Homologs in group_1629

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10730 FBDBKF_10730 80.2 Morganella morganii S1 tex Transcriptional accessory protein Tex/SPT6
EHELCC_15065 EHELCC_15065 80.2 Morganella morganii S2 tex Transcriptional accessory protein Tex/SPT6
NLDBIP_14895 NLDBIP_14895 80.2 Morganella morganii S4 tex Transcriptional accessory protein Tex/SPT6
LHKJJB_14450 LHKJJB_14450 80.2 Morganella morganii S3 tex Transcriptional accessory protein Tex/SPT6
HKOGLL_13070 HKOGLL_13070 80.2 Morganella morganii S5 tex Transcriptional accessory protein Tex/SPT6
F4V73_RS14445 F4V73_RS14445 78.8 Morganella psychrotolerans - Tex family protein

Distribution of the homologs in the orthogroup group_1629

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1629

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P46837 0.0 1222 77 1 777 1 yhgF Protein YhgF Escherichia coli (strain K12)
P71353 0.0 1140 71 1 770 4 HI_0568 Uncharacterized protein HI_0568 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51152 0.0 910 59 5 767 4 NMB0075 Uncharacterized protein NMB0075 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q51062 0.0 910 60 5 767 4 tex Transcriptional accessory protein Tex Neisseria gonorrhoeae
P57072 0.0 906 59 5 767 4 NMA0194 Uncharacterized protein NMA0194 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q45388 0.0 885 58 6 775 4 tex Protein tex Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O31489 0.0 546 44 11 728 4 ydcI Uncharacterized protein YdcI Bacillus subtilis (strain 168)
Q5RDI0 2.07e-138 436 34 17 802 2 SRBD1 S1 RNA-binding domain-containing protein 1 Pongo abelii
Q8N5C6 4.55e-136 430 34 16 801 1 SRBD1 S1 RNA-binding domain-containing protein 1 Homo sapiens
Q497V5 7.72e-135 427 35 19 799 2 Srbd1 S1 RNA-binding domain-containing protein 1 Mus musculus
Q8NIV6 7.27e-20 99 23 24 593 3 spt-6 Transcription elongation factor spt-6 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4WWH6 2.73e-17 90 30 14 327 3 spt6 Transcription elongation factor spt6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2U561 7.88e-17 89 27 14 365 3 spt6 Transcription elongation factor spt6 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q62383 3.34e-16 87 22 23 712 1 Supt6h Transcription elongation factor SPT6 Mus musculus
Q7KZ85 3.92e-16 87 21 24 710 1 SUPT6H Transcription elongation factor SPT6 Homo sapiens
Q4HYQ4 5.15e-16 86 26 10 360 3 SPT6 Transcription elongation factor SPT6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9W420 7.42e-16 86 22 12 434 1 Spt6 Transcription elongation factor SPT6 Drosophila melanogaster
Q8UVK2 1.16e-15 85 23 10 404 1 supt6h Transcription elongation factor SPT6 Danio rerio
A8MS85 2.21e-15 84 22 27 716 1 SPT6 Transcription elongation factor SPT6 homolog Arabidopsis thaliana
Q9SZD6 3.59e-15 83 40 3 130 1 PETs Polyprotein of EF-Ts, chloroplastic Arabidopsis thaliana
Q93148 3.23e-14 80 31 6 218 2 emb-5 Suppressor of Ty 6 homolog Caenorhabditis briggsae
P9WH43 9.07e-14 78 47 1 78 1 rpsA Small ribosomal subunit protein bS1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH43 9.55e-11 68 35 3 128 1 rpsA Small ribosomal subunit protein bS1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH42 9.07e-14 78 47 1 78 3 rpsA Small ribosomal subunit protein bS1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WH42 9.55e-11 68 35 3 128 3 rpsA Small ribosomal subunit protein bS1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0CR73 1.83e-13 78 24 10 344 3 SPT6 Transcription elongation factor SPT6 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CR72 1.88e-13 78 24 10 344 3 SPT6 Transcription elongation factor SPT6 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
A0QYY6 2.04e-13 77 47 1 78 1 rpsA Small ribosomal subunit protein bS1 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QYY6 1.95e-11 70 35 3 128 1 rpsA Small ribosomal subunit protein bS1 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q09915 5.22e-13 77 20 21 677 1 spt6 Transcription elongation factor spt6 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P46836 6.11e-13 75 46 1 78 1 rpsA Small ribosomal subunit protein bS1 Mycobacterium leprae (strain TN)
P46836 9.07e-11 68 48 0 70 1 rpsA Small ribosomal subunit protein bS1 Mycobacterium leprae (strain TN)
Q5B7Q7 6.2e-13 76 26 14 375 3 spt6 Transcription elongation factor spt6 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P50889 1.69e-12 73 44 0 78 2 rps1 Small ribosomal subunit protein bS1 Leuconostoc lactis
P50889 3.17e-10 66 46 1 73 2 rps1 Small ribosomal subunit protein bS1 Leuconostoc lactis
P34703 2.69e-12 74 28 8 261 1 emb-5 Suppressor of Ty 6 homolog Caenorhabditis elegans
P38494 3.73e-12 72 46 2 93 1 ypfD Small ribosomal subunit protein bS1 homolog Bacillus subtilis (strain 168)
P38494 5.48e-12 72 52 1 78 1 ypfD Small ribosomal subunit protein bS1 homolog Bacillus subtilis (strain 168)
A0LE14 8.31e-12 72 51 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q9CAM1 8.84e-12 72 21 30 853 1 At1g63210 Transcription elongation factor SPT6-like Arabidopsis thaliana
Q6FLB1 1.23e-11 72 26 6 231 1 SPT6 Transcription elongation factor SPT6 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A8J637 1.36e-11 72 46 0 76 1 PETs Polyprotein of EF-Ts, chloroplastic Chlamydomonas reinhardtii
O06000 1.45e-11 70 48 1 78 3 rpsA Small ribosomal subunit protein bS1 homolog Bacillus cereus (strain ATCC 10987 / NRS 248)
O06000 6.07e-10 65 46 0 71 3 rpsA Small ribosomal subunit protein bS1 homolog Bacillus cereus (strain ATCC 10987 / NRS 248)
Q49XT0 3.84e-11 69 47 1 78 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q49XT0 1.99e-09 63 39 1 94 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2QP54 8.4e-11 69 36 3 121 2 PETs Polyprotein of EF-Ts, chloroplastic Oryza sativa subsp. japonica
A2ZLC1 8.4e-11 69 36 3 121 3 PETs Polyprotein of EF-Ts, chloroplastic Oryza sativa subsp. indica
B4SQR6 2.32e-10 67 50 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q8CWR9 2.5e-10 67 40 2 95 1 rpsA Small ribosomal subunit protein bS1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8CWR9 1.78e-06 54 36 1 73 1 rpsA Small ribosomal subunit protein bS1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q3MNT0 2.73e-10 68 24 10 290 3 SPT6 Transcription elongation factor SPT6 Candida albicans (strain SC5314 / ATCC MYA-2876)
B2FN86 2.8e-10 67 50 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Stenotrophomonas maltophilia (strain K279a)
P14128 7.04e-10 65 37 1 91 3 rpsA Small ribosomal subunit protein bS1 (Fragment) Providencia sp.
