Homologs in group_4634

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4634

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4634

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JT67 0.0 819 73 0 552 3 YE4162 Putative transport protein YE4162 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8Z9V7 0.0 812 73 0 552 3 YPO4083 Putative transport protein YPO4083/y4100/YP_3992 Yersinia pestis
A9R4H0 0.0 812 73 0 552 3 YpAngola_A3793 Putative transport protein YpAngola_A3793 Yersinia pestis bv. Antiqua (strain Angola)
Q1CD76 0.0 812 73 0 552 3 YPN_3727 Putative transport protein YPN_3727 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1C3K8 0.0 812 73 0 552 3 YPA_3002 Putative transport protein YPA_3002 Yersinia pestis bv. Antiqua (strain Antiqua)
A4TGM8 0.0 812 73 0 552 3 YPDSF_0014 Putative transport protein YPDSF_0014 Yersinia pestis (strain Pestoides F)
A7FPA6 0.0 811 73 0 552 3 YpsIP31758_4141 Putative transport protein YpsIP31758_4141 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2K7E7 0.0 811 73 0 552 3 YPTS_4123 Putative transport protein YPTS_4123 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q663W8 0.0 811 73 0 552 3 YPTB3906 Putative transport protein YPTB3906 Yersinia pseudotuberculosis serotype I (strain IP32953)
B1JGZ7 0.0 811 73 0 552 3 YPK_0013 Putative transport protein YPK_0013 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A8G7S0 0.0 783 70 0 552 3 Spro_0050 Putative transport protein Spro_0050 Serratia proteamaculans (strain 568)
C5BC80 0.0 782 71 0 552 3 NT01EI_3867 Putative transport protein NT01EI_3867 Edwardsiella ictaluri (strain 93-146)
A6TFY7 0.0 778 68 0 552 3 KPN78578_40470 Putative transport protein KPN78578_40470 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XT62 0.0 775 68 0 552 3 KPK_0013 Putative transport protein KPK_0013 Klebsiella pneumoniae (strain 342)
A0KNW5 0.0 773 69 0 551 3 AHA_3492 Putative transport protein AHA_3492 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5EY82 0.0 767 67 0 552 3 yidE Putative transport protein YidE Salmonella agona (strain SL483)
Q8ZL04 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TMX5 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella schwarzengrund (strain CVM19633)
B5BIJ0 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella paratyphi A (strain AKU_12601)
A9MWJ2 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKS7 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SY75 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella newport (strain SL254)
A8ACJ7 0.0 766 67 0 552 3 CKO_00031 Putative transport protein CKO_00031 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C0Q247 0.0 766 66 0 552 3 yidE Putative transport protein YidE Salmonella paratyphi C (strain RKS4594)
B4TA59 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella heidelberg (strain SL476)
B5QU35 0.0 766 67 0 552 3 yidE Putative transport protein YidE Salmonella enteritidis PT4 (strain P125109)
B5FMC7 0.0 765 67 0 552 3 yidE Putative transport protein YidE Salmonella dublin (strain CT_02021853)
Q57I28 0.0 764 66 0 552 3 yidE Putative transport protein YidE Salmonella choleraesuis (strain SC-B67)
A9MJX2 0.0 764 66 0 552 3 yidE Putative transport protein YidE Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z2L7 0.0 763 66 0 552 3 yidE Putative transport protein YidE Salmonella typhi
Q6CYV4 0.0 761 68 0 552 3 ECA4401 Putative transport protein ECA4401 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1R4Q2 0.0 749 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain UTI89 / UPEC)
Q8FBW6 0.0 749 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AHM0 0.0 749 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O1:K1 / APEC
B7N2D1 0.0 749 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O81 (strain ED1a)
