Homologs in group_1593

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10385 FBDBKF_10385 71.9 Morganella morganii S1 mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
EHELCC_14720 EHELCC_14720 71.9 Morganella morganii S2 mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
NLDBIP_14550 NLDBIP_14550 71.9 Morganella morganii S4 mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
LHKJJB_14795 LHKJJB_14795 71.9 Morganella morganii S3 mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
HKOGLL_13415 HKOGLL_13415 71.9 Morganella morganii S5 mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
F4V73_RS14080 F4V73_RS14080 72.0 Morganella psychrotolerans mrcA peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA

Distribution of the homologs in the orthogroup group_1593

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1593

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P02918 0.0 1202 67 6 854 1 mrcA Penicillin-binding protein 1A Escherichia coli (strain K12)
Q9KNU5 0.0 921 53 10 866 3 mrcA Penicillin-binding protein 1A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P31776 0.0 833 50 12 859 1 mrcA Penicillin-binding protein 1A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q07806 0.0 632 41 10 851 1 mrcA Penicillin-binding protein 1A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9PGD4 0.0 559 40 13 786 3 mrcA Penicillin-binding protein 1A Xylella fastidiosa (strain 9a5c)
Q87AW7 0.0 556 40 14 787 3 mrcA Penicillin-binding protein 1A Xylella fastidiosa (strain Temecula1 / ATCC 700964)
O87579 8.87e-173 522 38 18 844 3 mrcA Penicillin-binding protein 1A Neisseria lactamica
O86088 2.56e-169 513 37 13 796 3 mrcA Penicillin-binding protein 1A Neisseria cinerea
O87626 2.56e-166 505 38 11 764 3 mrcA Penicillin-binding protein 1A Neisseria flavescens
P0A0Z6 9.06e-153 470 40 5 622 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0A0Z6 3.65e-14 80 38 4 123 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P0A0Z5 9.06e-153 470 40 5 622 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P0A0Z5 3.65e-14 80 38 4 123 3 mrcA Penicillin-binding protein 1A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
O05131 4.51e-151 466 40 5 622 1 mrcA Penicillin-binding protein 1A Neisseria gonorrhoeae
Q5FAC7 4.51e-151 466 40 5 622 3 mrcA Penicillin-binding protein 1A Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q68VU2 5.2e-137 429 33 19 830 3 mrcA Penicillin-binding protein 1A Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UK08 4.3e-134 421 33 19 849 3 mrcA Penicillin-binding protein 1A Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92G78 3.18e-132 416 33 18 844 3 mrcA Penicillin-binding protein 1A Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q1RKC5 2.47e-131 414 33 18 849 3 mrcA Penicillin-binding protein 1A Rickettsia bellii (strain RML369-C)
Q9ZCE9 2.55e-131 414 33 20 828 3 mrcA Penicillin-binding protein 1A Rickettsia prowazekii (strain Madrid E)
O66874 2.61e-96 320 35 15 647 1 mrcA Penicillin-binding protein 1A Aquifex aeolicus (strain VF5)
O66874 7.03e-11 69 30 6 161 1 mrcA Penicillin-binding protein 1A Aquifex aeolicus (strain VF5)
P39793 9e-53 202 33 6 315 1 ponA Penicillin-binding protein 1A/1B Bacillus subtilis (strain 168)
P39793 5.17e-17 89 25 17 421 1 ponA Penicillin-binding protein 1A/1B Bacillus subtilis (strain 168)
Q07259 2.99e-50 179 55 1 176 3 H16_A0665 Putative transglycosylase H16_A0665 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q00573 1.94e-48 186 37 6 304 3 ponA Penicillin-binding protein 1A (Fragment) Streptococcus oralis
Q00573 6.02e-05 50 26 7 218 3 ponA Penicillin-binding protein 1A (Fragment) Streptococcus oralis
P38050 2.86e-47 183 36 3 271 2 pbpF Penicillin-binding protein 1F Bacillus subtilis (strain 168)
P38050 3.3e-13 77 31 8 189 2 pbpF Penicillin-binding protein 1F Bacillus subtilis (strain 168)