P0AG70 9.76e-10 65 37 1 91 3 rpsA Small ribosomal subunit protein bS1 Shigella flexneri
P0AG67 9.76e-10 65 37 1 91 1 rpsA Small ribosomal subunit protein bS1 Escherichia coli (strain K12)
P0AG68 9.76e-10 65 37 1 91 3 rpsA Small ribosomal subunit protein bS1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AG69 9.76e-10 65 37 1 91 3 rpsA Small ribosomal subunit protein bS1 Escherichia coli O157:H7
P37985 1.1e-09 65 37 1 91 3 rpsA Small ribosomal subunit protein bS1 Dickeya dadantii (strain 3937)
P37985 0.000543 47 35 2 88 3 rpsA Small ribosomal subunit protein bS1 Dickeya dadantii (strain 3937)
Q2NBZ2 1.18e-09 65 47 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Erythrobacter litoralis (strain HTCC2594)
P23615 1.62e-09 65 26 6 223 1 SPT6 Transcription elongation factor SPT6 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2G5F5 1.69e-09 65 47 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
C4L8X0 2.08e-09 64 48 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B8GP06 2.34e-09 64 48 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
P37560 2.67e-09 59 44 1 70 3 yabR Uncharacterized protein YabR Bacillus subtilis (strain 168)
Q0A7A1 2.81e-09 64 48 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q97I09 2.83e-09 64 47 2 76 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97I09 3.31e-06 54 38 0 70 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q48082 2.84e-09 63 41 1 78 3 rpsA Small ribosomal subunit protein bS1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q48082 1.28e-06 55 43 2 69 3 rpsA Small ribosomal subunit protein bS1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1RJH1 2.91e-09 64 42 1 78 3 rpsA Small ribosomal subunit protein bS1 Rickettsia bellii (strain RML369-C)
Q9JZ44 2.94e-09 63 40 1 76 1 rpsA Small ribosomal subunit protein bS1 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JZ44 3.89e-07 57 44 2 72 1 rpsA Small ribosomal subunit protein bS1 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P57395 3.06e-09 63 35 1 91 3 rpsA Small ribosomal subunit protein bS1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q4L6I1 3.52e-09 63 46 1 76 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus haemolyticus (strain JCSC1435)
Q4L6I1 1.15e-05 52 38 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus haemolyticus (strain JCSC1435)
Q89AJ3 4.53e-09 63 41 1 73 3 rpsA Small ribosomal subunit protein bS1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ3 3.35e-05 51 36 2 69 3 rpsA Small ribosomal subunit protein bS1 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1GVQ8 5.54e-09 63 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B8CW78 5.77e-09 63 50 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B3PIA0 5.89e-09 63 47 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Cellvibrio japonicus (strain Ueda107)
Q4FVL0 6.37e-09 63 50 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4ULF1 7.24e-09 62 41 1 78 3 rpsA Small ribosomal subunit protein bS1 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q83E09 7.44e-09 62 37 1 91 1 rpsA Small ribosomal subunit protein bS1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83E09 8.41e-06 53 33 3 104 1 rpsA Small ribosomal subunit protein bS1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P80870 7.5e-09 58 38 0 77 1 yugI General stress protein 13 Bacillus subtilis (strain 168)
Q92HM4 7.89e-09 62 41 1 78 3 rpsA Small ribosomal subunit protein bS1 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8F1P3 8.02e-09 62 35 3 112 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia massiliae (strain Mtu5)
Q6NDP1 8.06e-09 62 38 1 78 1 rpsA Small ribosomal subunit protein bS1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NDP1 3.81e-05 50 40 1 66 1 rpsA Small ribosomal subunit protein bS1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NDP1 0.000533 47 39 1 71 1 rpsA Small ribosomal subunit protein bS1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0VSR7 8.36e-09 62 50 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A7IC03 8.72e-09 62 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B8EP09 8.76e-09 62 49 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
P14129 9.06e-09 62 37 1 78 3 rpsA Small ribosomal subunit protein bS1 Rhizobium meliloti (strain 1021)
P14129 0.000271 48 32 2 94 3 rpsA Small ribosomal subunit protein bS1 Rhizobium meliloti (strain 1021)
Q1QEN9 9.45e-09 62 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B0RRB8 1.07e-08 62 46 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas campestris pv. campestris (strain B100)
C4K3E6 1.07e-08 62 37 3 116 3 pnp Polyribonucleotide nucleotidyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q3ZXV6 1.08e-08 62 44 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Dehalococcoides mccartyi (strain CBDB1)
Q3BRP9 1.1e-08 62 44 1 81 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8P7V1 1.11e-08 62 46 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UW98 1.11e-08 62 46 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas campestris pv. campestris (strain 8004)
A5FQT2 1.11e-08 62 44 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q609C6 1.19e-08 62 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8PJ59 1.21e-08 62 44 1 81 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q5GXV3 1.3e-08 62 44 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SVJ9 1.3e-08 62 44 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P0X5 1.3e-08 62 44 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q44653 1.33e-08 62 35 1 91 3 rpsA Small ribosomal subunit protein bS1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q44653 8.4e-06 53 40 2 72 3 rpsA Small ribosomal subunit protein bS1 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B0UEX5 1.35e-08 62 37 2 114 3 pnp Polyribonucleotide nucleotidyltransferase Methylobacterium sp. (strain 4-46)
Q87EV0 1.35e-08 62 44 2 86 3 pnp Polyribonucleotide nucleotidyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I730 1.35e-08 62 44 2 86 3 pnp Polyribonucleotide nucleotidyltransferase Xylella fastidiosa (strain M23)
Q75EP8 1.36e-08 62 25 7 227 3 SPT6 Transcription elongation factor SPT6 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
B0U1R2 1.4e-08 62 44 2 86 3 pnp Polyribonucleotide nucleotidyltransferase Xylella fastidiosa (strain M12)
B2ICY4 1.48e-08 62 50 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A4YJF3 1.5e-08 62 49 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Bradyrhizobium sp. (strain ORS 278)
Q9PGQ9 1.53e-08 62 44 2 86 3 pnp Polyribonucleotide nucleotidyltransferase Xylella fastidiosa (strain 9a5c)
B1LZQ1 1.54e-08 62 38 1 99 3 pnp Polyribonucleotide nucleotidyltransferase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B0T175 1.56e-08 62 39 2 91 3 pnp Polyribonucleotide nucleotidyltransferase Caulobacter sp. (strain K31)