B7MGA5 0.0 749 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O45:K1 (strain S88 / ExPEC)
P60874 0.0 748 66 0 552 3 yidE Putative transport protein YidE Shigella flexneri
B1LL09 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain SMS-3-5 / SECEC)
B6I3R8 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain SE11)
B7NF02 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60872 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain K12)
B1IYQ9 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TB22 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6E4 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O9:H4 (strain HS)
B1X9B5 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain K12 / DH10B)
C4ZYW2 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain K12 / MC4100 / BW2952)
B7M4H4 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O8 (strain IAI1)
B7NQY5 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P60873 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O157:H7
B7L824 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli (strain 55989 / EAEC)
A7ZTN8 0.0 748 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6LQ84 0.0 748 66 0 552 3 PBPRA2144 Putative transport protein PBPRA2144 Photobacterium profundum (strain SS9)
B7UMF2 0.0 747 66 0 552 3 yidE Putative transport protein YidE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B2TUT7 0.0 746 66 0 552 3 yidE Putative transport protein YidE Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A4W4S5 0.0 746 66 0 552 3 Ent638_0015 Putative transport protein Ent638_0015 Enterobacter sp. (strain 638)
Q0SYM8 0.0 745 66 0 552 3 yidE Putative transport protein YidE Shigella flexneri serotype 5b (strain 8401)
Q31UU4 0.0 745 66 0 552 3 yidE Putative transport protein YidE Shigella boydii serotype 4 (strain Sb227)
A4SJA2 0.0 741 68 0 551 3 ASA_0825 Putative transport protein ASA_0825 Aeromonas salmonicida (strain A449)
Q329C8 0.0 739 66 0 552 3 yidE Putative transport protein YidE Shigella dysenteriae serotype 1 (strain Sd197)
Q3YWC7 0.0 722 66 0 552 3 yidE Putative transport protein YidE Shigella sonnei (strain Ss046)
B8F3F2 0.0 714 63 1 550 3 HAPS_0158 Putative transport protein HAPS_0158 Glaesserella parasuis serovar 5 (strain SH0165)
Q0I5K7 0.0 705 64 1 551 3 HS_1470 Putative transport protein HS_1470 Histophilus somni (strain 129Pt)
B0URX9 0.0 703 64 1 551 3 HSM_0534 Putative transport protein HSM_0534 Histophilus somni (strain 2336)
Q9CLX8 0.0 700 67 2 544 3 PM1071 Putative transport protein PM1071 Pasteurella multocida (strain Pm70)
Q4QPK9 0.0 699 64 1 551 3 NTHI0043 Putative transport protein NTHI0043 Haemophilus influenzae (strain 86-028NP)
P44472 0.0 696 64 1 551 3 HI_0035 Putative transport protein HI_0035 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFK5 0.0 696 64 1 551 3 CGSHiGG_02670 Putative transport protein CGSHiGG_02670 Haemophilus influenzae (strain PittGG)
A5UBA3 0.0 692 63 1 551 3 CGSHiEE_03135 Putative transport protein CGSHiEE_03135 Haemophilus influenzae (strain PittEE)
B3GXV8 0.0 688 62 1 551 3 APP7_1021 Putative transport protein APP7_1021 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0X4 0.0 688 62 1 551 3 APL_0966 Putative transport protein APL_0966 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VKA8 0.0 674 61 1 550 3 Asuc_0023 Putative transport protein Asuc_0023 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A5EX03 0.0 670 59 4 561 3 DNO_0009 Putative transport protein DNO_0009 Dichelobacter nodosus (strain VCS1703A)
B0BPQ8 0.0 659 62 1 551 3 APJL_0985 Putative transport protein APJL_0985 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q8A5Z4 6.12e-148 439 43 4 548 3 BT_2092 Uncharacterized transporter BT_2092 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q64PN7 8.94e-139 416 41 4 550 3 BF3802 Uncharacterized transporter BF3802 Bacteroides fragilis (strain YCH46)