P45345 3.48e-44 175 37 3 256 3 mrcB Penicillin-binding protein 1B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45345 7.84e-17 89 24 11 357 3 mrcB Penicillin-binding protein 1B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04707 1.69e-43 172 34 7 308 1 ponA Penicillin-binding protein 1A Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04707 5.37e-05 50 25 8 236 1 ponA Penicillin-binding protein 1A Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8DR59 7.94e-43 170 34 7 308 1 pbpA Penicillin-binding protein 1A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DR59 5.19e-05 50 25 8 236 1 pbpA Penicillin-binding protein 1A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P70997 3.87e-42 167 36 4 264 2 pbpG Penicillin-binding protein 2D Bacillus subtilis (strain 168)
P70997 2.59e-25 115 35 2 182 2 pbpG Penicillin-binding protein 2D Bacillus subtilis (strain 168)
P70997 2.71e-11 70 35 4 127 2 pbpG Penicillin-binding protein 2D Bacillus subtilis (strain 168)
Q9KUC0 7.78e-41 164 36 3 249 3 mrcB Penicillin-binding protein 1B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KUC0 1.23e-17 91 32 2 190 3 mrcB Penicillin-binding protein 1B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5I6G4 1.67e-40 164 33 11 331 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A5I6G4 1.57e-16 88 33 9 209 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A5I6G4 1.05e-11 72 32 5 173 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY32 1.67e-40 164 33 11 331 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain ATCC 19397 / Type A)
A7FY32 1.57e-16 88 33 9 209 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain ATCC 19397 / Type A)
A7FY32 1.05e-11 72 32 5 173 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain ATCC 19397 / Type A)
Q8XJ01 2.94e-40 162 33 18 415 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain 13 / Type A)
Q8XJ01 2.62e-08 61 25 7 212 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain 13 / Type A)
Q0SRL7 3.98e-40 162 34 18 416 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain SM101 / Type A)
Q0SRL7 1.73e-10 68 22 18 421 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain SM101 / Type A)
Q0TNZ8 5.49e-40 162 33 19 418 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ8 2.27e-08 61 25 9 243 3 pbpA Penicillin-binding protein 1A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A7GHV1 1.86e-39 160 33 11 331 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GHV1 5e-16 86 32 9 209 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7GHV1 1.11e-11 72 32 5 173 3 pbpA Penicillin-binding protein 1A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q891X1 2.21e-39 160 38 6 254 3 pbpA Penicillin-binding protein 1A Clostridium tetani (strain Massachusetts / E88)
Q891X1 1.62e-14 81 32 10 216 3 pbpA Penicillin-binding protein 1A Clostridium tetani (strain Massachusetts / E88)
Q891X1 3.89e-10 67 33 7 169 3 pbpA Penicillin-binding protein 1A Clostridium tetani (strain Massachusetts / E88)
Q89AR2 8.59e-37 152 34 5 267 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AR2 6.45e-15 82 28 2 191 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AR2 7.17e-06 53 27 6 145 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57296 1.3e-36 151 33 4 277 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57296 5.6e-15 83 26 2 199 3 mrcB Penicillin-binding protein 1B Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P40750 4.83e-36 148 33 1 240 1 pbpD Penicillin-binding protein 4 Bacillus subtilis (strain 168)
P40750 1.58e-08 62 23 7 221 1 pbpD Penicillin-binding protein 4 Bacillus subtilis (strain 168)
Q8DNB6 2.36e-35 147 32 5 292 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DNB6 4.38e-14 80 36 6 158 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZMF9 2.36e-35 147 32 5 292 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0A0H2ZMF9 4.38e-14 80 36 6 158 1 pbp2a Penicillin-binding protein 2a Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P02919 2.57e-35 148 38 3 244 1 mrcB Penicillin-binding protein 1B Escherichia coli (strain K12)
P02919 1.67e-15 84 26 5 273 1 mrcB Penicillin-binding protein 1B Escherichia coli (strain K12)
