Homologs in group_4150

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4150

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4150

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EY24 0.0 848 100 0 406 3 caiB L-carnitine CoA-transferase Proteus mirabilis (strain HI4320)
Q8GB19 0.0 840 99 0 406 1 caiB L-carnitine CoA-transferase Proteus sp. (strain LE138)
B5BL56 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella paratyphi A (strain AKU_12601)
Q5PIK9 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R1R1 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella enteritidis PT4 (strain P125109)
Q8ZRX3 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57TI9 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella choleraesuis (strain SC-B67)
Q8Z9L3 0.0 729 88 0 401 3 caiB L-carnitine CoA-transferase Salmonella typhi
Q0T8F6 0.0 725 86 0 402 3 caiB L-carnitine CoA-transferase Shigella flexneri serotype 5b (strain 8401)
B5RGA5 0.0 724 87 0 401 3 caiB L-carnitine CoA-transferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
P31572 0.0 723 86 0 402 1 caiB L-carnitine CoA-transferase Escherichia coli (strain K12)
B1IRD8 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XBG3 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain K12 / DH10B)
C4ZPW4 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain K12 / MC4100 / BW2952)
P59394 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Shigella flexneri
A7ZVY8 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O9:H4 (strain HS)
B7M0D5 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O8 (strain IAI1)
B7L4G1 0.0 723 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain 55989 / EAEC)
B7N7R3 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TLV1 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RGG0 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain UTI89 / UPEC)
B1LFX1 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain SMS-3-5 / SECEC)
B6HYY9 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli (strain SE11)
Q8FLA4 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A788 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O1:K1 / APEC
B7MNP5 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O81 (strain ED1a)
B7NHE2 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MAG1 0.0 722 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YYD2 0.0 721 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA32 0.0 721 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O157:H7
A7ZHC9 0.0 719 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7UI84 0.0 719 86 0 402 3 caiB L-carnitine CoA-transferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32K59 0.0 718 86 0 402 3 caiB L-carnitine CoA-transferase Shigella dysenteriae serotype 1 (strain Sd197)
B7LWM9 0.0 717 85 0 402 3 caiB L-carnitine CoA-transferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P19413 2.89e-79 253 37 6 397 1 baiF Bile acid CoA-transferase BaiF Clostridium scindens (strain JCM 10418 / VPI 12708)
B4YST4 1.13e-76 247 35 5 403 1 baiK Bile acid CoA-transferase BaiK Clostridium scindens (strain JCM 10418 / VPI 12708)
Q1KLK0 6.86e-36 139 27 10 401 1 smtB Succinyl-CoA--L-malate CoA-transferase beta subunit Chloroflexus aurantiacus
A9WC39 6.86e-36 139 27 10 401 3 smtB Succinyl-CoA--L-malate CoA-transferase beta subunit Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A9WGE3 3.85e-32 128 27 11 400 3 Caur_2266 Succinyl-CoA--D-citramalate CoA-transferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q1KLK1 4.82e-31 126 27 10 402 1 smtA Succinyl-CoA--L-malate CoA-transferase alpha subunit Chloroflexus aurantiacus
A9WC40 1.02e-30 125 27 10 402 3 smtA Succinyl-CoA--L-malate CoA-transferase alpha subunit Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q55CV9 4.75e-29 121 25 6 349 3 DDB_G0269880 CaiB/baiF CoA-transferase family protein DDB_G0269880 Dictyostelium discoideum
A9X6P9 8.15e-29 119 27 7 353 1 uctC Acetyl-CoA:oxalate CoA-transferase Acetobacter aceti
Q7CXU0 1.53e-28 119 25 9 392 1 caiB Succinate--glutarate CoA-transferase Agrobacterium fabrum (strain C58 / ATCC 33970)
P76518 2.03e-27 115 25 9 393 1 yfdE Acetyl-CoA:oxalate CoA-transferase Escherichia coli (strain K12)
K3VD64 9.32e-26 111 25 12 417 2 FPSE_08120 Acyl-CoA transferase FPSE_08120 Fusarium pseudograminearum (strain CS3096)
Q5V468 2.8e-25 109 29 5 255 1 mct Succinyl-CoA:mesaconate CoA-transferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
G0HQ31 5.44e-25 108 25 10 375 1 mct Succinyl-CoA:mesaconate CoA-transferase Haloarcula hispanica (strain ATCC 33960 / DSM 4426 / JCM 8911 / NBRC 102182 / NCIMB 2187 / VKM B-1755)
Q82M40 2.68e-24 107 26 15 423 3 frc Formyl-CoA:oxalate CoA-transferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O87838 9.64e-24 105 26 15 423 3 frc Formyl-CoA:oxalate CoA-transferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5U921 3.8e-19 92 24 11 412 1 hadA (R)-2-hydroxy-4-methylpentanoate CoA-transferase Clostridioides difficile
