Homologs in group_3016

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17885 FBDBKF_17885 99.9 Morganella morganii S1 pksD Acyl transferase domain in polyketide synthase (PKS) enzymes
EHELCC_06450 EHELCC_06450 99.9 Morganella morganii S2 pksD Acyl transferase domain in polyketide synthase (PKS) enzymes
NLDBIP_06770 NLDBIP_06770 99.9 Morganella morganii S4 pksD Acyl transferase domain in polyketide synthase (PKS) enzymes
LHKJJB_18890 LHKJJB_18890 99.9 Morganella morganii S3 pksD Acyl transferase domain in polyketide synthase (PKS) enzymes
HKOGLL_04620 HKOGLL_04620 99.9 Morganella morganii S5 pksD Acyl transferase domain in polyketide synthase (PKS) enzymes

Distribution of the homologs in the orthogroup group_3016

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3016

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7TXL6 2.46e-146 501 34 12 903 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE1 2.53e-146 501 34 12 903 1 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE0 2.53e-146 501 34 12 903 3 ppsE Phenolphthiocerol/phthiocerol polyketide synthase subunit E Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
D4AU31 6.41e-120 431 31 21 920 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU31 1.78e-11 74 22 7 285 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
B2HIL7 3.23e-119 427 32 19 897 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
B2HIL7 2.96e-25 120 27 10 373 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium marinum (strain ATCC BAA-535 / M)
A0A2I2F262 2.89e-118 425 31 19 922 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
A0A2I2F262 6.35e-13 79 23 8 292 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
I6XD69 3.28e-114 413 30 19 887 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 1.19e-107 392 29 18 896 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 7.85e-20 102 26 13 402 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
I6XD69 3.63e-16 90 31 3 177 1 pks12 Mycoketide-CoA synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXK8 7.62e-114 410 31 20 897 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TXK8 7.41e-23 112 28 11 366 1 pks15/1 Phenolphthiocerol synthesis polyketide synthase type I Pks15/1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
E9F8M3 5.13e-112 405 30 19 923 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9F8M3 4.55e-11 73 22 7 301 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q03132 1.49e-109 398 32 28 910 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 1.36e-101 372 29 18 900 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
Q03132 3.8e-15 86 25 9 376 1 eryA 6-deoxyerythronolide-B synthase EryA2, modules 3 and 4 Saccharopolyspora erythraea
G3XNF4 1.79e-109 394 31 22 925 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q03131 1.98e-109 397 31 29 913 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 8.31e-106 385 30 21 894 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 2.38e-21 107 25 6 362 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 2.32e-14 84 24 9 302 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03131 3.14e-13 80 21 12 420 1 eryA 6-deoxyerythronolide-B synthase EryA1, modules 1 and 2 Saccharopolyspora erythraea
Q03133 2.05e-107 390 30 21 897 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 1.82e-94 348 29 22 911 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 7.46e-21 105 24 16 464 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q03133 4.26e-14 83 24 10 323 1 eryA 6-deoxyerythronolide-B synthase EryA3, modules 5 and 6 Saccharopolyspora erythraea
Q7TXL7 1.71e-105 381 30 23 908 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TXL7 6.08e-13 79 27 4 199 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE3 4.35e-105 380 29 23 908 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE3 6.13e-13 79 27 4 199 1 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit D Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE2 4.35e-105 380 29 23 908 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQE2 6.13e-13 79 27 4 199 3 ppsD Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9ZGI2 4.22e-104 371 29 23 896 1 pikAIV Narbonolide/10-deoxymethynolide synthase PikA4, module 6 Streptomyces venezuelae
Q9ZGI5 9.11e-102 372 30 21 962 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 4.88e-97 357 29 25 905 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 1.24e-76 290 38 6 438 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 1.44e-20 104 24 8 355 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 5.91e-17 92 25 8 307 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
Q9ZGI5 4.54e-10 70 28 6 201 1 pikAI Narbonolide/10-deoxymethynolide synthase PikA1, modules 1 and 2 Streptomyces venezuelae
P9WQE5 1.62e-101 366 32 21 803 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE5 4.11e-07 60 20 12 472 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE4 1.62e-101 366 32 21 803 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQE4 4.11e-07 60 20 12 472 3 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXL9 1.68e-101 366 32 21 803 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TXL9 4.71e-07 59 20 12 472 1 ppsB Phenolphthiocerol/phthiocerol polyketide synthase subunit B Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q84HC6 2.27e-101 367 29 19 883 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