A0PZT1 1.99e-34 145 35 12 322 3 pbpA Penicillin-binding protein 1A Clostridium novyi (strain NT)
A0PZT1 4.5e-16 86 29 8 231 3 pbpA Penicillin-binding protein 1A Clostridium novyi (strain NT)
A0PZT1 2.75e-09 64 28 6 177 3 pbpA Penicillin-binding protein 1A Clostridium novyi (strain NT)
P76577 2.03e-33 141 37 5 224 1 pbpC Penicillin-binding protein 1C Escherichia coli (strain K12)
P76577 2.95e-07 58 30 5 160 1 pbpC Penicillin-binding protein 1C Escherichia coli (strain K12)
Q97GR5 3.05e-33 141 33 12 334 3 pbpA Penicillin-binding protein 1A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97GR5 9.11e-15 82 33 9 214 3 pbpA Penicillin-binding protein 1A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97GR5 3.21e-06 54 29 6 150 3 pbpA Penicillin-binding protein 1A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7A0I6 8.42e-31 125 35 2 191 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MW2)
A8YY46 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G860 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GFI3 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain MRSA252)
Q7A4S6 8.42e-31 125 35 2 191 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain N315)
Q99T05 8.42e-31 125 35 2 191 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QI56 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Newman)
Q5HEQ0 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain COL)
Q2YU13 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q93Q23 8.42e-31 125 35 2 191 1 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFM1 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain USA300)
A7X3Z2 8.42e-31 125 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q49YR9 3.48e-30 124 40 2 173 3 mgt Monofunctional glycosyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A5IU40 3.81e-30 123 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain JH9)
A6U2X8 3.81e-30 123 35 2 191 3 mgt Monofunctional glycosyltransferase Staphylococcus aureus (strain JH1)
Q8CNQ3 3.74e-29 120 35 2 182 3 mgt Monofunctional glycosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN60 3.74e-29 120 35 2 182 3 mgt Monofunctional glycosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L7I0 6.93e-29 120 30 5 252 3 mgt Monofunctional glycosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
P71707 4.88e-28 125 30 8 331 1 ponA1 Penicillin-binding protein 1A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P71707 1.83e-07 58 27 6 211 1 ponA1 Penicillin-binding protein 1A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0R7G2 2.03e-26 119 30 8 327 3 ponA1 Penicillin-binding protein 1A Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0R7G2 3.88e-07 57 25 4 213 3 ponA1 Penicillin-binding protein 1A Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2YBM4 3.58e-25 108 31 3 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q11VI0 1.62e-23 103 32 5 210 3 mtgA Biosynthetic peptidoglycan transglycosylase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
O24849 2.09e-22 100 38 0 134 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q12Q34 2.11e-22 100 41 1 143 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6VRW7 2.96e-22 99 40 2 155 3 mtgA Biosynthetic peptidoglycan transglycosylase Marinomonas sp. (strain MWYL1)
Q0AIQ0 6.26e-22 99 36 0 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3SFZ8 6.49e-22 99 36 1 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Thiobacillus denitrificans (strain ATCC 25259)
Q82U73 8.99e-22 98 35 0 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7NS41 1.73e-21 97 36 3 174 3 mtgA Biosynthetic peptidoglycan transglycosylase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q478U7 3.22e-21 96 38 4 159 3 mtgA Biosynthetic peptidoglycan transglycosylase Dechloromonas aromatica (strain RCB)
Q07X68 3.97e-21 96 40 1 143 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella frigidimarina (strain NCIMB 400)