Q07Q82 2.33e-18 89 24 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain BisA53)
B7MY33 3.15e-18 89 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O81 (strain ED1a)
P70473 3.89e-18 89 24 11 391 1 Amacr Alpha-methylacyl-CoA racemase Rattus norvegicus
Q6N8F8 6.72e-18 88 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8FFE8 6.97e-18 88 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q139H7 8.25e-18 88 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain BisB5)
B3QBS6 9.66e-18 88 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain TIE-1)
P69903 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Shigella flexneri
Q0T2C3 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Shigella flexneri serotype 5b (strain 8401)
Q31Y97 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Shigella boydii serotype 4 (strain Sb227)
Q1R8Z2 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain UTI89 / UPEC)
B1LMH0 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain SMS-3-5 / SECEC)
B6I6S5 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain SE11)
P69902 9.75e-18 87 24 12 416 1 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain K12)
B1IX88 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TF87 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADQ1 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O1:K1 / APEC
A8A2M8 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O9:H4 (strain HS)
B1X9P6 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain K12 / DH10B)
C4ZVR1 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M6P3 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O8 (strain IAI1)
B7NPQ8 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LBS7 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli (strain 55989 / EAEC)
B7MH34 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UG84 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZPI2 9.75e-18 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32DG9 1.19e-17 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Shigella dysenteriae serotype 1 (strain Sd197)
B7N5X4 1.19e-17 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5YYX4 1.19e-17 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBR7 1.19e-17 87 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Escherichia coli O157:H7
O09174 2.07e-17 86 24 11 391 1 Amacr Alpha-methylacyl-CoA racemase Mus musculus
A5EGD7 2.83e-17 86 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B2TWX3 3.39e-17 86 24 12 416 3 frc Formyl-CoA:oxalate CoA-transferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3YZF6 3.72e-17 86 24 15 419 3 frc Formyl-CoA:oxalate CoA-transferase Shigella sonnei (strain Ss046)
Q217M3 5.86e-17 85 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain BisB18)
A4YXN2 7.84e-17 85 23 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Bradyrhizobium sp. (strain ORS 278)
Q93AM1 1.24e-16 84 24 13 410 1 fldA Cinnamoyl-CoA:phenyllactate CoA-transferase Clostridium sporogenes
Q89QH2 3.49e-16 83 22 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2IUI7 4.77e-16 82 21 14 421 3 frc Formyl-CoA:oxalate CoA-transferase Rhodopseudomonas palustris (strain HaA2)
Q9KJF0 4.92e-16 82 23 8 396 1 bbsE Succinyl-CoA:(R)-benzylsuccinate CoA-transferase subunit BbsE Thauera aromatica
O06543 5.16e-16 82 29 9 272 1 mcr Alpha-methylacyl-CoA racemase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9HAC7 5.77e-16 82 23 12 414 1 SUGCT Succinate--hydroxymethylglutarate CoA-transferase Homo sapiens
Q9UHK6 2.98e-15 80 25 15 393 1 AMACR Alpha-methylacyl-CoA racemase Homo sapiens
B6JE29 7.29e-15 79 22 18 427 3 frc Formyl-CoA:oxalate CoA-transferase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q7TNE1 2.9e-14 77 26 6 272 1 Sugct Succinate--hydroxymethylglutarate CoA-transferase Mus musculus
P96877 3.2e-14 77 25 6 258 1 Rv3272 Probable fatty acyl-CoA transferase Rv3272 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q68FU4 1.57e-13 75 26 6 272 2 Sugct Succinate--hydroxymethylglutarate CoA-transferase Rattus norvegicus
O06644 2.13e-13 75 28 6 215 1 frc Formyl-CoA:oxalate CoA-transferase Oxalobacter formigenes
A6W2K8 3.85e-13 74 28 6 209 1 dddD CoA-transferase/lyase DddD Marinomonas sp. (strain MWYL1)
A6W2K8 2.33e-10 66 22 10 422 1 dddD CoA-transferase/lyase DddD Marinomonas sp. (strain MWYL1)
Q09618 3.19e-11 67 25 11 263 3 ZK892.4 CaiB/baiF CoA-transferase family protein ZK892.4 Caenorhabditis elegans
Q8J0F0 5.07e-11 67 25 8 241 3 cefD2 Isopenicillin N epimerase component 2 Hapsidospora chrysogena
P95149 7.92e-10 64 29 6 209 1 Rv1866 Probable CoA-transferase Rv1866 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5P5Z3 1.61e-09 62 22 13 353 1 iaaL Phenylsuccinyl-CoA transferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9KJE9 4.47e-06 52 21 12 401 1 bbsF Succinyl-CoA:(R)-benzylsuccinate CoA-transferase subunit BbsF Thauera aromatica