Q2VZQ4 1.63e-08 62 42 1 95 3 pnp Polyribonucleotide nucleotidyltransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A4SJR9 1.65e-08 62 48 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Aeromonas salmonicida (strain A449)
B8IGX3 1.74e-08 62 36 2 114 3 pnp Polyribonucleotide nucleotidyltransferase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A5E870 1.76e-08 62 50 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A0KND9 1.86e-08 61 48 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q68WL4 2.06e-08 61 41 1 78 3 rpsA Small ribosomal subunit protein bS1 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q5FQL9 2.84e-08 61 45 1 79 3 pnp Polyribonucleotide nucleotidyltransferase Gluconobacter oxydans (strain 621H)
Q2J2J4 3.07e-08 60 40 1 97 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain HaA2)
Q9HZ71 3.98e-08 60 38 1 76 3 rpsA Small ribosomal subunit protein bS1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZ71 1.17e-05 52 33 4 101 3 rpsA Small ribosomal subunit protein bS1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZD43 4.08e-08 60 33 3 121 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia prowazekii (strain Madrid E)
A8IGA3 4.28e-08 60 40 1 92 3 pnp Polyribonucleotide nucleotidyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q057K3 4.68e-08 60 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q16CF6 4.74e-08 60 36 1 88 3 pnp Polyribonucleotide nucleotidyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B8D7R0 5.06e-08 60 49 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57454 5.06e-08 60 49 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9F8 5.06e-08 60 49 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q5QYE1 5.74e-08 60 44 1 69 3 pnp Polyribonucleotide nucleotidyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q67P77 6.28e-08 60 50 0 65 3 pnp Polyribonucleotide nucleotidyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A4XYD6 6.98e-08 59 50 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas mendocina (strain ymp)
P73530 7.1e-08 58 36 1 76 3 rps1A Small ribosomal subunit protein bS1A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5HP69 7.18e-08 59 41 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HP69 1.72e-06 54 46 1 76 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B3QAB0 7.58e-08 59 39 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain TIE-1)
Q6NCN8 7.71e-08 59 39 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q9KNY1 8.3e-08 59 35 6 139 3 rnr Ribonuclease R Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5GRD7 8.32e-08 59 46 2 80 3 pnp Polyribonucleotide nucleotidyltransferase Synechococcus sp. (strain RCC307)
Q47D98 9.11e-08 59 41 2 91 3 pnp Polyribonucleotide nucleotidyltransferase Dechloromonas aromatica (strain RCB)
Q1QS60 9.22e-08 59 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B4F2C3 9.23e-08 59 47 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Proteus mirabilis (strain HI4320)
B6J0K5 9.31e-08 59 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Coxiella burnetii (strain CbuG_Q212)
C4K0F4 9.47e-08 59 34 3 115 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia peacockii (strain Rustic)
A5FVG2 9.53e-08 59 42 1 83 3 pnp Polyribonucleotide nucleotidyltransferase Acidiphilium cryptum (strain JF-5)
B6J6S7 9.63e-08 59 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Coxiella burnetii (strain CbuK_Q154)
Q5NQ32 9.63e-08 59 41 2 84 3 pnp Polyribonucleotide nucleotidyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q3J9C0 9.71e-08 59 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
C3PNK2 9.72e-08 59 34 3 115 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia africae (strain ESF-5)
B6IVG3 1.02e-07 59 47 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
C5BFC1 1.03e-07 59 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Edwardsiella ictaluri (strain 93-146)
Q4PI89 1.03e-07 59 29 5 174 3 SPT6 Transcription elongation factor SPT6 Ustilago maydis (strain 521 / FGSC 9021)
Q83D87 1.03e-07 59 41 1 70 1 pnp Polyribonucleotide nucleotidyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9ND62 1.03e-07 59 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFK6 1.03e-07 59 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Coxiella burnetii (strain Dugway 5J108-111)
C0QHM6 1.04e-07 59 51 0 58 3 pnp Polyribonucleotide nucleotidyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A8ZZ59 1.06e-07 59 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B0THS2 1.08e-07 59 36 2 108 3 pnp Polyribonucleotide nucleotidyltransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A1WXU7 1.08e-07 59 45 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q9ZD28 1.18e-07 58 38 1 78 3 rpsA Small ribosomal subunit protein bS1 Rickettsia prowazekii (strain Madrid E)
B6JCR8 1.19e-07 59 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A7HZ97 1.21e-07 59 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q13EM2 1.27e-07 58 39 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain BisB5)
C1DFK5 1.29e-07 58 47 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9Z8M3 1.31e-07 58 31 1 101 3 rpsA Small ribosomal subunit protein bS1 Chlamydia pneumoniae
Q9Z8M3 0.000495 47 31 2 82 3 rpsA Small ribosomal subunit protein bS1 Chlamydia pneumoniae
Q9Z8M3 0.0008 46 35 1 71 3 rpsA Small ribosomal subunit protein bS1 Chlamydia pneumoniae
Q6CVK3 1.35e-07 59 24 7 227 3 SPT6 Transcription elongation factor SPT6 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q89WB3 1.36e-07 58 47 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A4VPN6 1.4e-07 58 47 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Stutzerimonas stutzeri (strain A1501)
A8G911 1.48e-07 58 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Serratia proteamaculans (strain 568)
A8LKE7 1.52e-07 58 28 12 266 3 pnp Polyribonucleotide nucleotidyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q127W8 1.56e-07 58 40 2 84 3 pnp Polyribonucleotide nucleotidyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A9CKQ7 1.84e-07 58 44 2 83 3 pnp Polyribonucleotide nucleotidyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q0BPK3 1.91e-07 58 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
F4J8K6 1.93e-07 58 36 1 92 2 RRP5 rRNA biogenesis protein RRP5 Arabidopsis thaliana
A8GS96 1.96e-07 58 36 5 119 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia rickettsii (strain Sheila Smith)
B0BXR0 1.96e-07 58 36 5 119 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia rickettsii (strain Iowa)
B5EMD4 2.01e-07 58 47 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4D8 2.06e-07 58 47 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A2BXQ9 2.12e-07 58 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus (strain MIT 9515)