A3M3C7 4.75e-21 96 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HVP6 7.65e-21 95 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain ACICU)
B0V9M4 8.42e-21 95 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AYE)
B7I8R1 8.42e-21 95 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AB0057)
B7GXW9 8.42e-21 95 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain AB307-0294)
B0VSQ2 8.58e-21 95 33 1 167 3 mtgA Biosynthetic peptidoglycan transglycosylase Acinetobacter baumannii (strain SDF)
Q3V7R3 1.32e-20 95 36 1 159 3 mtgA Biosynthetic peptidoglycan transglycosylase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C1D8R6 1.99e-20 94 30 3 209 3 mtgA Biosynthetic peptidoglycan transglycosylase Laribacter hongkongensis (strain HLHK9)
Q1GYH8 2.16e-20 94 33 4 187 3 mtgA Biosynthetic peptidoglycan transglycosylase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B3QBD2 2.88e-20 94 39 2 142 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain TIE-1)
Q6NCE7 2.88e-20 94 39 2 142 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8A8H2 9.53e-20 92 31 4 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q51005 1.07e-19 92 29 4 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae
Q5F6F6 1.07e-19 92 29 4 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1K3B8 1.26e-19 92 32 2 179 3 mtgA Biosynthetic peptidoglycan transglycosylase Azoarcus sp. (strain BH72)
B4RJ59 1.56e-19 92 29 4 232 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria gonorrhoeae (strain NCCP11945)
Q5P6J8 3.22e-19 90 34 2 173 3 mtgA Biosynthetic peptidoglycan transglycosylase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q89VU8 3.35e-19 90 42 1 135 3 mtgA Biosynthetic peptidoglycan transglycosylase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q11CS6 4.24e-19 90 39 1 141 3 mtgA Biosynthetic peptidoglycan transglycosylase Chelativorans sp. (strain BNC1)
B6IWJ6 6.59e-19 90 34 4 172 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q8ZLR7 9.59e-19 89 34 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T739 9.59e-19 89 34 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella newport (strain SL254)
Q13ED9 1.14e-18 89 37 2 139 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain BisB5)
B4TJQ1 1.68e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella heidelberg (strain SL476)
C0PZM1 1.73e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi C (strain RKS4594)
B5RES4 1.73e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R0J9 1.73e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella enteritidis PT4 (strain P125109)
Q57JE2 1.73e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella choleraesuis (strain SC-B67)
B4TWH8 1.94e-18 89 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella schwarzengrund (strain CVM19633)
Q8Z3G0 2.45e-18 88 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella typhi
A9N776 2.7e-18 88 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8AQ99 3e-18 88 33 3 174 3 mtgA Biosynthetic peptidoglycan transglycosylase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0VLR6 3.04e-18 88 40 0 130 3 mtgA Biosynthetic peptidoglycan transglycosylase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q87FR1 3.13e-18 87 30 4 231 3 mtgA Biosynthetic peptidoglycan transglycosylase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2J2T4 3.46e-18 87 34 3 172 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodopseudomonas palustris (strain HaA2)
Q9I6B7 3.67e-18 87 28 6 241 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5F6X7 3.87e-18 88 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella agona (strain SL483)
A6T2A4 5.89e-18 87 33 0 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Janthinobacterium sp. (strain Marseille)
Q3YX33 6.53e-18 87 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella sonnei (strain Ss046)
Q13U46 8.1e-18 87 33 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia xenovorans (strain LB400)
A4G8N2 8.14e-18 87 32 0 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Herminiimonas arsenicoxydans