Q64TC3 2.27e-138 415 40 8 550 3 BF2507 Uncharacterized transporter BF2507 Bacteroides fragilis (strain YCH46)
Q7MUS4 8.69e-127 385 42 8 554 3 PG_1411 Uncharacterized transporter PG_1411 Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q64VB3 7.34e-119 365 37 6 545 3 BF1818 Uncharacterized transporter BF1818 Bacteroides fragilis (strain YCH46)
Q8A8D8 1.82e-118 363 38 6 547 3 BT_1229 Uncharacterized transporter BT_1229 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7MWN8 1.17e-106 333 36 5 553 3 PG_0562 Uncharacterized transporter PG_0562 Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8AAG5 2.2e-89 288 34 8 536 3 BT_0500 Uncharacterized transporter BT_0500 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q64SU9 4.25e-89 287 35 8 536 3 BF2680 Uncharacterized transporter BF2680 Bacteroides fragilis (strain YCH46)
Q6APL9 1.28e-82 270 33 9 536 3 DP0976 Uncharacterized transporter DP0976 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8NNI8 1.88e-82 270 33 8 533 3 Cgl2211 Uncharacterized transporter Cgl2211/cg2425 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q74EE6 5.47e-79 261 31 5 541 3 GSU1016 Uncharacterized transporter GSU1016 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8FNP2 1.72e-74 249 32 9 536 3 CE2102 Uncharacterized transporter CE2102 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q6NIE7 8.47e-74 247 34 8 534 3 DIP0830 Uncharacterized transporter DIP0830 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q67MD6 6.04e-68 232 30 9 545 3 STH2172 Uncharacterized transporter STH2172 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7UH36 5.14e-63 218 30 10 541 3 RB4869 Uncharacterized transporter RB4869 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8NSS8 1.76e-61 214 30 12 543 3 Cgl0590 Uncharacterized transporter Cgl0590/cg0683 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q6NJ43 2.73e-60 212 29 10 548 3 DIP0570 Uncharacterized transporter DIP0570 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8FS11 4.43e-57 202 29 10 546 3 CE0595 Uncharacterized transporter CE0595 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A0KL13 6.23e-44 167 28 18 564 3 AHA_2450 Putative transport protein AHA_2450 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6A666 1.39e-43 166 28 14 550 3 PPA2034 Uncharacterized transporter PPA2034 Cutibacterium acnes (strain DSM 16379 / KPA171202)
A4SN85 5.86e-41 159 28 18 564 3 ASA_2308 Putative transport protein ASA_2308 Aeromonas salmonicida (strain A449)
Q87QB8 1.86e-36 146 26 16 539 3 VP1232 Putative transport protein VP1232 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D8Y7 7.47e-36 144 26 14 539 3 VV1_2828 Putative transport protein VV1_2828 Vibrio vulnificus (strain CMCP6)
Q7MLI9 7.47e-36 144 26 14 539 3 VV1438 Putative transport protein VV1438 Vibrio vulnificus (strain YJ016)
B7VPS1 1.01e-35 144 26 16 542 3 VS_1837 Putative transport protein VS_1837 Vibrio atlanticus (strain LGP32)
A7MSH9 1.54e-35 143 25 16 539 3 VIBHAR_02636 Putative transport protein VIBHAR_02636 Vibrio campbellii (strain ATCC BAA-1116)
A5F296 4.91e-35 142 25 15 554 3 VC0395_A0715 Putative transport protein VC0395_A0715/VC395_1212 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KSW1 4.91e-35 142 25 15 554 3 VC_1145 Putative transport protein VC_1145 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LLJ2 4.91e-35 142 25 15 554 3 VCM66_1101 Putative transport protein VCM66_1101 Vibrio cholerae serotype O1 (strain M66-2)
Q6LPH2 3.09e-34 139 25 14 564 3 PBPRA2420 Putative transport protein PBPRA2420 Photobacterium profundum (strain SS9)