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13085
Feature type CDS
Gene caiB
Product L-carnitine CoA-transferase
Location 2905273 - 2906493 (strand: 1)
Length 1221 (nucleotides) / 406 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4150
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF02515 CoA-transferase family III

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1804 Lipid transport and metabolism (I) I Crotonobetainyl-CoA:carnitine CoA-transferase CaiB and related acyl-CoA transferases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08298 L-carnitine CoA-transferase [EC:2.8.3.21] - -

Protein Sequence

MTEHLPMPQFGPLAGVRVVFSGIEIAGPFAGQMFAEWGAEVIWIENVAWADTIRVQPHYPQLSRRNLHALSLNIFKEEGRDAFLKLMETTDIFIEASKGPAFARRGITDEVLWEHNPKLVIAHLSGFGQYGDPQYTNLPAYNTIAQAFSGYLIQNGDKDQPMPAFPYTADYFSGMTATTSALAALYKVQQTGKGESIDIAMYEVMLRMGQYFMMDYFNGGEICPRMTKGKDPYYAGCGLYRCQDGYIVMEVVGITQIEEIFKDIGLAHLLGTPEVPKGTQLIHRINCPHGQLFEDKLDEWLANQPITAVLKRLSELNIASAKVLTIPELEGNPQYVARESITQWKTMSGETCKGPNIMPKFKNNPGKIWRGMPAHGMDTNAILKNIGYSDEQIRELVDKGLAKIVE

Flanking regions ( +/- flanking 50bp)

TTAACATCAAGTGAGGGAGTGTTCAAACAGTCCACTGACGAGGTGACATTATGACAGAACATTTACCCATGCCACAATTTGGGCCACTAGCTGGAGTTCGTGTGGTGTTTTCAGGTATTGAGATTGCCGGGCCATTTGCAGGACAGATGTTTGCAGAGTGGGGTGCGGAGGTCATTTGGATTGAAAACGTTGCATGGGCGGATACCATTCGTGTTCAACCCCATTATCCACAGCTTTCCCGTCGCAATCTACATGCGTTATCGTTAAATATTTTCAAAGAAGAAGGCCGTGATGCTTTCCTAAAATTAATGGAAACCACGGATATTTTTATCGAAGCCAGCAAAGGTCCTGCCTTTGCCCGTCGCGGTATTACCGATGAGGTTTTATGGGAGCATAACCCTAAATTGGTTATCGCGCACTTATCCGGCTTTGGTCAATATGGCGATCCGCAATATACCAACCTTCCAGCCTACAACACTATTGCTCAAGCATTTAGTGGTTATCTCATTCAAAACGGCGATAAAGACCAACCTATGCCCGCCTTTCCTTATACCGCTGACTATTTCTCTGGTATGACGGCAACCACCTCAGCATTAGCGGCACTGTACAAAGTGCAACAAACGGGCAAAGGGGAAAGTATTGATATTGCAATGTATGAAGTGATGTTGCGAATGGGGCAATACTTCATGATGGACTATTTTAATGGCGGAGAAATCTGTCCACGAATGACCAAAGGCAAAGATCCATACTATGCCGGCTGTGGCTTATACCGTTGCCAAGATGGTTATATCGTGATGGAAGTGGTCGGCATCACTCAAATTGAAGAAATTTTTAAAGATATTGGTCTTGCTCATCTATTAGGTACTCCTGAAGTCCCCAAAGGGACACAACTGATCCACCGTATTAATTGCCCTCATGGTCAACTCTTTGAAGATAAATTAGATGAGTGGCTAGCCAACCAGCCTATTACCGCCGTACTAAAACGCCTATCTGAACTCAATATTGCCAGTGCAAAAGTGTTAACCATTCCTGAATTAGAAGGCAATCCACAATACGTGGCTCGAGAGTCAATTACTCAATGGAAAACGATGAGTGGTGAAACCTGTAAGGGACCAAATATCATGCCGAAATTCAAAAATAATCCAGGAAAAATCTGGCGTGGTATGCCTGCTCACGGCATGGATACCAATGCGATTTTGAAAAATATCGGTTATAGCGACGAACAAATTAGGGAGCTAGTCGATAAAGGGCTAGCTAAAATCGTAGAGTAAATACCGTTAGACTCAGGTACAAGTGGCACTATCCCACAATACCTGAGCTT