B2SYS3 9.7e-18 87 31 0 161 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B7N364 1.01e-17 87 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O81 (strain ED1a)
Q1QQI5 1.01e-17 86 38 2 134 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
P44890 1.04e-17 87 37 0 138 3 mtgA Biosynthetic peptidoglycan transglycosylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B5BGN2 1.08e-17 86 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi A (strain AKU_12601)
Q3V7K4 1.08e-17 86 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P0A0Z4 1.23e-17 86 29 7 237 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9MNZ9 1.29e-17 86 31 1 174 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B1IQR5 1.38e-17 86 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A0Z3 1.42e-17 86 29 7 237 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q3V815 1.47e-17 86 33 7 194 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides fragilis (strain YCH46)
Q3V7G2 1.47e-17 86 33 7 194 3 mtgA Biosynthetic peptidoglycan transglycosylase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A9M2N3 1.8e-17 85 29 7 237 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup C (strain 053442)
B7NDJ2 1.85e-17 86 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q31W84 2.12e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella boydii serotype 4 (strain Sb227)
Q3SVC8 2.3e-17 85 38 2 134 3 mtgA Biosynthetic peptidoglycan transglycosylase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q32BC5 2.33e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Shigella dysenteriae serotype 1 (strain Sd197)
B7LHS1 2.33e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain 55989 / EAEC)
B2JH09 2.36e-17 85 33 0 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B6I1T1 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain SE11)
P46022 2.37e-17 85 32 1 176 1 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12)
A8A523 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O9:H4 (strain HS)
B1XHI3 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12 / DH10B)
C4ZSU7 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0S6 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O8 (strain IAI1)
A7ZSA7 2.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O139:H28 (strain E24377A / ETEC)
B5FIQ6 2.46e-17 85 33 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Salmonella dublin (strain CT_02021853)
Q1QYT5 3.25e-17 85 35 1 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B1LGH4 3.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain SMS-3-5 / SECEC)
B7NKS5 3.37e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R6C6 3.5e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli (strain UTI89 / UPEC)
Q8FD68 3.5e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCQ1 3.5e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGA9 3.5e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O1:K1 / APEC
B7MBX7 3.5e-17 85 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O45:K1 (strain S88 / ExPEC)
C6DIR2 4.84e-17 85 32 0 161 3 mtgA Biosynthetic peptidoglycan transglycosylase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A5UDP3 5.83e-17 84 31 4 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Haemophilus influenzae (strain PittEE)
B8GYX9 5.93e-17 84 36 1 136 3 mtgA Biosynthetic peptidoglycan transglycosylase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9ABA6 5.93e-17 84 36 1 136 3 mtgA Biosynthetic peptidoglycan transglycosylase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B5YSU1 9.03e-17 84 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9I1 9.03e-17 84 32 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O157:H7
