Homologs in group_4901

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4901

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4901

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P62609 6.53e-59 188 44 4 217 1 focC Chaperone protein FocC Escherichia coli
P62610 6.53e-59 188 44 4 217 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P37923 7.64e-59 188 44 2 203 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P31697 2.69e-58 187 45 3 217 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P59590 1.28e-57 185 44 3 218 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77249 3.04e-55 179 43 5 226 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
Q8X5K6 8.74e-51 167 41 1 208 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
Q8X5E4 5.84e-48 160 42 4 206 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P75856 2.74e-47 159 41 4 206 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P43661 3.77e-45 153 36 3 225 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P42914 1.91e-37 133 34 3 221 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P33409 1.04e-36 132 35 5 206 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P15319 4.85e-34 125 33 7 227 1 papD Chaperone protein PapD Escherichia coli
P53520 4.99e-33 122 34 9 235 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P45991 3.02e-31 117 34 8 225 3 hifB Chaperone protein HifB Haemophilus influenzae
P33128 5.97e-31 117 34 10 215 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P35757 2.48e-30 115 34 8 225 3 hifB Chaperone protein HifB Haemophilus influenzae
P21646 4.1e-30 114 32 7 230 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P77599 1.38e-29 113 33 7 210 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P75749 9.72e-29 111 32 5 196 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P26926 2.46e-28 110 33 5 214 1 caf1M Chaperone protein caf1M Yersinia pestis
P53516 1.47e-27 108 35 3 180 3 afaB Chaperone protein AfaB Escherichia coli
P46004 2.93e-26 105 32 5 205 3 aggD Chaperone protein AggD Escherichia coli
P15483 1.24e-25 103 32 6 237 3 None Chaperone protein CS3-1 Escherichia coli
P77616 4.13e-25 102 32 9 216 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P33342 6.9e-23 95 28 4 219 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P69966 1.4e-22 95 29 7 264 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 1.4e-22 95 29 7 264 3 psaB Chaperone protein PsaB Yersinia pestis
P46738 2.38e-22 94 32 3 180 3 nfaE Chaperone protein NfaE Escherichia coli
P25402 2.16e-21 91 31 9 223 3 fanE Chaperone protein FanE Escherichia coli
P33407 6.56e-21 91 27 8 255 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P25401 4.7e-20 88 27 6 204 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 4.9e-20 88 29 8 213 3 clpE Chaperone protein ClpE Escherichia coli
P53519 1.12e-19 87 28 5 228 3 cssC Chaperone protein CssC Escherichia coli
P53518 2.18e-18 83 26 5 228 3 cssC Chaperone protein CssC Escherichia coli
P33387 3.71e-18 83 27 6 206 3 sefB Chaperone protein SefB Salmonella enteritidis
P40876 4.43e-15 74 28 8 223 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P42183 8.35e-14 68 37 4 104 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli
P46001 0.000466 42 31 3 99 4 fasE Protein FasE Escherichia coli

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13450
Feature type CDS
Gene -
Product fimbria/pilus periplasmic chaperone
Location 2979752 - 2980429 (strand: 1)
Length 678 (nucleotides) / 225 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4901
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07346 fimbrial chaperone protein Two-component system -

Protein Sequence

MKKIFAFIIFLFPLIAYSNGVSLGATRIIYNSNIKQTNLVVTNSDKENSFLIQSWVSDNQGNKNNDFIVTPPLYILDANKENALRIMYTGEPLPADRESLFWMNVKAIPSLDEKLANENTLQIAIQSRIKLFYRPSGLSAYTEKYANEVTFSYKNGELIAHNPTPYHITMVNLAAADSQLPSSIMINPFSQLTLGKVNQNANTISFQTINDYGAQTPVLKKEIVH

Flanking regions ( +/- flanking 50bp)

TTTATCAAAAGTATTATTACTCCATATTCATTAGCTAATAAATATTTATTATGAAAAAGATATTTGCTTTTATTATTTTTTTATTCCCACTTATTGCTTATTCTAATGGTGTTTCATTAGGTGCTACGCGTATTATTTATAATTCTAATATTAAACAAACTAATCTTGTTGTGACTAATTCAGATAAAGAGAATAGTTTTCTAATTCAATCATGGGTATCTGATAATCAAGGTAATAAAAATAATGATTTTATTGTTACCCCTCCTTTATATATTCTTGACGCTAATAAAGAGAATGCTTTAAGAATTATGTATACAGGTGAACCTTTACCTGCAGATCGCGAAAGTTTATTTTGGATGAATGTCAAAGCTATTCCTTCTTTAGATGAAAAGCTTGCTAATGAAAATACACTACAAATTGCCATCCAGAGTCGGATAAAGCTTTTCTACCGTCCTAGTGGATTGTCCGCTTATACTGAAAAATATGCCAATGAAGTGACTTTTTCCTATAAAAATGGGGAGTTAATTGCCCATAATCCAACACCTTATCATATTACTATGGTCAATTTAGCTGCAGCCGACAGTCAACTTCCTTCAAGTATTATGATTAACCCATTTTCACAATTAACATTAGGAAAAGTTAATCAGAATGCTAATACCATTTCATTCCAAACCATTAATGATTATGGCGCACAGACTCCTGTTTTAAAAAAAGAAATCGTTCATTAATCACAGCATCTTTTTCAACCCTGTTGGTCAAAAACCATGGTTAATAAGAA