B8GWZ0 2.2e-07 58 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9AC32 2.2e-07 58 43 1 71 1 pnp Polyribonucleotide nucleotidyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q6D9A1 2.21e-07 58 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A2BSA7 2.27e-07 58 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus (strain AS9601)
Q4FNM6 2.28e-07 58 47 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Pelagibacter ubique (strain HTCC1062)
A8G5Y9 2.35e-07 58 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus (strain MIT 9215)
A7MIN6 2.37e-07 58 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
C6DKK7 2.39e-07 58 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1GZG8 2.44e-07 58 37 2 96 3 pnp Polyribonucleotide nucleotidyltransferase Endomicrobium trichonymphae
Q7V0R5 2.47e-07 58 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q92HV7 2.54e-07 58 33 3 116 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A3PE40 2.58e-07 58 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus (strain MIT 9301)
A8GNL8 2.6e-07 58 31 2 113 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia akari (strain Hartford)
B3PXD7 2.61e-07 58 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium etli (strain CIAT 652)
B2VGN7 2.63e-07 58 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9MP39 2.72e-07 58 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5ZW24 2.72e-07 58 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B7LR33 2.75e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q319U4 2.79e-07 57 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Prochlorococcus marinus (strain MIT 9312)
B7UJ59 2.79e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R6H4 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LFR6 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NDF0 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FD87 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCU5 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AG69 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O1:K1 / APEC
B7N0U9 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O81 (strain ED1a)
B7MB85 2.84e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A4WEX9 2.87e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Enterobacter sp. (strain 638)
Q8ZLT3 2.89e-07 57 42 1 78 1 pnp Polyribonucleotide nucleotidyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NM73 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella typhimurium (strain SL1344)
B5BGJ1 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella paratyphi A (strain AKU_12601)
C0PZ50 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella paratyphi C (strain RKS4594)
A9N728 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PL97 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5REN2 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZV4 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella enteritidis PT4 (strain P125109)
Q57JI3 2.89e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella choleraesuis (strain SC-B67)
Q8K9H5 2.93e-07 57 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B9JGS9 2.99e-07 57 43 2 85 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A5N848 3.06e-07 57 40 2 88 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E1K8 3.06e-07 57 40 2 88 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium kluyveri (strain NBRC 12016)
Q1AW48 3.07e-07 57 48 3 75 3 pnp Polyribonucleotide nucleotidyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A8AQ53 3.1e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YX77 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella sonnei (strain Ss046)
B2U211 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I1N9 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain SE11)
P05055 3.15e-07 57 42 1 78 1 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain K12)
A8A4Y0 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O9:H4 (strain HS)
B1XGX6 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain K12 / DH10B)
C4ZSQ5 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NKN3 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YS54 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X9M3 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O157:H7
B7LH99 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZS61 3.15e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83JG0 3.18e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella flexneri
Q0T0B7 3.18e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella flexneri serotype 5b (strain 8401)
Q31W43 3.18e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella boydii serotype 4 (strain Sb227)
B5XSX9 3.18e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Klebsiella pneumoniae (strain 342)
A6TEI3 3.2e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7JJ84 3.29e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain AH820)
Q0SSE0 3.3e-07 57 40 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium perfringens (strain SM101 / Type A)
B7M072 3.32e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli O8 (strain IAI1)
Q7UR95 3.37e-07 57 42 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q66F56 3.39e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K2Q9 3.39e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B7HDT0 3.49e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain B4264)
Q6BVE1 3.51e-07 57 27 6 176 3 SPT6 Transcription elongation factor SPT6 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
B9IV96 3.58e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain Q1)
B7HLE0 3.58e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain AH187)
B1IQV7 3.61e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q732R5 3.65e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9CLU1 3.68e-07 57 40 3 95 3 pnp Polyribonucleotide nucleotidyltransferase Pasteurella multocida (strain Pm70)
C3L0B0 3.68e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain 657 / Type Ba4)
B7IUG5 3.71e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain G9842)
A7GG00 3.75e-07 57 40 3 104 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q6HF08 3.8e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q636L9 3.8e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain ZK / E33L)
C1EP29 3.8e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain 03BB102)
A0RHH8 3.8e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus thuringiensis (strain Al Hakam)
C3L7C0 3.8e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
Q81WM8 3.84e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus anthracis
C3P5L0 3.84e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus anthracis (strain A0248)
B1JLX6 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TQU4 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pestis (strain Pestoides F)
A9R5A9 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q0WBF9 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pestis