Q84HC6 9.64e-14 82 21 10 365 1 ncsB Neocarzinostatin naphthoate synthase Streptomyces carzinostaticus
W3X8X8 2.38e-101 370 29 26 907 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
W3X8X8 5.39e-18 96 25 12 408 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
Q9ZGI3 3.2e-101 365 29 23 905 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q9ZGI3 6.97e-10 69 24 10 321 1 pikAIII Narbonolide/10-deoxymethynolide synthase PikA3, module 5 Streptomyces venezuelae
Q9ZGI4 5.68e-101 370 28 26 927 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 1.7e-98 362 29 19 896 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
Q9ZGI4 3.86e-08 63 23 10 343 1 pikAII Narbonolide/10-deoxymethynolide synthase PikA2, modules 3 and 4 Streptomyces venezuelae
A1KQG0 7.09e-100 365 28 20 911 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KQG0 7.66e-11 72 25 9 278 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P9WQE7 1.14e-98 360 31 15 794 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE7 2.01e-19 100 26 17 467 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE9 1.34e-98 360 28 20 911 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE9 8.05e-11 72 25 9 278 1 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQE8 1.34e-98 360 28 20 911 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQE8 8.05e-11 72 25 9 278 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9F4 1.34e-98 360 28 20 911 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A5U9F4 8.05e-11 72 25 9 278 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q7TVK8 1.34e-98 360 28 20 911 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TVK8 8.05e-11 72 25 9 278 3 pks2 Phthioceranic/hydroxyphthioceranic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQE6 1.38e-98 359 31 15 794 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQE6 2.13e-19 100 26 17 467 3 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0R1E8 4.3e-98 358 30 23 830 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0R1E8 1.21e-09 68 25 14 349 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7TXM0 2.02e-97 356 31 15 794 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TXM0 2.1e-19 100 26 17 467 1 ppsA Phenolphthiocerol/phthiocerol polyketide synthase subunit A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P96202 1.19e-96 354 32 18 808 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P96202 7.22e-19 99 26 9 358 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TXL8 1.19e-96 354 32 18 808 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TXL8 7.22e-19 99 26 9 358 1 ppsC Phenolphthiocerol/phthiocerol polyketide synthase subunit C Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O53901 2.24e-96 353 30 22 832 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53901 1.94e-10 71 24 6 277 1 pks5 Mycocerosic acid synthase-like polyketide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A2I2F2N6 7.73e-96 352 29 25 924 1 cfoA Chalcone synthase cfoA Aspergillus candidus
A0A2I2F2N6 1.15e-14 85 27 10 295 1 cfoA Chalcone synthase cfoA Aspergillus candidus
Q07017 1.2e-93 345 28 23 927 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 5.88e-71 271 35 7 445 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.43e-14 84 27 3 195 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
Q07017 1.43e-14 84 27 3 195 3 orfB Oleandomycin polyketide synthase, modules 5 and 6 Streptomyces antibioticus
G1XU04 3.23e-93 342 30 26 820 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
G1XU04 4.14e-22 109 22 11 396 1 AOL_s00215g283 6-methylsalicylic acid synthase AOL_s00215g283 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
Q02251 5.42e-93 342 31 24 843 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q02251 9.72e-09 65 33 3 130 1 mas Mycocerosic acid synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A089QRB9 9.29e-92 338 30 23 831 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A089QRB9 1.24e-09 68 30 2 136 1 msl3 Mycolipanoate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q869W9 4.47e-91 337 28 16 811 2 pks16 Probable polyketide synthase 16 Dictyostelium discoideum
A0A0Y0M151 7.95e-91 335 27 27 920 1 cla2 Highly reducing polyketide synthase cla2 Cladosporium cladosporioides
P9WET8 8.43e-91 335 29 26 940 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
P9WET8 0.000678 49 19 7 374 2 Preu1 Highly reducing polyketide synthase Preu1 Preussia isomera
A0A098D8A0 1.89e-90 334 27 26 947 2 ZEA2 Highly reducing polyketide synthase ZEA2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B6F209 2.48e-90 335 29 32 950 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
B6F209 1.67e-10 71 22 12 358 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
B6F209 9.49e-08 62 27 3 146 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
B3FWT3 2.83e-90 333 29 27 920 1 hpm8 Reducing polyketide synthase hmp8 Hypomyces subiculosus
A0A455LLX1 5.15e-90 333 29 33 909 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
A0A455LLX1 1.39e-24 117 30 6 238 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
A0A455LLX1 9.67e-14 82 28 8 219 1 atnH Highly reducing polyketide synthase atnH Arthrinium sp.
