Homologs in group_4613

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4613

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4613

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FLA3 8.44e-138 390 75 0 256 3 fixA Protein FixA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MAG4 8.44e-138 390 75 0 256 3 fixA Protein FixA Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI87 8.44e-138 390 75 0 256 3 fixA Protein FixA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0TLU8 1.25e-137 390 75 0 256 3 fixA Protein FixA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MNP8 1.25e-137 390 75 0 256 3 fixA Protein FixA Escherichia coli O81 (strain ED1a)
P59673 4.2e-130 371 74 0 256 3 fixA Protein FixA Shigella flexneri
Q0T8F3 4.2e-130 371 74 0 256 3 fixA Protein FixA Shigella flexneri serotype 5b (strain 8401)
B6HYZ2 4.2e-130 371 74 0 256 3 fixA Protein FixA Escherichia coli (strain SE11)
B7M0D8 4.2e-130 371 74 0 256 3 fixA Protein FixA Escherichia coli O8 (strain IAI1)
B7L4G4 4.2e-130 371 74 0 256 3 fixA Protein FixA Escherichia coli (strain 55989 / EAEC)
B7LWN2 1.56e-129 370 74 0 256 3 fixA Protein FixA Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P60566 1.62e-129 369 74 0 256 1 fixA Protein FixA Escherichia coli (strain K12)
B1IRD5 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZVZ3 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli O9:H4 (strain HS)
B1XBG6 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli (strain K12 / DH10B)
C4ZPW7 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli (strain K12 / MC4100 / BW2952)
P60567 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli O157:H7
A7ZHD4 1.62e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N7R6 1.75e-129 369 75 0 256 3 fixA Protein FixA Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B4T6K2 4.01e-129 369 72 0 256 3 fixA Protein FixA Salmonella newport (strain SL254)
B5F756 4.01e-129 369 72 0 256 3 fixA Protein FixA Salmonella agona (strain SL483)
B1LFX5 4.19e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli (strain SMS-3-5 / SECEC)
B7NHE5 4.19e-129 369 74 0 256 3 fixA Protein FixA Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5RGA8 2.34e-128 367 72 0 256 3 fixA Protein FixA Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FHH0 2.34e-128 367 72 0 256 3 fixA Protein FixA Salmonella dublin (strain CT_02021853)
Q8Z9L0 7.98e-128 365 72 0 256 3 fixA Protein FixA Salmonella typhi
B5BL59 7.98e-128 365 72 0 256 3 fixA Protein FixA Salmonella paratyphi A (strain AKU_12601)
Q5PIN4 7.98e-128 365 72 0 256 3 fixA Protein FixA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZRX0 8.33e-128 365 72 0 256 3 fixA Protein FixA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYK3 8.33e-128 365 72 0 256 3 fixA Protein FixA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
P76201 1.35e-82 250 52 4 255 3 ydiQ Putative electron transfer flavoprotein subunit YdiQ Escherichia coli (strain K12)
P9WNG7 1.78e-26 107 32 8 259 1 etfB Electron transfer flavoprotein subunit beta Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNG6 1.78e-26 107 32 8 259 3 etfB Electron transfer flavoprotein subunit beta Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64098 1.78e-26 107 32 8 259 1 etfB Electron transfer flavoprotein subunit beta Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
H6LBB0 7.05e-25 102 29 7 251 1 lctB Lactate dehydrogenase (NAD(+),ferredoxin) subunit LctB Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
O33095 3.49e-24 100 31 8 259 3 etfB Electron transfer flavoprotein subunit beta Mycobacterium leprae (strain TN)
P97089 6.61e-21 92 30 5 213 3 etfB Electron transfer flavoprotein subunit beta Thermoanaerobacterium thermosaccharolyticum (strain ATCC 7956 / DSM 571 / NCIMB 9385 / NCA 3814 / NCTC 13789 / WDCM 00135 / 2032)
P52040 2.25e-20 90 28 3 211 3 etfB Electron transfer flavoprotein subunit beta Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
H6LGM7 3.01e-20 90 26 3 216 1 carD Caffeyl-CoA reductase-Etf complex subunit CarD Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
P94550 3.06e-20 90 33 6 204 3 etfB Electron transfer flavoprotein subunit beta Bacillus subtilis (strain 168)
O85691 3.05e-17 82 27 3 210 3 etfB Electron transfer flavoprotein subunit beta Megasphaera elsdenii
G3KIM7 1.25e-16 80 28 6 223 1 acrB Acryloyl-CoA reductase electron transfer subunit gamma Anaerotignum propionicum
P38975 1.07e-15 77 29 5 224 1 etfB Electron transfer flavoprotein subunit beta Paracoccus denitrificans
P53576 1.53e-15 77 26 6 256 3 fixA Protein FixA Azotobacter vinelandii
Q53210 1.72e-15 77 27 6 252 3 fixA Protein FixA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0AZ34 8.48e-15 75 31 4 196 1 etfB Electron transfer flavoprotein subunit beta Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
P53577 8.99e-15 75 28 4 224 3 fixA Protein FixA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6UAQ8 5.27e-13 70 28 5 223 1 ETFB Electron transfer flavoprotein subunit beta Sus scrofa
Q9DCW4 5.49e-13 70 27 5 222 1 Etfb Electron transfer flavoprotein subunit beta Mus musculus
P09818 7.85e-13 70 28 7 250 3 fixA Protein FixA Rhizobium meliloti (strain 1021)
Q2TBV3 1.03e-12 69 30 3 192 1 ETFB Electron transfer flavoprotein subunit beta Bos taurus
Q05559 2.75e-12 68 26 6 247 3 fixA Protein FixA Rhizobium leguminosarum bv. phaseoli
P53570 6.18e-12 67 27 4 216 1 etfB Electron transfer flavoprotein subunit beta Methylophilus methylotrophus
Q5RFK0 7.68e-12 67 29 3 192 2 ETFB Electron transfer flavoprotein subunit beta Pongo abelii
P38117 9.25e-12 66 29 3 192 1 ETFB Electron transfer flavoprotein subunit beta Homo sapiens
P26482 9.55e-12 67 28 5 252 3 fixA Protein FixA Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q68FU3 1.29e-11 66 27 5 223 1 Etfb Electron transfer flavoprotein subunit beta Rattus norvegicus
Q9UTH2 1.57e-11 65 27 6 224 3 SPAC1805.02c Probable electron transfer flavoprotein subunit beta Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7F9U3 1.7e-10 63 27 3 176 2 ETFB Electron transfer flavoprotein subunit beta, mitochondrial Oryza sativa subsp. japonica
A2XQV4 2.24e-10 62 27 3 176 3 ETFB Electron transfer flavoprotein subunit beta, mitochondrial Oryza sativa subsp. indica
Q9LSW8 3.2e-10 62 28 3 175 1 ETFB Electron transfer flavoprotein subunit beta, mitochondrial Arabidopsis thaliana
P53575 3.23e-10 62 25 7 226 3 etfB Electron transfer flavoprotein subunit beta Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P42940 1.31e-09 60 24 5 225 1 CIR1 Probable electron transfer flavoprotein subunit beta Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54YZ4 1.79e-09 60 29 5 174 3 etfb Electron transfer flavoprotein subunit beta Dictyostelium discoideum
Q9HZP6 4.42e-08 55 25 4 228 3 etfB Electron transfer flavoprotein subunit beta Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q46908 0.000634 43 30 3 89 3 ygcR Putative electron transfer flavoprotein subunit YgcR Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13070
Feature type CDS
Gene -
Product electron transfer flavoprotein FixA
Location 2901132 - 2901905 (strand: -1)
Length 774 (nucleotides) / 257 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4613
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF01012 Electron transfer flavoprotein domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2086 Energy production and conversion (C) C Electron transfer flavoprotein, alpha and beta subunits