Q1C3L8 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FMR8 3.85e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q1CM51 3.95e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A5I4I7 4.05e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVY7 4.05e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B1KWK1 4.08e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
B5YHN2 4.14e-07 57 41 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B1II43 4.26e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Okra / Type B1)
P44584 4.55e-07 57 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2KE00 4.59e-07 57 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
C1FS53 4.6e-07 57 41 3 98 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5CC62 4.67e-07 57 41 1 73 3 pnp Polyribonucleotide nucleotidyltransferase Orientia tsutsugamushi (strain Boryong)
A1W4L8 4.72e-07 57 42 2 80 3 pnp Polyribonucleotide nucleotidyltransferase Acidovorax sp. (strain JS42)
Q1MN44 4.79e-07 57 45 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3SWP5 4.81e-07 57 38 1 97 3 pnp Polyribonucleotide nucleotidyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A9HF35 4.84e-07 57 46 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
B0K1D0 4.92e-07 57 41 2 87 3 pnp Polyribonucleotide nucleotidyltransferase Thermoanaerobacter sp. (strain X514)
B0K9P4 4.92e-07 57 41 2 87 3 pnp Polyribonucleotide nucleotidyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q05022 4.96e-07 57 37 1 81 1 RRP5 rRNA biogenesis protein RRP5 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A9F8Z2 4.97e-07 57 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Sorangium cellulosum (strain So ce56)
A8EYU2 4.98e-07 57 33 3 114 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia canadensis (strain McKiel)
P40611 5.07e-07 57 42 4 90 3 rnr Ribonuclease R Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B3CTX1 5.17e-07 57 41 1 73 3 pnp Polyribonucleotide nucleotidyltransferase Orientia tsutsugamushi (strain Ikeda)
A5VCY9 5.23e-07 57 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
P24384 5.3e-07 57 33 6 125 1 PRP22 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP22 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8XJS4 5.37e-07 57 40 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TPS3 5.37e-07 57 40 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q87WQ8 5.46e-07 57 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6AJY9 5.62e-07 57 47 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8F7J8 5.94e-07 57 33 4 139 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NX7 5.94e-07 57 33 4 139 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
C5D9D5 5.94e-07 57 35 3 103 3 pnp Polyribonucleotide nucleotidyltransferase Geobacillus sp. (strain WCH70)
A1U5Z6 6.08e-07 57 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q04ZJ9 6.08e-07 57 33 4 139 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q68WN1 6.11e-07 57 32 3 121 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q04U27 6.3e-07 56 33 4 139 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
C3MC71 6.33e-07 56 40 2 88 3 pnp Polyribonucleotide nucleotidyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A1UU54 6.73e-07 56 34 2 105 3 pnp Polyribonucleotide nucleotidyltransferase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q1IF39 6.76e-07 56 50 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas entomophila (strain L48)
C3K255 6.94e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas fluorescens (strain SBW25)
Q9RSR1 7.08e-07 56 46 0 56 1 pnp Polyribonucleotide nucleotidyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q4QNV7 7.16e-07 56 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Haemophilus influenzae (strain 86-028NP)
A2SFM2 7.66e-07 56 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5UAQ6 7.67e-07 56 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Haemophilus influenzae (strain PittEE)
A6VCJ6 8.03e-07 56 44 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas aeruginosa (strain PA7)
Q48E81 8.03e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4KIF2 8.04e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q819Z1 8.16e-07 56 38 2 89 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5UG34 8.35e-07 56 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Haemophilus influenzae (strain PittGG)
Q9HV59 8.45e-07 56 44 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FT2 8.45e-07 56 44 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V1F2 8.45e-07 56 44 2 78 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas aeruginosa (strain LESB58)
Q3KI80 8.53e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q2IQ01 8.63e-07 56 42 1 83 3 pnp Polyribonucleotide nucleotidyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
P29344 8.65e-07 55 40 1 70 1 RPS1 Small ribosomal subunit protein bS1c Spinacia oleracea
Q6G0P7 8.7e-07 56 34 3 113 3 pnp Polyribonucleotide nucleotidyltransferase Bartonella quintana (strain Toulouse)
Q7A5J0 8.75e-07 55 38 0 68 1 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain N315)
Q99U14 8.75e-07 55 38 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
B1J2B3 8.75e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas putida (strain W619)
Q8NWM8 8.9e-07 55 38 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain MW2)
Q6G987 8.9e-07 55 38 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain MSSA476)
Q5HFU7 8.9e-07 55 38 0 68 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain COL)
Q0AE53 8.92e-07 56 43 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B0KHX3 9.13e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas putida (strain GB-1)
A9W8P8 9.22e-07 56 44 1 72 3 pnp Polyribonucleotide nucleotidyltransferase Methylorubrum extorquens (strain PA1)
B7KN55 9.22e-07 56 44 1 72 3 pnp Polyribonucleotide nucleotidyltransferase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q98BI3 9.29e-07 56 45 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q73NW1 9.35e-07 56 47 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
C1A3Y1 9.47e-07 56 45 1 72 3 pnp Polyribonucleotide nucleotidyltransferase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q88DW0 9.53e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W983 9.53e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q21C27 9.53e-07 56 40 2 92 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain BisB18)
O87792 9.69e-07 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas putida
P41121 9.83e-07 56 39 1 78 1 pnp Polyribonucleotide nucleotidyltransferase Photorhabdus luminescens
Q7MYZ0 9.91e-07 56 44 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q32BG9 1.01e-06 56 42 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B0VLR7 1.02e-06 56 45 1 70 1 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain SDF)
B0VEA3 1.03e-06 56 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain AYE)