Q9R9J1 1.49e-89 332 41 11 478 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 5.81e-07 59 21 14 411 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
A0A0A0RM07 1.62e-89 330 29 22 830 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A0A0RM07 2.72e-12 77 22 11 347 1 MLNS Mellein synthase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
W6QL47 2.81e-89 330 30 21 766 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
W6QL47 4.01e-25 119 31 13 325 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
W6QL47 5.54e-19 99 28 11 259 3 mpaC Non-reducing polyketide synthase mapC Penicillium roqueforti (strain FM164)
E9F646 4.06e-89 330 27 21 910 1 Pks1 Polyketide synthase 1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P40806 9.27e-89 330 39 6 443 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 4.75e-80 301 38 9 450 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 4.08e-51 205 30 7 427 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1.89e-13 81 21 8 363 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1e-10 72 20 11 466 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 9.46e-10 68 22 17 479 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
E9EHG2 2.01e-88 327 27 23 929 2 Pks2 Polyketide synthase 2 Metarhizium acridum (strain CQMa 102)
A0A443HK81 6.21e-88 326 27 23 966 1 VdtA Non-reducing polyketide synthase VdtA Byssochlamys spectabilis
B3FWU0 6.29e-88 326 29 27 846 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
B3FWU0 0.000527 50 28 6 190 1 rdc5 Reducing polyketide synthase rdc5 Metacordyceps chlamydosporia
A0A0B4H8J1 6.35e-88 326 28 23 907 2 Pks2 Polyketide synthase 2 Metarhizium brunneum (strain ARSEF 3297)
A0A0B4FTU6 7.51e-88 325 27 23 912 1 Pks1 Polyketide synthase 1 Metarhizium anisopliae (strain ARSEF 549)
A0A0B4ESU9 1.07e-87 325 27 23 912 1 Pks1 Polyketide synthase 1 Metarhizium brunneum (strain ARSEF 3297)
E9ET39 1.32e-87 325 27 22 937 2 Pks2 Polyketide synthase 2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A5ABG0 1.34e-87 326 27 25 949 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A5ABG0 1.57e-16 91 21 28 816 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A1P8NTI3 1.51e-87 323 27 26 952 2 pks8 Non-reducing polyketide synthase 8 Pestalotiopsis microspora
A0A0B4H4F0 4.85e-87 323 27 23 912 1 Pks1 Polyketide synthase 1 Metarhizium majus (strain ARSEF 297)
A7UMW1 5.04e-87 323 27 23 905 2 PKS1 Non-reducing polyketide synthase 1 Elsinoe fawcettii
A0A0B4G9F9 6.41e-87 322 27 21 910 1 Pks1 Polyketide synthase 1 Metarhizium guizhouense (strain ARSEF 977)
A0A0N7D4P6 7.51e-87 322 29 27 911 2 Dhc3 Highly reducing polyketide synthase Dhc3 Alternaria cinerariae
A0A0H4ADX3 8.67e-87 321 28 18 908 2 None Non-reducing polyketide synthase PKS19 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0D1N9 9.67e-87 322 26 20 918 1 terA Non-reducing polyketide synthase terA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A2U8NEV6 1.37e-86 321 27 21 903 1 Pks1 Polyketide synthase 1 Metarhizium acridum (strain CQMa 102)
O31782 1.43e-86 322 39 7 467 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 6.11e-70 268 32 13 552 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 3.54e-68 262 36 14 468 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.12e-22 111 24 12 408 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 1.25e-11 75 23 9 352 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 4.92e-05 53 19 2 162 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
A0A0B4FLB2 1.74e-86 321 27 25 908 2 Pks2 Polyketide synthase 2 Metarhizium anisopliae (strain ARSEF 549)
Q869X2 2.25e-86 321 27 17 812 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
Q869X2 1.7e-05 54 23 17 393 3 pks17 Probable polyketide synthase 17 Dictyostelium discoideum
C5H885 2.42e-86 321 29 28 910 3 rads1 Reducing polyketide synthase rads1 Floropilus chiversii
A0A6S5ZY48 3.39e-86 320 26 27 921 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
A0A6S5ZY48 4.48e-21 106 30 6 226 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
A0A6S5ZY48 7.99e-14 82 38 2 126 2 g433 Highly reducing polyketide synthase g433 Fusarium sp.