A8GCA3 2.39e-32 134 24 15 551 3 Spro_1639 Putative transport protein Spro_1639 Serratia proteamaculans (strain 568)
A1JM45 5.34e-32 133 24 15 551 3 YE1478 Putative transport protein YE1478 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B6EHQ3 7.37e-32 132 25 14 567 3 VSAL_I2029 Putative transport protein VSAL_I2029 Aliivibrio salmonicida (strain LFI1238)
C5BED9 1.33e-31 132 24 18 557 3 NT01EI_2530 Putative transport protein NT01EI_2530 Edwardsiella ictaluri (strain 93-146)
B2VC50 1.89e-31 131 25 18 553 3 ETA_21820 Putative transport protein ETA_21820 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A7MF23 4.3e-31 130 24 16 557 3 ESA_02488 Putative transport protein ESA_02488 Cronobacter sakazakii (strain ATCC BAA-894)
B5XYN9 1.56e-30 129 23 14 551 3 KPK_3686 Putative transport protein KPK_3686 Klebsiella pneumoniae (strain 342)
Q1CAD7 3.35e-30 128 23 15 551 3 YPA_0617 Putative transport protein YPA_0617 Yersinia pestis bv. Antiqua (strain Antiqua)
B1JRK3 3.35e-30 128 23 15 551 3 YPK_2734 Putative transport protein YPK_2734 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q1CG99 3.35e-30 128 23 15 551 3 YPN_2653 Putative transport protein YPN_2653 Yersinia pestis bv. Antiqua (strain Nepal516)
A7FK36 3.35e-30 128 23 15 551 3 YpsIP31758_2649 Putative transport protein YpsIP31758_2649 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TN83 3.35e-30 128 23 15 551 3 YPDSF_2370 Putative transport protein YPDSF_2370 Yersinia pestis (strain Pestoides F)
A9R4U7 3.35e-30 128 23 15 551 3 YpAngola_A1559 Putative transport protein YpAngola_A1559 Yersinia pestis bv. Antiqua (strain Angola)
B2K9W1 3.35e-30 128 23 15 551 3 YPTS_1454 Putative transport protein YPTS_1454 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q66CP5 3.35e-30 128 23 15 551 3 YPTB1357 Putative transport protein YPTB1357 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZGH1 3.35e-30 128 23 15 551 3 YPO1326 Putative transport protein YPO1326/y2857/YP_1266 Yersinia pestis
A4W8L3 4.2e-30 127 23 17 557 3 Ent638_1362 Putative transport protein Ent638_1362 Enterobacter sp. (strain 638)
Q6D3R1 5.06e-30 127 24 19 554 3 ECA2683 Putative transport protein ECA2683 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6T6U3 6.77e-30 127 23 14 551 3 KPN78578_08530 Putative transport protein KPN78578_08530 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8AIS0 1.21e-29 126 24 16 557 3 CKO_02260 Putative transport protein CKO_02260 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C6DEP2 2.74e-29 125 25 21 555 3 PC1_1686 Putative transport protein PC1_1686 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q57R91 2.83e-29 125 24 16 552 3 ybjL Putative transport protein YbjL Salmonella choleraesuis (strain SC-B67)
B5R857 3.63e-29 125 24 17 553 3 ybjL Putative transport protein YbjL Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LN13 3.81e-29 124 23 17 554 3 ybjL Putative transport protein YbjL Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5FPD7 4.76e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella dublin (strain CT_02021853)
Q8ZQK4 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TRM3 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella schwarzengrund (strain CVM19633)
B5BBW7 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella paratyphi A (strain AKU_12601)
A9MSN4 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PGN8 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0D1 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella newport (strain SL254)
B4TCW8 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella heidelberg (strain SL476)
B5QXX4 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella enteritidis PT4 (strain P125109)
B5F0Y9 8.17e-29 124 24 17 553 3 ybjL Putative transport protein YbjL Salmonella agona (strain SL483)