A3M1M7 1.03e-06 56 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I2Q0 1.03e-06 56 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain ACICU)
B7I3U1 1.03e-06 56 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain AB0057)
B7H0Z1 1.03e-06 56 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baumannii (strain AB307-0294)
Q4ZNR6 1.04e-06 56 48 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Pseudomonas syringae pv. syringae (strain B728a)
B2V4H5 1.05e-06 56 42 2 85 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Alaska E43 / Type E3)
B1ZGS7 1.06e-06 56 44 1 72 3 pnp Polyribonucleotide nucleotidyltransferase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B8JFZ1 1.1e-06 55 42 1 83 3 pnp Polyribonucleotide nucleotidyltransferase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q92SW0 1.13e-06 55 39 2 88 3 pnp Polyribonucleotide nucleotidyltransferase Rhizobium meliloti (strain 1021)
B9MEL0 1.16e-06 55 40 2 80 3 pnp Polyribonucleotide nucleotidyltransferase Acidovorax ebreus (strain TPSY)
B2TJ61 1.19e-06 55 42 2 85 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
B4UHG5 1.2e-06 55 42 1 83 3 pnp Polyribonucleotide nucleotidyltransferase Anaeromyxobacter sp. (strain K)
Q21YD1 1.22e-06 55 42 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
O34275 1.23e-06 55 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia enterocolitica
Q6FF12 1.23e-06 55 45 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1JIX3 1.24e-06 55 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9B8G1 1.29e-06 55 29 1 113 3 pnp Polyribonucleotide nucleotidyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q65VB0 1.29e-06 55 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9KA83 1.3e-06 55 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C5CT24 1.4e-06 55 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Variovorax paradoxus (strain S110)
Q2NW19 1.44e-06 55 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Sodalis glossinidius (strain morsitans)
Q1LSL2 1.48e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
A1TLL2 1.49e-06 55 41 2 80 3 pnp Polyribonucleotide nucleotidyltransferase Paracidovorax citrulli (strain AAC00-1)
Q1XDE2 1.54e-06 53 33 1 74 3 rps1 Small ribosomal subunit protein bS1c Neopyropia yezoensis
A1VM56 1.54e-06 55 40 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Polaromonas naphthalenivorans (strain CJ2)
B8I2R5 1.57e-06 55 47 0 63 3 pnp Polyribonucleotide nucleotidyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A6UF34 1.59e-06 55 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Sinorhizobium medicae (strain WSM419)
Q07V82 1.6e-06 55 47 1 69 3 pnp Polyribonucleotide nucleotidyltransferase Rhodopseudomonas palustris (strain BisA53)
B9JYL0 1.66e-06 55 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q6G5F8 1.67e-06 55 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q9ZAE1 1.72e-06 55 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Thermus thermophilus
Q72JJ8 1.72e-06 55 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6GGT5 1.73e-06 54 38 0 67 3 rpsA Small ribosomal subunit protein bS1 Staphylococcus aureus (strain MRSA252)
A3DCH7 1.75e-06 55 44 0 63 3 pnp Polyribonucleotide nucleotidyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q11BC3 1.75e-06 55 45 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Chelativorans sp. (strain BNC1)
Q4ULK1 1.75e-06 55 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1GKK5 1.81e-06 55 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Ruegeria sp. (strain TM1040)
Q822C1 1.84e-06 55 38 1 81 3 pnp Polyribonucleotide nucleotidyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q8Z3I0 1.89e-06 55 41 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Salmonella typhi
Q255L4 1.9e-06 55 38 1 81 3 pnp Polyribonucleotide nucleotidyltransferase Chlamydia felis (strain Fe/C-56)
A1WLP8 1.92e-06 55 40 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Verminephrobacter eiseniae (strain EF01-2)
A5F913 1.92e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P39694 1.93e-06 52 35 0 73 1 comEA ComE operon protein 1 Bacillus subtilis (strain 168)
C3LSQ2 1.93e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KU76 1.93e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1RIG0 2.01e-06 55 32 2 109 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia bellii (strain RML369-C)
A8GWV2 2.01e-06 55 32 2 109 3 pnp Polyribonucleotide nucleotidyltransferase Rickettsia bellii (strain OSU 85-389)
Q7MI20 2.03e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio vulnificus (strain YJ016)
Q8DBU9 2.03e-06 55 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio vulnificus (strain CMCP6)
B1Y823 2.1e-06 55 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1V2L2 2.2e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia mallei (strain SAVP1)
Q62IN1 2.2e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia mallei (strain ATCC 23344)
A2S463 2.2e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI97 2.2e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia mallei (strain NCTC 10247)
Q63VN7 2.24e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia pseudomallei (strain K96243)
A3N7L3 2.24e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia pseudomallei (strain 668)
Q3JUB3 2.24e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia pseudomallei (strain 1710b)
A3NTA2 2.24e-06 55 39 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia pseudomallei (strain 1106a)
Q5LN23 2.24e-06 55 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q1DAM1 2.35e-06 55 47 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Myxococcus xanthus (strain DK1622)
Q82XT0 2.35e-06 55 36 2 93 3 pnp Polyribonucleotide nucleotidyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B9KP47 2.38e-06 55 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B9LH03 2.42e-06 55 40 0 70 3 pnp Polyribonucleotide nucleotidyltransferase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WEJ7 2.42e-06 55 40 0 70 3 pnp Polyribonucleotide nucleotidyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A1K7B5 2.42e-06 55 42 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Azoarcus sp. (strain BH72)
A4WWP0 2.44e-06 55 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
P38016 2.53e-06 54 32 1 91 3 rpsA Small ribosomal subunit protein bS1 Chlamydia muridarum (strain MoPn / Nigg)
P38016 0.00088 46 35 1 71 3 rpsA Small ribosomal subunit protein bS1 Chlamydia muridarum (strain MoPn / Nigg)
P38016 0.001 46 31 2 82 3 rpsA Small ribosomal subunit protein bS1 Chlamydia muridarum (strain MoPn / Nigg)
B7VJH3 2.56e-06 54 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio atlanticus (strain LGP32)
Q8RA43 2.56e-06 54 46 0 64 3 pnp Polyribonucleotide nucleotidyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2SMK9 2.6e-06 54 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Hahella chejuensis (strain KCTC 2396)