B7UJU8 9.38e-17 84 31 1 176 3 mtgA Biosynthetic peptidoglycan transglycosylase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A0KK53 9.88e-17 84 35 3 160 3 mtgA Biosynthetic peptidoglycan transglycosylase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3V7N8 1.44e-16 83 31 0 161 3 mtgA Biosynthetic peptidoglycan transglycosylase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8EB02 1.6e-16 83 37 1 132 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87CI7 1.82e-16 83 37 1 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I5D0 1.82e-16 83 37 1 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain M23)
Q2KUU2 2.2e-16 82 36 2 158 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella avium (strain 197N)
Q9PCR3 2.22e-16 83 36 1 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain 9a5c)
A1KVS7 2.38e-16 82 29 7 237 3 mtgA Biosynthetic peptidoglycan transglycosylase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P69345 2.73e-16 80 33 3 162 3 mtgA Biosynthetic peptidoglycan transglycosylase (Fragment) Neisseria meningitidis
A4Y001 3.37e-16 82 36 1 134 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas mendocina (strain ymp)
B0U2V1 3.96e-16 82 37 1 140 3 mtgA Biosynthetic peptidoglycan transglycosylase Xylella fastidiosa (strain M12)
Q8P6V1 4.43e-16 82 36 1 136 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RQA5 4.43e-16 82 36 1 136 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain B100)
Q4UXB0 4.43e-16 82 36 1 136 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas campestris pv. campestris (strain 8004)
Q5H1V9 1.04e-15 81 34 2 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P4R3 1.04e-15 81 34 2 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7N087 1.33e-15 80 31 1 175 3 mtgA Biosynthetic peptidoglycan transglycosylase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4VRK8 1.59e-15 80 36 1 135 3 mtgA Biosynthetic peptidoglycan transglycosylase Stutzerimonas stutzeri (strain A1501)
A1S3J2 4.84e-15 79 34 3 173 3 mtgA Biosynthetic peptidoglycan transglycosylase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1IGD6 8.57e-15 78 35 1 135 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas entomophila (strain L48)
Q1BZB0 1.1e-14 78 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia orbicola (strain AU 1054)
A0K4E0 1.1e-14 78 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia cenocepacia (strain HI2424)
B1JVD0 1.2e-14 78 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia orbicola (strain MC0-3)
Q39JR9 1.21e-14 77 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BIE9 1.21e-14 77 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YSX5 1.23e-14 77 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia ambifaria (strain MC40-6)
Q2SZD0 1.78e-14 77 33 0 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q4K4C2 1.91e-14 77 31 1 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8PI51 2.23e-14 77 38 1 124 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas axonopodis pv. citri (strain 306)
A4JBE7 2.34e-14 77 32 0 157 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q3BQP8 2.39e-14 77 38 1 124 3 mtgA Biosynthetic peptidoglycan transglycosylase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q48CL6 2.69e-14 76 30 1 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q98FG8 3.25e-14 76 33 2 155 3 mtgA Biosynthetic peptidoglycan transglycosylase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A9AI31 3.44e-14 76 33 0 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia multivorans (strain ATCC 17616 / 249)
Q4ZM52 3.68e-14 76 30 1 159 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas syringae pv. syringae (strain B728a)
Q7W039 4.09e-14 76 35 5 169 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3V2 4.09e-14 76 35 5 169 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF82 4.09e-14 76 35 5 169 3 mtgA Biosynthetic peptidoglycan transglycosylase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B1J2G5 5.52e-14 75 37 1 126 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain W619)
B0KN61 5.9e-14 75 36 1 130 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain GB-1)
Q48465 6.62e-14 75 38 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Klebsiella oxytoca
