCTTACCGTTTAAGTCCAAAGCCCATTAGAACACTTTCTGCAATAGGTTCATTAGTTGTTGTTGCCCTCTATCTTATTGCTCAAATGGTAGGGGCAGGTAAATTAATCGAGCTACTTTTTGGCTTAAACTACCATATTGCGGTGATCTTAGTCGGTATTTTAATGGTTCTTTATGTCCTTTTTGGCGGCATGTTAGCCACCACTTGGGTACAAATAATCAAAGCCATTTTATTACTCGCCGGTGCAACTTTTATGGCGGTCATGGTAATGAAAGCGGCAGACTTTAACTTCAATACTTTGTTTAAAGAAGCTGTTAACGTCCATCAAAAAGGCTTTTCTATCATGAGTCCAGGAGGATTAGTTTCTGATCCTATCTCTGCATTATCCTTAGGTCTTGCCTTAATGTTTGGTACCGCAGGACTTCCCCACATTATCATGCGCTTTTTTACCGTTAGCGATGCAAAAGAGGCTCGTAAAAGTGTTTTCTATGCGACAGGTTTTATCGGTTATTTCTATATTCTTACTTTTATTATTGGTTTCGGGGCTATCTTACTCGTTAGCCCTAATCCTCTGTTCAAAGATGCCGCTGGTGCTTTAATTGGTGGCACCAATATGGCCGCTGTTCATTTAGCGGATGCTGTTGGTGGTAATTTCTTCCTTGGTTTTATTTCTGCAGTCGCTTTTGCCACTATTTTAGCCGTTGTTGCAGGATTAACTTTAGCAGGTGCATCTGCCGTTTCTCATGATTTATACGCCAATGTAATTAAAAATGGCCAAGCAGATGAGCGACAAGAGCTAAAAGTTTCGAAAATAACGGTTGTTATTCTCGGCATTGTCGCCATTGGTTTAGGTATTTTATTTGAGAAACAGAATATTGCCTTTATGGTCGGTTTAGCTTTCTCTATCGCTGCAAGTTGTAATTTCCCTATTATCTTACTCTCTATGTATTGGAAGGGATTAACAACACGTGGGGCTGTAATTGGTGGCTGGTCTGGCTTAATTGTTGCCGTTACCTTAATGATCTTAGGTCCCACGATCTGGGTGAGTATTCTTGGTCATGATACACCTATTTATCCTTACGAGTACCCTGCTCTTTTCTCTATGATCATTGCCTTTATCGTTTCATGGTTATTCTCCATTACCGATAATTCTTCTCTGGCAACTCAAGAGCGTATGAAATTTGAAGCTCAGTTTATTCGCTCACAAATAGGTATTGGTGCAGAGCAAGGTAAACCTCATTAAACATCTGTAAAATAGTTTTTTATTCTTAAAGTGCCAACAATGTTGGCACT