Q3IYT7 2.62e-06 54 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PNG0 2.62e-06 54 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A6VR10 2.96e-06 54 39 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8G3Z1 2.99e-06 54 40 0 70 3 pnp Polyribonucleotide nucleotidyltransferase Chloroflexus aggregans (strain MD-66 / DSM 9485)
B8FCZ0 3.47e-06 54 48 0 58 3 pnp Polyribonucleotide nucleotidyltransferase Desulfatibacillum aliphaticivorans
Q493T3 3.53e-06 54 37 2 85 3 pnp Polyribonucleotide nucleotidyltransferase Blochmanniella pennsylvanica (strain BPEN)
A5D2S6 3.57e-06 54 35 5 123 3 pnp Polyribonucleotide nucleotidyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3IJ73 3.64e-06 54 44 1 74 1 pnp Polyribonucleotide nucleotidyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q482T5 3.76e-06 54 42 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9CEI6 3.8e-06 54 40 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
P46228 3.88e-06 53 40 1 76 1 rpsA Small ribosomal subunit protein bS1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A9BNB8 4.21e-06 54 40 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q14LB9 4.31e-06 53 43 0 62 3 pnp Polyribonucleotide nucleotidyltransferase Spiroplasma citri
Q6MMS2 4.33e-06 53 37 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q2SZN9 4.37e-06 53 38 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q0AK62 4.48e-06 53 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Maricaulis maris (strain MCS10)
A9IMR9 4.81e-06 53 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A6TM00 4.81e-06 53 36 1 76 3 pnp1 Polyribonucleotide nucleotidyltransferase 1 Alkaliphilus metalliredigens (strain QYMF)
A6TM05 4.9e-06 53 36 1 76 3 pnp2 Polyribonucleotide nucleotidyltransferase 2 Alkaliphilus metalliredigens (strain QYMF)
B1YI57 4.96e-06 53 32 2 119 3 pnp Polyribonucleotide nucleotidyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q49X62 4.97e-06 53 40 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9MR54 5.56e-06 53 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q895J3 5.58e-06 53 45 1 74 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium tetani (strain Massachusetts / E88)
Q2RMR6 5.64e-06 53 42 2 77 3 pnp Polyribonucleotide nucleotidyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5L0I2 5.78e-06 53 34 2 103 3 pnp Polyribonucleotide nucleotidyltransferase Geobacillus kaustophilus (strain HTA426)
A5WBT2 5.82e-06 53 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Psychrobacter sp. (strain PRwf-1)
A6TNZ5 6.22e-06 53 37 1 74 3 pnp3 Polyribonucleotide nucleotidyltransferase 3 Alkaliphilus metalliredigens (strain QYMF)
B0UTJ5 6.65e-06 53 42 2 77 3 pnp Polyribonucleotide nucleotidyltransferase Histophilus somni (strain 2336)
Q0I2T0 6.65e-06 53 42 2 77 3 pnp Polyribonucleotide nucleotidyltransferase Histophilus somni (strain 129Pt)
Q39EE1 6.66e-06 53 40 1 79 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A3QGU0 6.71e-06 53 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8GZQ3 6.84e-06 53 30 3 136 1 PNP1 Polyribonucleotide nucleotidyltransferase 1, chloroplastic Arabidopsis thaliana
Q895G2 7e-06 53 38 0 70 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium tetani (strain Massachusetts / E88)
Q895G2 0.00014 49 43 2 79 3 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase Clostridium tetani (strain Massachusetts / E88)
Q0BWM9 7.63e-06 53 38 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Hyphomonas neptunium (strain ATCC 15444)
P51345 7.71e-06 52 35 1 74 3 rps1 Small ribosomal subunit protein bS1c Porphyra purpurea
A4JGD4 7.83e-06 53 40 1 79 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
P57628 7.9e-06 53 38 2 81 3 rnr Ribonuclease R Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A1AWB1 8.01e-06 53 33 2 89 3 pnp Polyribonucleotide nucleotidyltransferase Ruthia magnifica subsp. Calyptogena magnifica
Q7VQM0 8.02e-06 53 39 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Blochmanniella floridana
Q2LWT4 8.27e-06 53 50 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Syntrophus aciditrophicus (strain SB)
B2KDX2 8.38e-06 53 43 0 57 3 pnp Polyribonucleotide nucleotidyltransferase Elusimicrobium minutum (strain Pei191)
B1KRQ5 8.92e-06 53 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q5SJ75 8.97e-06 53 44 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P74142 9.13e-06 52 36 2 82 3 rps1b Small ribosomal subunit protein bS1B Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5NZR7 9.45e-06 53 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2RJL9 9.54e-06 53 40 3 79 3 pnp Polyribonucleotide nucleotidyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B0TQ97 9.64e-06 52 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella halifaxensis (strain HAW-EB4)
A1ST53 9.94e-06 52 44 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1B5P9 9.95e-06 52 39 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Paracoccus denitrificans (strain Pd 1222)
A6LSR0 9.96e-06 52 46 0 60 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q93VC7 1.02e-05 52 38 1 70 1 RPS1 Small ribosomal subunit protein bS1c Arabidopsis thaliana
A8MFB4 1.05e-05 52 45 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Alkaliphilus oremlandii (strain OhILAs)
A4XL64 1.06e-05 52 42 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q9ESX4 1.09e-05 51 35 2 84 1 Zcchc17 Zinc finger CCHC domain-containing protein 17 Mus musculus
A8FYR5 1.09e-05 52 43 1 69 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella sediminis (strain HAW-EB3)
B0BUD5 1.18e-05 52 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A4IME3 1.19e-05 52 32 2 103 3 pnp Polyribonucleotide nucleotidyltransferase Geobacillus thermodenitrificans (strain NG80-2)
B3GXC1 1.24e-05 52 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZU3 1.24e-05 52 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8F492 1.25e-05 52 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
C0R0E0 1.25e-05 52 38 1 78 3 pnp Polyribonucleotide nucleotidyltransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q0BDC6 1.29e-05 52 40 1 77 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YTR1 1.29e-05 52 40 1 77 3 pnp Polyribonucleotide nucleotidyltransferase Burkholderia ambifaria (strain MC40-6)
Q2GGA4 1.41e-05 52 34 3 99 3 pnp Polyribonucleotide nucleotidyltransferase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q9Z6R0 1.51e-05 52 44 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Chlamydia pneumoniae
A0Q0Q1 1.61e-05 52 47 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium novyi (strain NT)
A6Q4N2 1.66e-05 52 51 0 56 3 pnp Polyribonucleotide nucleotidyltransferase Nitratiruptor sp. (strain SB155-2)