Q65S86 6.79e-14 75 36 1 138 3 mtgA Biosynthetic peptidoglycan transglycosylase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q63QP9 6.95e-14 75 32 0 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia pseudomallei (strain K96243)
Q8FYT4 8.42e-14 75 34 2 143 3 mtgA Biosynthetic peptidoglycan transglycosylase Brucella suis biovar 1 (strain 1330)
Q3V7M0 9.74e-14 75 32 0 152 3 mtgA Biosynthetic peptidoglycan transglycosylase Burkholderia mallei (strain ATCC 23344)
Q3K584 1.09e-13 75 27 4 212 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain Pf0-1)
C3K3M0 1.16e-13 75 29 3 178 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas fluorescens (strain SBW25)
Q88CS3 1.16e-13 74 29 5 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WAE0 1.24e-13 74 29 5 200 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1LIV1 1.27e-13 74 36 0 123 3 mtgA Biosynthetic peptidoglycan transglycosylase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8YJ15 1.75e-13 73 33 2 143 3 mtgA Biosynthetic peptidoglycan transglycosylase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q88AF9 1.83e-13 74 30 1 149 3 mtgA Biosynthetic peptidoglycan transglycosylase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A7MJD8 2.78e-13 73 38 1 118 3 mtgA Biosynthetic peptidoglycan transglycosylase Cronobacter sakazakii (strain ATCC BAA-894)
B5ZU97 3.39e-13 73 30 4 199 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q8XVQ4 4.62e-13 73 34 0 123 3 mtgA Biosynthetic peptidoglycan transglycosylase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A7FDY6 7.25e-13 72 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q2RYG3 7.96e-13 72 36 1 130 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q46XB8 1.07e-12 72 29 5 193 3 mtgA Biosynthetic peptidoglycan transglycosylase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q92L23 1.17e-12 72 33 4 161 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium meliloti (strain 1021)
A1JR77 1.26e-12 72 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JL77 2.3e-12 71 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q3V7N9 2.53e-12 71 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3Y6 2.53e-12 71 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4THK0 2.7e-12 70 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis (strain Pestoides F)
Q1CE18 2.7e-12 70 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1R0 2.7e-12 70 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZB72 2.7e-12 70 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis
Q1C1G0 2.7e-12 70 37 0 116 3 mtgA Biosynthetic peptidoglycan transglycosylase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8UBX8 5.19e-12 69 32 5 175 3 mtgA Biosynthetic peptidoglycan transglycosylase Agrobacterium fabrum (strain C58 / ATCC 33970)
B3PR74 5.68e-12 69 29 4 198 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium etli (strain CIAT 652)
Q2K330 6.12e-12 69 31 2 145 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9CNV0 1.78e-10 65 35 1 122 3 mtgA Biosynthetic peptidoglycan transglycosylase Pasteurella multocida (strain Pm70)
Q28VR9 3.66e-10 64 29 1 148 3 mtgA Biosynthetic peptidoglycan transglycosylase Jannaschia sp. (strain CCS1)
Q1MAC8 4.85e-10 64 30 1 132 3 mtgA Biosynthetic peptidoglycan transglycosylase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P14677 9.1e-05 50 30 5 163 1 pbpX Penicillin-binding protein 2x Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P54488 0.000125 49 23 12 232 1 pbpA Penicillin-binding protein 2A Bacillus subtilis (strain 168)
P59676 0.000144 49 30 5 163 1 pbpX Penicillin-binding protein 2X Streptococcus pneumoniae (strain ATCC BAA-255 / R6)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14945
Feature type CDS
Gene mrcA
Product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA
Location 3317025 - 3319559 (strand: -1)
Length 2535 (nucleotides) / 844 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1593
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00905 Penicillin binding protein transpeptidase domain