C0PXM8 9.57e-29 123 24 17 553 3 ybjL Putative transport protein YbjL Salmonella paratyphi C (strain RKS4594)
Q8Z851 1.13e-28 123 24 17 553 3 ybjL Putative transport protein YbjL Salmonella typhi
B5FCI8 1.19e-28 123 24 14 567 3 VFMJ11_0927 Putative transport protein VFMJ11_0927 Aliivibrio fischeri (strain MJ11)
Q5E6G2 1.19e-28 123 24 14 567 3 VF_0889 Putative transport protein VF_0889 Aliivibrio fischeri (strain ATCC 700601 / ES114)
A9MIN5 2.03e-28 122 24 17 553 3 ybjL Putative transport protein YbjL Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q323Q4 4.42e-28 121 24 20 560 3 ybjL Putative transport protein YbjL Shigella boydii serotype 4 (strain Sb227)
A7ZJR5 4.51e-28 121 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O139:H28 (strain E24377A / ETEC)
Q89PK4 9.64e-28 120 23 10 489 3 bll3476 Uncharacterized transporter bll3476 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B2TV73 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RE78 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain UTI89 / UPEC)
B1LMZ9 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain SMS-3-5 / SECEC)
B6I8G8 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain SE11)
B7NAJ3 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60869 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain K12)
B1IWS5 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60870 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJK1 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A986 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O1:K1 / APEC
A7ZYF0 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O9:H4 (strain HS)
B1X7Y8 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain K12 / DH10B)
C4ZY19 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7C2 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O8 (strain IAI1)
B7MQV0 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O81 (strain ED1a)
B7NNT0 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSD8 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60871 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O157:H7
B7LD40 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli (strain 55989 / EAEC)
B7MGV4 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMT9 1.1e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83S20 1.56e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Shigella flexneri
Q0T8M0 1.56e-27 120 24 19 559 3 ybjL Putative transport protein YbjL Shigella flexneri serotype 5b (strain 8401)
Q7WJ43 2.14e-27 119 24 12 528 3 BB2657 Uncharacterized transporter BB2657 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WA16 3.43e-27 119 24 12 528 3 BPP1579 Uncharacterized transporter BPP1579 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q3Z3T7 3.88e-27 119 24 19 558 3 ybjL Putative transport protein YbjL Shigella sonnei (strain Ss046)
E1WTB4 1.24e-26 117 26 15 550 3 BF638R_1531 Uncharacterized transporter BF638R_1531 Bacteroides fragilis (strain 638R)
Q32IC5 1.47e-26 117 24 18 543 3 ybjL Putative transport protein YbjL Shigella dysenteriae serotype 1 (strain Sd197)
P0CJ82 1.7e-26 117 26 15 550 3 BF1518 Uncharacterized transporter BF1518 Bacteroides fragilis (strain YCH46)