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03521 electron transfer flavoprotein beta subunit - -

Protein Sequence

MKIITCYKSVPDEQDIVVNNADGSLDFSRANNKISQYDLNAIEAANQLKTQLDGIQITAMSVGGNALTNAKARKDVLSRGADDLVVVVDEQLEASLPYQTATVLAAAATKQGYDLILCGDGSADLSSQQVSLLVGEILNIPAINGVNKIVSITTDSITVERELENEIETLTITLPAVIAVSTDINSPQIPSMKAILGAAKKPVQQWSVADLGLEPITPRSEQTVLAPKQKVRQRIIIEGDGDDQIAEFAEYLRKIIK

Flanking regions ( +/- flanking 50bp)

ATATTACATTGCCAGAGTAAATGACATATTTATTAATTTCAGGAGATGTAATGAAGATTATTACATGTTACAAGAGTGTTCCCGATGAACAGGATATTGTGGTCAATAATGCCGATGGTTCACTCGATTTTTCGCGCGCCAATAACAAAATTAGCCAATATGATTTAAATGCGATTGAAGCGGCAAATCAGTTAAAAACACAACTTGATGGTATTCAAATCACGGCAATGAGCGTAGGTGGTAACGCGCTGACTAACGCTAAAGCACGTAAAGATGTGTTATCTCGTGGTGCTGATGATCTCGTGGTGGTGGTCGATGAGCAATTGGAAGCTTCTCTTCCTTATCAAACGGCGACAGTGCTTGCAGCAGCTGCAACTAAGCAGGGGTACGATCTTATCTTATGTGGTGATGGCTCGGCAGATCTAAGTTCCCAACAAGTGAGTTTGCTGGTGGGGGAGATCTTGAATATTCCTGCCATTAATGGGGTTAATAAAATTGTTTCTATTACAACTGATTCCATCACCGTTGAACGCGAATTAGAAAACGAAATTGAAACGCTTACTATCACCTTACCTGCGGTGATTGCCGTTTCTACCGATATCAACTCTCCGCAAATTCCATCCATGAAAGCCATTTTAGGTGCCGCTAAAAAGCCGGTTCAACAATGGAGTGTGGCCGATCTTGGTTTAGAGCCCATAACGCCACGTTCAGAGCAAACCGTGTTAGCACCGAAACAAAAAGTACGTCAGCGCATCATTATTGAAGGTGATGGCGATGATCAAATTGCTGAATTTGCAGAATATTTACGAAAAATTATTAAGTAATAGGGGGAGTTATGAGCCAGTTTTCAACTGTTTGGGTGTTGAGTGATGTA