PF00912 Transglycosylase
PF17092 Penicillin-binding protein OB-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5009 Cell wall/membrane/envelope biogenesis (M) M Membrane carboxypeptidase/penicillin-binding protein

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05366 penicillin-binding protein 1A [EC:2.4.99.28 3.4.16.4] Peptidoglycan biosynthesis
Metabolic pathways
beta-Lactam resistance		 -

Protein Sequence

MKFLKYFFIFVFACIILGAASIYGMYKYVEPQLPDVATLKDVRLQTPMQVFSADGELMAQYGEKRRLPLTLQEMPPQLINAFIATEDTRFREHHGIDPIGISRAVVVALTSGQASQGASTITQQLARNFFLTPEKKLMRKIKEAFLAIRIEKELTKDEILALYLNKIYLGNRAYGVGAAAYVYFGKSVHDLSLSEMAVIAGLPKAPSTLNPLYSYDRALKRRNLVLQRMLEENYITREEYDSAKAEPIVAKYHAPQIDFSAPYLTEMVRMEMYQRYGENAYTDGYKIYTTVIRKDQLAAEQALRNNVIDYDMRHGYRGAQEVLWHAGQTPWDDKAINDKLKGIQTYGPLIPAVVLSADAKEAQVVLKNGDKITLDLKAVRWARKFISDTAQGATPSKVDAVVHAGEQIWVRQNSENDWLLAQLPEVNAAFVALDPLNGGIIALVGGFDFELSKFNRVSQSLRQVGSNIKPFLYAAALDKGLTLSTLLNDLPISRWDAGAGTDWRPKNSPPTYAGPIRLRQGLGQSKNVVMVRAMRAMGVDYAADYLLRFGFPNQNIDRTESLALGSPSFTPMQMARGFAVMANGGYLIEPYFIQRIENADGEVIFTAEPKVACPECTDIPVIYGDTTRSIALSDDYMENVAQSQQAQPAETAPDIELEQAPLAETVKESPYAPHVISTPLAFLMHDALRTNLVGEPGWSGTGWRALRDLKRQDIGGKTGTTNSSKDAWFSGYGANIVATAWIGFDDSSRNLGRTAATGGEAGAKTAQPIWNDFMKVALEGVPVQMMPMPKGVVAVQIDRNTGKLAGDGPSMKEYFIEGTQPTEKAKSEVGTRIFEDNGESNELF

Flanking regions ( +/- flanking 50bp)

GCACTGTTTGTTTATAAACTGCCCAATTCACATTACATGGGAAATTTAAGGTGAAGTTCTTAAAATATTTTTTCATCTTCGTTTTTGCTTGCATAATTTTGGGAGCAGCCTCGATATATGGCATGTATAAATATGTCGAGCCTCAACTACCCGATGTCGCGACATTAAAAGATGTTCGTTTACAAACTCCTATGCAGGTCTTTAGCGCAGACGGAGAGTTAATGGCGCAATATGGCGAAAAACGTCGTTTGCCTCTTACCTTGCAGGAGATGCCTCCGCAATTAATTAATGCCTTTATTGCCACTGAAGATACGCGTTTTCGTGAACATCATGGTATTGACCCTATTGGCATCTCTCGTGCTGTTGTTGTTGCGTTAACATCGGGGCAAGCATCGCAAGGTGCCAGTACCATCACGCAACAATTAGCGCGTAATTTCTTCTTAACACCTGAGAAGAAATTAATGCGTAAAATCAAAGAAGCCTTTTTGGCTATCCGTATTGAGAAAGAGCTTACTAAAGATGAGATCTTGGCACTTTATCTCAATAAAATTTATCTAGGAAATCGCGCTTATGGTGTGGGTGCTGCTGCATATGTTTACTTTGGTAAAAGTGTGCATGATCTTAGCTTAAGTGAGATGGCTGTTATTGCAGGTTTACCTAAAGCCCCTTCGACACTAAACCCACTTTATTCGTATGATCGTGCCTTAAAACGCCGTAATTTAGTGTTACAACGCATGTTGGAAGAGAACTATATTACCCGCGAAGAGTATGACAGTGCTAAAGCTGAGCCTATTGTGGCTAAATATCACGCCCCACAAATTGATTTTTCAGCGCCTTATTTGACTGAAATGGTCAGAATGGAGATGTATCAGCGCTATGGCGAAAATGCCTATACGGATGGTTATAAAATTTACACTACAGTTATCCGCAAAGATCAATTAGCCGCTGAACAAGCGCTACGTAATAATGTTATTGATTATGATATGCGCCATGGCTATCGCGGTGCTCAAGAGGTGCTGTGGCATGCAGGGCAAACTCCTTGGGATGATAAAGCCATTAACGATAAGCTAAAGGGTATACAGACTTATGGCCCATTAATCCCCGCAGTGGTGTTATCCGCTGATGCTAAAGAAGCTCAGGTGGTATTAAAAAATGGCGATAAAATAACACTCGATTTAAAAGCGGTTCGTTGGGCGCGTAAATTTATTTCTGATACGGCTCAAGGGGCCACGCCGAGCAAAGTTGATGCTGTTGTACATGCTGGTGAGCAAATTTGGGTACGACAAAATAGTGAAAACGATTGGTTATTAGCACAGCTTCCTGAGGTTAATGCAGCTTTTGTCGCATTAGATCCACTTAATGGCGGTATTATTGCGCTGGTGGGAGGTTTTGATTTTGAATTGAGTAAGTTTAATCGCGTATCTCAATCGTTACGTCAAGTTGGTTCAAATATCAAACCTTTCTTATATGCGGCAGCATTAGATAAAGGGTTAACATTATCGACATTACTAAATGACTTACCTATTAGTCGTTGGGATGCGGGAGCTGGAACTGATTGGCGCCCTAAAAACTCACCACCTACTTATGCAGGGCCTATTCGTTTACGTCAAGGTTTAGGTCAATCTAAAAACGTAGTTATGGTGCGCGCTATGCGGGCGATGGGGGTTGATTACGCTGCAGATTATCTATTGCGTTTTGGTTTTCCTAATCAAAATATAGATAGAACAGAGTCATTAGCTTTAGGCTCACCTTCATTTACACCAATGCAAATGGCTCGAGGTTTTGCGGTAATGGCAAATGGTGGGTATCTCATTGAGCCATATTTTATTCAGCGTATTGAAAATGCTGATGGTGAAGTGATCTTTACTGCTGAGCCGAAAGTCGCTTGTCCTGAATGTACCGATATCCCCGTGATTTATGGTGATACTACGCGCTCTATTGCATTATCTGATGATTATATGGAAAACGTCGCACAATCTCAGCAAGCGCAACCGGCAGAAACGGCGCCTGATATTGAGTTAGAGCAAGCACCTCTTGCTGAAACAGTCAAAGAAAGCCCATATGCTCCTCATGTGATAAGTACGCCACTGGCGTTTCTAATGCATGATGCGTTAAGAACCAATCTCGTTGGTGAGCCGGGATGGTCTGGTACAGGATGGCGTGCATTGCGAGATTTAAAACGTCAAGATATCGGTGGTAAGACAGGAACGACCAATAGCTCTAAAGATGCTTGGTTCTCTGGATATGGTGCTAATATTGTGGCGACTGCATGGATTGGTTTTGATGATAGTAGTCGCAATTTAGGGCGAACTGCCGCAACGGGTGGTGAAGCGGGTGCCAAAACGGCACAACCTATTTGGAATGACTTTATGAAAGTTGCTTTAGAAGGTGTTCCGGTACAAATGATGCCGATGCCAAAAGGCGTTGTTGCTGTTCAAATCGATCGCAATACCGGTAAGTTGGCGGGAGATGGACCATCAATGAAAGAGTATTTTATTGAAGGCACTCAGCCAACAGAAAAAGCAAAAAGTGAAGTGGGTACACGGATCTTTGAGGATAATGGCGAATCTAACGAGCTATTTTGATTAATATAATAAACAAAAAGTTAGATTAAATAGCGATCTAACGAATAACT