P9WES9 5.49e-86 319 26 21 906 1 PFUR17_0229 Non-reducing polyketide synthase PFUR17_0229 Pseudevernia furfuracea
A0A0B4I1J8 1.07e-85 318 27 26 910 2 Pks2 Polyketide synthase 2 Metarhizium majus (strain ARSEF 297)
A0A3G9GQ29 1.12e-85 319 28 23 881 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A3G9GQ29 8.39e-12 75 23 10 375 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A3G9GQ29 6.82e-08 62 23 4 238 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A3G9GQ29 1.52e-06 58 24 9 247 1 cdmE 6-hydroxymellein synthase cdmE Talaromyces verruculosus
A0A8F4SKJ7 1.18e-85 318 28 26 916 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
A0A8F4SKJ7 2.04e-22 110 30 10 265 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
A0A8F4SKJ7 3.08e-15 87 28 7 238 1 atr1 Non-reducing polyketide synthase atr1 Stereocaulon alpinum
B3FWT6 1.2e-85 318 27 27 953 1 rdc1 Non-reducing polyketide synthase rdc1 Metacordyceps chlamydosporia
A0A0B4I1L1 1.43e-85 318 27 25 908 2 Pks2 Polyketide synthase 2 Metarhizium guizhouense (strain ARSEF 977)
A0A1B4XBH3 1.66e-85 318 27 29 948 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
A0A1B4XBH3 0.000102 52 26 3 167 3 sdnO Highly reducing polyketide synthase sdnO Sordaria araneosa
A0A0A2JW91 1.78e-85 318 27 26 944 1 cnsI Highly reducing polyketide synthase cnsI Penicillium expansum
B6HNK3 1.97e-85 318 27 31 975 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HNK3 5.67e-13 79 26 5 222 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HNK3 6.93e-10 69 27 13 295 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HNK3 9.35e-07 58 25 5 223 3 sorA Highly reducing polyketide synthase sorA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
L7X8J4 3.44e-85 317 28 26 898 1 curS1 Highly reducing polyketide synthase curS1 Aspergillus terreus
I6X8D2 7.31e-85 315 27 30 986 1 pks13 Polyketide synthase Pks13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
D9N1A1 1.22e-84 315 30 28 845 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
D9N1A1 2.41e-20 103 25 14 432 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
D9N1A1 5.04e-19 99 32 11 232 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
D9N1A1 2.07e-10 70 21 8 353 2 ACTTS3 Highly reducing polyketide synthase ACTTS3 Alternaria alternata
P9WEX0 1.29e-84 315 28 27 913 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
P9WEX0 1.62e-09 68 26 12 282 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
P9WEX0 5.15e-09 66 23 11 321 1 dpasA Non-reducing polyketide synthase dpasA Apiospora sacchari
M2YKT6 1.58e-84 315 29 27 949 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
M2YKT6 2.45e-06 57 30 2 126 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
M2YKT6 0.000219 51 21 4 193 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
B8MKY6 2.4e-84 314 27 29 971 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MKY6 7.06e-06 56 31 3 116 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MKY6 8.45e-05 52 22 8 269 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MKY6 0.000623 49 20 15 362 1 tstA Highly reducing polyketide synthase tstA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A0A193PS74 4.04e-84 313 28 25 919 1 stbA Non-reducing polyketide synthase stbA Stachybotrys bisbyi
Q0D159 4.72e-84 314 28 35 967 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G0R6S8 6.28e-84 313 27 31 934 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
G0R6S8 1.08e-09 68 29 8 216 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
G0R6S8 6.56e-09 66 28 5 184 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
G0R6S8 3.73e-08 63 27 5 222 2 sor1 Highly reducing polyketide synthase sor1 Hypocrea jecorina (strain QM6a)
Q4WZA8 7.17e-84 312 26 26 974 1 alb1 Conidial pigment polyketide synthase alb1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5KTM9 7.75e-84 313 27 28 976 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
Q5KTM9 8.76e-26 121 28 16 401 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
Q5KTM9 2.34e-12 77 30 10 232 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
Q5KTM9 7e-11 72 23 11 355 1 alt5 Highly reducing polyketide synthase alt5 Alternaria solani
A0A2U8NET4 8.92e-84 312 26 18 914 1 Pks1 Polyketide synthase 1 Metarhizium album (strain ARSEF 1941)
F1DBA9 9.02e-84 312 30 25 773 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
F1DBA9 5.61e-23 112 28 8 316 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
F1DBA9 6.42e-19 99 27 15 346 1 mpaC Non-reducing polyketide synthase mapC Penicillium brevicompactum
A0A6H0YV38 1.44e-83 311 26 17 898 2 crz7 Non-reducing polyketide synthase crz7 Cladonia metacorallifera