B8CKH8 1.72e-05 52 42 1 69 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H735 1.74e-05 52 42 1 69 3 pnp Polyribonucleotide nucleotidyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0SQH8 1.79e-05 52 39 1 73 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SH22 1.79e-05 52 39 1 73 3 pnp Polyribonucleotide nucleotidyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q7VL91 1.81e-05 52 45 1 68 3 pnp Polyribonucleotide nucleotidyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A9VT44 1.81e-05 52 49 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus mycoides (strain KBAB4)
B2T2E3 1.85e-05 52 38 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q3YSC4 1.85e-05 52 37 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Ehrlichia canis (strain Jake)
Q39VA1 1.87e-05 52 47 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A6WWW1 1.89e-05 52 43 1 71 3 pnp Polyribonucleotide nucleotidyltransferase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5L5B4 1.9e-05 52 37 1 81 3 pnp Polyribonucleotide nucleotidyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q142H7 1.92e-05 52 42 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Paraburkholderia xenovorans (strain LB400)
A7GRD7 2.02e-05 52 47 0 59 3 pnp Polyribonucleotide nucleotidyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O29723 2.1e-05 50 38 1 72 3 eif2a Translation initiation factor 2 subunit alpha Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A7H9F8 2.12e-05 52 48 0 54 3 pnp Polyribonucleotide nucleotidyltransferase Anaeromyxobacter sp. (strain Fw109-5)
Q02WZ5 2.19e-05 52 37 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
A4G647 2.2e-05 51 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Herminiimonas arsenicoxydans
B2JDN2 2.2e-05 51 38 1 76 3 pnp Polyribonucleotide nucleotidyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A2RMS5 2.21e-05 52 37 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q3Z7V6 2.21e-05 51 45 1 75 3 pnp Polyribonucleotide nucleotidyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q97I45 2.25e-05 51 44 0 63 3 pnp Polyribonucleotide nucleotidyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A7MZI2 2.26e-05 51 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q87M06 2.4e-05 51 41 1 70 3 pnp Polyribonucleotide nucleotidyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VZU0 2.41e-05 51 32 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W570 2.41e-05 51 32 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9NP64 2.43e-05 50 32 4 125 1 ZCCHC17 Zinc finger CCHC domain-containing protein 17 Homo sapiens
Q15VD4 2.49e-05 51 36 1 84 3 pnp Polyribonucleotide nucleotidyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7WCQ0 2.56e-05 51 32 2 101 3 pnp Polyribonucleotide nucleotidyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2GJV5 2.58e-05 51 33 2 89 3 pnp Polyribonucleotide nucleotidyltransferase Anaplasma phagocytophilum (strain HZ)
Q6LUI8 2.63e-05 51 39 2 87 3 pnp Polyribonucleotide nucleotidyltransferase Photobacterium profundum (strain SS9)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14280
Feature type CDS
Gene -
Product Tex family protein
Location 3168856 - 3171189 (strand: -1)
Length 2334 (nucleotides) / 777 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1629
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00575 S1 RNA binding domain
PF09371 Tex-like protein N-terminal domain
PF12836 Helix-hairpin-helix motif
PF16921 Tex protein YqgF-like domain
PF17674 HHH domain
PF22706 Tex central region-like

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2183 Transcription (K) K Transcriptional accessory protein Tex/SPT6

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06959 protein Tex - -

Protein Sequence

MNESLSRIIAQELSVKPQQVLSAITLLDEGNTVPFVARYRKEVTGGLDDTQLRQLETRLSYLRELNDRRQTILKSIEEQGKLTEELRSSINETQSKTELEDLYLPYKPKRRTRGQIAIENGLEPLADLLWNEPQHTPEDAASAYINPEKGIDDSKAALDGARYILMERFAEDAGLLAKVRQYLWKNAHLVSKVVDGKEAEGAKFSDYFDTHEPIAHVPSHRALAMFRGRNEGILQLSLNPDPQFEEAPKESYGEQLITEHLGLRLNNQPADSWRKAVVSWTWRIKVLMHLETELMGQLREKAEDEAINVFARNLKDLLMAAPAGMRATMGLDPGLRTGVKVAVVDSTGKLIATDTIYPHTGQADKAAASVAALCIKHNVELVAIGNGTASRETERFFADTVKRYPEVKAQKVIVSEAGASVYSASELAAKEFPDLDVSLRGAVSIARRLQDPLAELVKIDPKSIGVGQYQHDVSQTLLAKKLDTVVEDCVNGVGVDLNTASVPLLTRVAGLSQSIAQNIIAWRDENGRFVDRKQLLKVARLGPKAFEQCAGFLRIRDGKNPLDASTVHPEAYPIVENILQSIHQKIDQVMGNSALLSQINAREFVTEQFGLPTINDILKELAKPGRDPRPEFKTATFAEGVETMNDLVSGMILEGTVTNVTNFGAFVDIGVHQDGLVHISSLSDRFVEDPHTVVKTGDIVKVKVLEVDLPRKRIALTMRLDEVAADSDHKRQSVTKDNASKHSRGQKPTRNRQSNTGNNAGNSAMSDALAAAFGKKR

Flanking regions ( +/- flanking 50bp)

TGTATAATAGCCATCTTTTTTAACCACTCCTCTCGGTAGGTAAATATATTATGAATGAATCATTAAGCCGAATTATTGCACAAGAGCTATCAGTAAAGCCCCAGCAAGTACTTTCGGCCATTACGTTACTGGATGAAGGGAATACGGTGCCTTTTGTGGCCCGTTACCGAAAAGAGGTAACTGGTGGGTTAGATGATACTCAGCTTCGTCAATTGGAAACCCGCCTGAGTTACTTACGGGAACTCAATGATCGTCGCCAAACTATTTTAAAATCAATTGAAGAGCAGGGGAAACTCACAGAAGAATTACGCTCTTCGATTAATGAGACGCAAAGTAAAACAGAACTTGAAGATCTCTACCTTCCTTATAAACCGAAACGTCGTACTCGTGGACAAATTGCAATTGAAAATGGCTTAGAGCCATTAGCTGATTTGTTATGGAATGAACCACAACATACTCCTGAAGACGCAGCAAGTGCATATATCAACCCTGAAAAAGGCATAGATGATAGTAAAGCAGCCTTAGATGGGGCTCGCTATATCTTAATGGAACGTTTTGCAGAAGATGCTGGATTATTAGCTAAAGTTCGCCAATATTTATGGAAAAATGCGCATCTTGTTAGCAAAGTTGTTGACGGAAAAGAAGCAGAAGGCGCTAAATTTAGCGATTATTTTGATACTCATGAGCCGATTGCTCATGTACCTTCTCACCGTGCATTAGCGATGTTTCGTGGTCGTAATGAAGGTATTTTGCAGTTATCACTTAATCCTGATCCACAATTCGAAGAAGCCCCCAAAGAGAGCTATGGCGAACAGTTGATTACGGAGCATTTAGGTTTACGTCTTAATAATCAACCCGCGGATAGTTGGCGTAAAGCCGTTGTCAGCTGGACTTGGCGTATAAAAGTGTTAATGCATCTTGAAACTGAGTTAATGGGTCAGTTACGTGAGAAAGCGGAAGATGAAGCCATTAATGTGTTTGCACGTAACCTAAAAGATCTCTTAATGGCCGCACCTGCAGGTATGCGAGCTACGATGGGGCTAGATCCTGGTTTACGTACTGGGGTTAAAGTCGCGGTGGTGGATAGTACCGGTAAGCTGATTGCGACAGATACTATTTATCCTCATACCGGACAAGCGGATAAAGCCGCTGCTAGTGTAGCGGCATTATGTATTAAGCATAATGTAGAGTTAGTGGCGATTGGTAACGGTACTGCATCACGTGAAACAGAGCGTTTTTTTGCTGATACAGTAAAACGCTACCCAGAAGTTAAAGCACAAAAAGTGATCGTGAGCGAAGCCGGGGCATCGGTTTATTCGGCATCAGAGCTGGCAGCTAAAGAATTTCCGGATCTGGATGTTTCTCTTCGTGGCGCTGTTTCTATCGCTCGTCGCTTACAAGATCCATTGGCGGAATTGGTAAAAATTGATCCTAAATCTATCGGGGTGGGTCAATATCAGCATGATGTGAGCCAAACATTATTGGCAAAAAAATTAGATACTGTTGTTGAAGACTGTGTAAATGGTGTCGGTGTTGATTTAAATACAGCCTCTGTACCGCTATTGACGCGAGTGGCGGGGCTTAGCCAATCTATTGCTCAAAATATTATTGCTTGGCGTGATGAAAATGGCCGTTTTGTGGATAGAAAACAGTTACTCAAAGTGGCGCGCTTAGGGCCTAAAGCGTTTGAGCAGTGTGCAGGATTTTTACGTATTCGTGATGGTAAAAATCCACTTGATGCCTCTACGGTTCACCCAGAAGCCTATCCTATTGTTGAAAATATCTTGCAATCAATACATCAAAAAATTGATCAAGTCATGGGCAATAGTGCATTACTTTCACAAATCAATGCCAGAGAGTTTGTCACCGAGCAGTTCGGTTTGCCTACCATTAATGACATCTTAAAGGAGCTTGCTAAACCGGGGCGTGATCCTCGACCTGAGTTTAAAACAGCCACCTTTGCCGAAGGTGTTGAAACAATGAATGATTTAGTCAGTGGTATGATATTGGAAGGTACTGTAACTAATGTGACTAATTTTGGTGCCTTTGTGGATATTGGGGTACACCAAGATGGATTAGTGCATATTTCATCACTGTCGGATAGATTTGTTGAAGATCCCCATACTGTGGTAAAAACCGGCGATATTGTGAAGGTAAAAGTCCTTGAAGTCGATTTACCGCGTAAACGTATTGCGTTAACCATGCGTTTAGATGAAGTGGCTGCTGATAGTGATCATAAACGTCAGTCAGTGACTAAGGATAATGCTTCTAAACATAGTCGCGGGCAAAAACCGACCAGAAACCGCCAATCAAATACGGGTAACAATGCAGGTAATAGTGCGATGAGTGATGCATTGGCCGCAGCATTTGGTAAAAAACGCTAATATCTTATAGGTAGCCATCAATATTAACGTGAAGTAATAAATTGTATTAC