Homologs in group_2452

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19545 FBDBKF_19545 62.8 Morganella morganii S1 dgkA Diacylglycerol kinase
EHELCC_16490 EHELCC_16490 62.8 Morganella morganii S2 dgkA Diacylglycerol kinase
NLDBIP_16700 NLDBIP_16700 62.8 Morganella morganii S4 dgkA Diacylglycerol kinase
LHKJJB_16770 LHKJJB_16770 62.8 Morganella morganii S3 dgkA Diacylglycerol kinase
HKOGLL_18845 HKOGLL_18845 62.8 Morganella morganii S5 dgkA Diacylglycerol kinase
F4V73_RS18580 F4V73_RS18580 62.0 Morganella psychrotolerans - diacylglycerol kinase

Distribution of the homologs in the orthogroup group_2452

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2452

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABN4 2.08e-55 171 66 0 121 3 dgkA Diacylglycerol kinase Shigella flexneri
P0ABN1 2.08e-55 171 66 0 121 1 dgkA Diacylglycerol kinase Escherichia coli (strain K12)
P0ABN2 2.08e-55 171 66 0 121 3 dgkA Diacylglycerol kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABN3 2.08e-55 171 66 0 121 3 dgkA Diacylglycerol kinase Escherichia coli O157:H7
P44424 2.53e-37 125 54 0 115 3 dgkA Diacylglycerol kinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HY23 1.19e-31 111 53 0 113 3 dgkA Diacylglycerol kinase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZLE0 4.31e-28 102 44 0 122 3 dgkA Diacylglycerol kinase Helicobacter pylori (strain J99 / ATCC 700824)
P56411 6.59e-28 102 46 0 117 3 dgkA Diacylglycerol kinase Helicobacter pylori (strain ATCC 700392 / 26695)
Q06119 8.76e-12 61 31 1 105 3 dgkA Diacylglycerol kinase Rhizobium meliloti (strain 1021)
Q05888 7.3e-11 58 34 4 125 1 dgkA Undecaprenol kinase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P29945 3.06e-08 52 32 1 104 3 dgkA Diacylglycerol kinase Sinorhizobium sp.
Q55143 0.000114 42 33 1 81 3 dgkA Diacylglycerol kinase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13555
Feature type CDS
Gene -
Product diacylglycerol kinase
Location 3006596 - 3006967 (strand: -1)
Length 372 (nucleotides) / 123 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2452
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01219 Prokaryotic diacylglycerol kinase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0818 Lipid transport and metabolism (I) I Diacylglycerol kinase

Protein Sequence

MANQNKGLTRIIKAGGYSYQGLRAAWINEAAFRQEAIVTLIAIILAFFIDVSVLERILLIGSVVLVVILELVNSAIEAVVDRIGTERHELSGRAKDMGSAAVLVAIILGLFTWGTILWHHFFA

Flanking regions ( +/- flanking 50bp)

TTAATAGAGAAAAGTGGCAAAATAATCGTTTGTTTTCGATAGAGTTTATTATGGCTAATCAAAATAAAGGTCTTACCCGAATCATTAAAGCTGGTGGCTATTCATATCAGGGCTTACGCGCCGCTTGGATCAATGAAGCCGCTTTTAGACAAGAAGCTATTGTGACCTTAATAGCAATTATCCTTGCATTTTTTATCGATGTCAGTGTTCTAGAGCGCATTTTATTGATTGGTTCAGTCGTCCTTGTCGTTATTTTAGAACTGGTCAATAGTGCTATAGAAGCTGTCGTCGATCGCATTGGTACAGAACGTCATGAATTATCAGGACGAGCAAAGGATATGGGATCAGCTGCCGTTCTCGTCGCTATTATATTGGGATTATTTACTTGGGGAACCATTCTTTGGCATCATTTTTTTGCATAAAGTAAAAAAAATCGACAATTGTCGAAAAATAATGCAAAGATGCGTGTTTT