A0A443HK66 1.7e-83 311 29 23 813 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
A0A443HK66 8.64e-10 68 31 5 147 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
A0A443HK66 0.000614 49 35 4 105 3 VdtX Highly reducing polyketide synthase VdtX Byssochlamys spectabilis
Q5ATJ7 2.06e-83 311 26 24 923 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATJ7 1.64e-23 114 26 15 422 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATJ7 2.75e-21 107 30 8 247 1 ausA Non-reducing polyketide synthase ausA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1W5T1T1 2.11e-83 311 26 25 944 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
A0A1W5T1T1 1.52e-06 58 22 9 355 2 poxF Highly reducing polyketide synthase poxF Penicillium oxalicum
G0REX6 3.97e-83 311 29 37 961 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
G0REX6 3.68e-17 93 19 24 783 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
G0REX6 1.03e-15 88 30 4 186 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
G0REX6 4.65e-14 83 32 6 165 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
A0A0U5GK88 4.91e-83 310 27 27 958 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
A0A0U5GK88 4.74e-13 79 38 4 135 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
A0A0U5GK88 2.45e-11 73 32 4 157 1 ausV Highly reducing polyketide synthase ausV Aspergillus calidoustus
Q5ATG8 5.48e-83 310 29 31 962 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATG8 1.48e-21 107 30 3 195 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATG8 1.69e-17 94 33 9 220 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B8MV60 6.81e-83 309 27 26 946 3 tpeB Non-reducing polyketide synthase tpeB Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
P96284 7.31e-83 286 38 10 436 1 pks15 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WET9 1.44e-82 308 27 20 900 1 PvBS090_009107 Non-reducing polyketide synthase PvBS090_009107 Byssochlamys spectabilis
A0A482N9V7 1.77e-82 309 28 29 948 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A482N9V7 9.03e-19 98 32 4 197 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A482N9V7 1.62e-18 97 36 6 168 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A482N9V7 2.92e-07 60 22 4 205 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
I1RF58 2.29e-82 307 27 27 948 1 PKS12 Non-reducing polyketide synthase PKS12 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q0CJ59 2.32e-82 306 28 17 821 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CJ59 2.11e-18 97 21 14 456 1 atX 6-methylsalicylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
B8NYX0 4.81e-82 300 29 23 799 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NYX0 3.37e-09 66 22 8 261 2 fluP Cluster 41 polyketide synthase Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P9WET3 5.57e-82 306 26 22 908 1 Preu8 Non-reducing polyketide synthase Preu8 Preussia isomera
A0A0N0DCA3 5.8e-82 306 27 28 951 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
A0A0N0DCA3 1.1e-05 55 21 3 205 2 DEP5 Reducing polyketide synthase DEP5 Fusarium langsethiae
Q03149 5.96e-82 306 27 27 911 1 wA Conidial yellow pigment biosynthesis polyketide synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A098D6U0 6.02e-82 306 25 25 930 1 ZEA1 Non-reducing polyketide synthase ZEA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q54IX3 6.87e-82 306 26 24 929 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q54IX3 4.02e-09 66 29 6 184 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
Q54IX3 3.48e-06 57 21 14 400 3 pks26 Probable polyketide synthase 26 Dictyostelium discoideum
E9KMQ2 8.72e-82 305 25 17 902 2 PKS16 Non-reducing polyketide synthase PKS16 Cladonia grayi
A0A0U4ZX08 1.04e-81 305 28 34 939 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
A0A0U4ZX08 2.46e-08 64 24 17 411 1 drtA Low-reducing polyketide synthase drtA Aspergillus calidoustus
S0EMV0 1.17e-81 305 27 31 970 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EMV0 4.62e-18 96 33 4 161 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EMV0 1.91e-17 94 35 3 165 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EMV0 1.58e-08 64 27 5 217 1 GPY1 Highly reducing polyketide synthase GPY1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
M2XHZ5 1.34e-81 305 26 21 909 2 pksA Norsolorinic acid synthase Dothistroma septosporum (strain NZE10 / CBS 128990)
Q30DW5 1.34e-81 305 26 21 909 2 pksA Norsolorinic acid synthase Dothistroma septosporum
P9WEZ4 1.34e-81 306 30 26 805 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
P9WEZ4 2.69e-16 90 21 28 767 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