Q8EF50 6.74e-26 115 22 14 546 3 SO_2143 Uncharacterized transporter SO_2143 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7WM55 9.39e-26 114 23 13 547 3 BB1538 Uncharacterized transporter BB1538 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W8J2 1.05e-25 114 23 13 547 3 BPP2141 Uncharacterized transporter BPP2141 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q89PK5 6.14e-25 112 24 14 515 3 bll3475 Uncharacterized transporter bll3475 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6ARA9 5.8e-23 106 25 19 570 3 DP0386 Uncharacterized transporter DP0386 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8A9S9 2.11e-22 104 25 14 505 3 BT_0736 Uncharacterized transporter BT_0736 Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5NGK7 2.62e-22 104 24 17 570 3 FTT_0829c Uncharacterized transporter FTT_0829c Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NLV5 5.59e-21 100 24 20 569 3 ZMO1681 Uncharacterized transporter ZMO1681 Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q89PK9 4.05e-19 94 26 11 528 3 bll3471 Uncharacterized transporter bll3471 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8L3K8 2.92e-17 88 24 15 523 1 aspT Aspartate/alanine antiporter Tetragenococcus halophilus
Q57604 0.000172 47 28 1 81 4 MJ0138.1 Potassium channel protein 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14090
Feature type CDS
Gene -
Product putative transporter
Location 3128007 - 3129665 (strand: 1)
Length 1659 (nucleotides) / 552 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4634
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF02080 TrkA-C domain
PF06826 Predicted Permease Membrane Region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2985 General function prediction only (R) R Uncharacterized membrane protein YbjL, putative transporter

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07085 putative transport protein - -

Protein Sequence

MSDIALTMVMLSLAGALGLWIGNVKIYRVSLGIGGVLFGGIIVGHLAQRYGLVLNTQILHFIQEFGLILFVYTIGIQVGPGFFSSLRVSGLKLNAFAILIILLGSLVTAFIYHLFNVPLPIILGIFSGAVTNTPSLGAGQQILTDLNIDPAIISQMGMGYAMAYPMGICGILLVMWFIRVLFKINIEREAKHFNHQQNSTKETLHTINIAIRNPNLDGLLMQDIPLLNEDALVCSRLKRGDDIMVPMPSTIIQLGDLLHIVGSREDLNKVRLILGEEVDASLSTSTHQLQSVRIVVTNDAVLSKRLKDLDLKRKYDVVITRLNRAGIELIPSNNSMLQFGDILNVVGRPGAIEAITVLLGNARQKLEQVQMLPVFIGIGLGVLLGSIPIFIPGIPVALKLGLAGGPLIVALILGRIGTFGKLYWFMPPSANLALRELGIVMFLAVVGLNSGGGFIDTLIYGQGLSWIGYGIAITLLPLLIVGIMARLVFKLNYLTLCGVLAGSMTDPPALAFANSIHQNSGAAALSYATVYPLAMFLRIITPQLMALIIWAL

Flanking regions ( +/- flanking 50bp)

TTTTAGCTAGTGAGTTACTTGGCTATTTCACTTGGCATAGGATCTGTTTTATGAGTGATATTGCATTAACAATGGTGATGTTGTCATTAGCAGGCGCCTTAGGACTTTGGATAGGTAACGTTAAAATCTATCGGGTCAGTTTAGGAATTGGCGGAGTGCTGTTTGGAGGGATTATTGTCGGCCATTTAGCTCAACGTTATGGACTGGTGCTCAACACACAGATACTCCATTTTATTCAAGAATTCGGCCTTATCCTCTTTGTATATACCATTGGTATCCAAGTCGGCCCCGGTTTTTTCTCTTCTTTACGTGTATCTGGGCTTAAGCTCAATGCCTTTGCCATTTTGATTATTTTACTTGGTTCACTAGTAACAGCCTTTATTTATCACTTATTTAATGTGCCACTCCCCATTATTCTTGGCATTTTTTCTGGTGCGGTAACGAACACGCCTTCATTAGGTGCAGGGCAACAAATCCTCACCGACCTTAATATTGATCCAGCCATAATCAGTCAAATGGGAATGGGATATGCTATGGCTTACCCCATGGGAATTTGTGGCATTCTTTTGGTCATGTGGTTTATTCGCGTGCTATTTAAAATCAATATAGAGCGAGAAGCAAAACACTTTAACCATCAGCAAAACAGCACTAAAGAGACACTGCATACCATTAACATTGCCATTCGCAATCCCAATTTAGATGGCTTATTAATGCAAGATATCCCACTACTCAATGAAGATGCCCTTGTCTGTTCACGTTTGAAACGTGGCGACGATATTATGGTTCCGATGCCTTCCACTATTATTCAGTTAGGCGATTTACTGCATATTGTCGGCTCAAGAGAAGATCTCAATAAGGTTCGCCTTATTTTAGGCGAAGAAGTAGATGCTTCACTTTCTACCTCAACCCATCAATTACAATCTGTGCGCATTGTTGTCACGAATGACGCAGTATTGAGTAAACGATTAAAAGATCTCGATTTAAAAAGAAAATATGATGTTGTTATCACACGATTAAATCGAGCTGGAATTGAATTAATTCCTAGTAATAACAGTATGCTACAGTTTGGCGATATTTTAAATGTTGTGGGTAGACCTGGGGCCATAGAAGCAATTACGGTACTTTTAGGTAATGCACGACAAAAATTAGAACAAGTACAGATGTTGCCTGTTTTTATTGGCATTGGTTTAGGGGTTTTATTAGGCTCTATCCCTATTTTTATTCCGGGGATCCCTGTTGCACTAAAATTAGGTCTTGCTGGCGGGCCACTGATCGTGGCCTTGATTTTAGGCCGTATTGGTACTTTCGGGAAACTCTATTGGTTTATGCCCCCAAGTGCTAATCTTGCACTACGTGAACTCGGGATCGTCATGTTTTTGGCTGTGGTTGGCCTTAATTCCGGTGGCGGGTTTATTGATACCTTAATATATGGACAAGGGTTAAGTTGGATTGGCTATGGTATCGCGATCACACTACTCCCATTATTGATAGTCGGTATAATGGCTCGTCTCGTTTTTAAGTTAAATTACCTTACCCTATGTGGCGTACTTGCAGGCTCGATGACTGATCCTCCCGCTCTAGCATTCGCTAATTCTATTCATCAAAATAGCGGTGCAGCCGCACTTTCTTATGCCACGGTTTATCCTTTAGCTATGTTTTTACGTATCATCACGCCACAACTAATGGCACTGATTATTTGGGCTTTGTAGCGAATTTAATAGATATATTAAATGGTTGCAGTCAATTTGTTATCAAATGC