Homologs in group_392

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15020 FBDBKF_15020 28.1 Morganella morganii S1 ceuA ABC-type enterochelin transport system, periplasmic component
EHELCC_11225 EHELCC_11225 28.1 Morganella morganii S2 ceuA ABC-type enterochelin transport system, periplasmic component
NLDBIP_11570 NLDBIP_11570 28.1 Morganella morganii S4 ceuA ABC-type enterochelin transport system, periplasmic component
LHKJJB_11430 LHKJJB_11430 28.1 Morganella morganii S3 ceuA ABC-type enterochelin transport system, periplasmic component
HKOGLL_10040 HKOGLL_10040 28.1 Morganella morganii S5 ceuA ABC-type enterochelin transport system, periplasmic component
F4V73_RS12430 F4V73_RS12430 28.1 Morganella psychrotolerans - ABC transporter substrate-binding protein
PMI_RS01580 PMI_RS01580 31.0 Proteus mirabilis HI4320 - siderophore ABC transporter substrate-binding protein

Distribution of the homologs in the orthogroup group_392

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_392

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P94421 7.06e-68 218 36 8 321 1 yclQ Petrobactin-binding protein YclQ Bacillus subtilis (strain 168)
P11460 4.89e-57 190 34 7 319 1 fatB Ferric-anguibactin-binding protein FatB Vibrio anguillarum (strain ATCC 68554 / 775)
O34348 1.58e-23 101 29 8 247 2 yfmC Fe(3+)-citrate-binding protein YfmC Bacillus subtilis (strain 168)
O31567 5.85e-19 89 25 8 329 1 yfiY Probable siderophore-binding lipoprotein YfiY Bacillus subtilis (strain 168)
Q81L65 2.76e-16 81 32 3 193 1 fpuA Petrobactin-binding protein FpuA Bacillus anthracis
C0SP94 2.75e-14 75 23 13 316 1 yhfQ Putative ABC transporter substrate-binding lipoprotein YhfQ Bacillus subtilis (strain 168)
Q845T3 3.88e-14 75 31 2 158 1 vatD Ferric aerobactin-binding protein VatD Vibrio vulnificus
P37580 5e-12 68 30 4 159 1 fhuD Iron(3+)-hydroxamate-binding protein FhuD Bacillus subtilis (strain 168)
P0AEL6 1.74e-08 58 25 6 196 1 fepB Ferric enterobactin-binding periplasmic protein FepB Escherichia coli (strain K12)
P0AEL7 1.74e-08 58 25 6 196 3 fepB Ferric enterobactin-binding periplasmic protein FepB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P15028 2.77e-08 57 21 6 260 1 fecB Fe(3+) dicitrate-binding periplasmic protein FecB Escherichia coli (strain K12)
P40409 0.000198 46 24 10 289 1 feuA Iron-uptake system-binding protein Bacillus subtilis (strain 168)
P54941 0.00039 45 26 6 140 1 yxeB Iron(3+)-hydroxamate-binding protein YxeB Bacillus subtilis (strain 168)
O34805 0.000718 44 25 11 252 3 yvrC Uncharacterized ABC transporter substrate-binding lipoprotein YvrC Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14620
Feature type CDS
Gene -
Product siderophore ABC transporter substrate-binding protein
Location 3240142 - 3241101 (strand: 1)
Length 960 (nucleotides) / 319 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_392
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF01497 Periplasmic binding protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4607 Inorganic ion transport and metabolism (P) P ABC-type enterochelin transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K25282 iron-siderophore transport system substrate-binding protein - -

Protein Sequence

MFKKSLSPLFLLLSSLVIAGCDNAQDTSTTQSTEKQTLTIEHAQGTTEIPAHPQKVVVMNMETLDIIDALGVPVVGLPQTNVHLPKFLEKYTNENEYINEGGLFEPNYEKLSTTAPDLILTGSRARDAYAKLSEIAPSISMDIDSTRFIDSLTERTTTLGQIFGKEEQAKKLLADFNSKIDTVKAKTPDAGKAMVVLVSGGKISAYGPGSRFGFIYDVLGFEPAYTFDSPGSHGNIVNSELLLKLNPDWMFVIDRDAAIGREDSQPAKQVLDNALVRKVNAWNKDQIIYLDASSIYISGGIQTYSRLMDTINQALDQKK

Flanking regions ( +/- flanking 50bp)

CACAGCTAGTAAACTGTGCTATTTCATATCGCAACAATATGGGAAAGAGAATGTTTAAAAAATCATTAAGCCCACTGTTCTTATTGCTGTCTTCTCTGGTTATCGCAGGTTGTGATAACGCACAAGATACCTCAACAACGCAATCCACAGAGAAACAAACTCTCACTATCGAACATGCTCAAGGCACCACTGAGATCCCTGCTCACCCACAAAAAGTGGTTGTGATGAACATGGAAACACTTGATATTATTGATGCTCTTGGCGTACCTGTTGTTGGCCTACCACAAACAAACGTCCACTTACCTAAATTTCTAGAGAAATACACCAACGAAAATGAGTACATCAACGAAGGTGGCCTGTTTGAACCAAACTACGAAAAACTCAGTACTACTGCCCCTGATCTGATTTTAACGGGTAGTCGTGCTCGCGATGCATATGCCAAATTAAGTGAAATCGCACCATCCATTTCTATGGATATCGACAGCACACGCTTTATTGACAGCCTCACTGAGCGTACAACGACTTTAGGTCAAATTTTTGGTAAAGAAGAACAAGCTAAAAAATTATTAGCTGACTTCAATAGCAAAATTGATACGGTAAAAGCAAAAACCCCAGATGCGGGTAAAGCAATGGTCGTATTAGTCAGTGGCGGTAAAATTTCCGCTTATGGCCCAGGCTCTCGCTTTGGTTTTATCTACGATGTATTGGGCTTTGAACCTGCATATACTTTCGATAGCCCAGGCTCTCACGGTAATATTGTTAACTCAGAACTACTGCTAAAACTTAATCCAGACTGGATGTTTGTCATTGACCGTGATGCAGCAATTGGTCGTGAAGATTCACAACCTGCAAAACAAGTGCTTGATAATGCCCTAGTTAGAAAGGTTAATGCATGGAATAAAGACCAAATTATCTATCTTGATGCCAGCTCGATTTATATCTCAGGTGGGATACAAACTTACTCTCGCTTAATGGATACAATTAATCAGGCGTTGGATCAAAAAAAATAAAGTAACTGAATGAAAACGTTCCATTTATCATTGGGGATAGGACTTATCGC