A0A2P1DP91 1.37e-81 304 29 21 821 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A2P1DP91 3.48e-18 96 24 14 401 1 macA 6-methylsalicylic acid synthase Penicillium terrestre
A0A1L9WQM9 1.67e-81 305 28 23 823 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WQM9 2.04e-11 74 34 3 161 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WQM9 2.58e-08 64 29 7 165 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WQM9 2.08e-07 61 23 5 212 2 acrA Highly reducing polyketide synthase acrA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
P0DUK1 1.78e-81 305 26 31 925 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
P0DUK1 5.61e-16 89 34 4 176 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
P0DUK1 6.52e-08 62 33 4 166 3 pspA Highly reducing polyketide synthase pspA Penicillium soppii
C8VJR7 2.12e-81 305 25 27 985 1 alnA Highly reducing polyketide synthase alnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
I1RVD8 2.42e-81 305 28 34 952 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD8 9.99e-21 105 28 12 327 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD8 5.23e-12 76 27 6 214 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD8 2.59e-10 70 26 6 204 3 PKS6 Highly reducing polyketide synthase PKS6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1E1FFN8 2.57e-81 304 26 27 969 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
A0A1E1FFN8 3.3e-24 116 28 8 294 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
A0A1E1FFN8 1.65e-19 100 28 13 320 3 prhL Non-reducing polyketide synthase prhL Penicillium brasilianum
S0DZM7 2.81e-81 304 27 26 934 1 bik1 Bikaverin polyketide synthase bik1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0A2KT65 3.1e-81 304 26 23 903 2 melA Conidial yellow pigment biosynthesis polyketide synthase melA Penicillium expansum
A0A1L9UCG2 3.58e-81 303 26 21 913 3 albA Non-reducing polyketide synthase albA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A8D5M692 3.83e-81 303 27 29 933 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
A0A8D5M692 5.63e-24 115 31 5 236 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
A0A8D5M692 3.48e-13 80 26 8 228 1 esdpA Non-reducing polyketide synthase esdpA Penicillium shearii
B8MV59 4.72e-81 303 27 27 902 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MV59 9.85e-06 55 23 10 342 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8MV59 0.000437 50 24 5 208 3 tpeA Partially reducing polyketide synthase tpeA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
A2QUI2 4.84e-81 303 26 21 921 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
S7Z800 6.27e-81 303 26 29 968 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7Z800 1.45e-19 101 29 5 212 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7Z800 1.89e-14 84 23 13 335 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7Z800 1.85e-08 64 19 9 346 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
G3XLL5 7.59e-81 302 26 21 921 3 albA Non-reducing polyketide synthase albA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
M1WG96 8.58e-81 301 26 24 911 2 CPUR_05437 Non-reducing polyketide synthase CPUR_05437 Claviceps purpurea (strain 20.1)
A0A0E4AZP0 9.4e-81 303 29 34 932 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
A0A0E4AZP0 4.9e-18 96 31 3 199 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
A0A0E4AZP0 2.2e-13 80 23 13 372 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
A0A0E4AZP0 7.3e-13 79 36 2 110 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
D7PHZ2 1.12e-80 301 26 21 986 1 vrtA Non-reducing polyketide synthase vrtA Penicillium aethiopicum
Q5BA83 1.17e-80 302 28 25 854 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BA83 6.88e-20 102 30 8 246 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BA83 5.98e-12 76 27 9 244 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BA83 1.76e-05 54 23 9 310 3 easB Highly reducing polyketide synthase easB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CCY3 1.37e-80 301 27 25 907 1 gedC Atrochrysone carboxylic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
E5A7D9 1.4e-80 302 26 22 908 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5A7D9 5.44e-16 89 28 9 235 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5A7D9 4.89e-14 83 29 9 221 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5A7D9 1.72e-05 54 25 5 191 2 pks5 Highly reducing polyketide synthase pks5 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
A0A075TRC0 1.84e-80 300 28 24 855 1 patK 6-methylsalicylic acid synthase Penicillium expansum
A0A075TRC0 1.38e-16 91 21 12 410 1 patK 6-methylsalicylic acid synthase Penicillium expansum
A0A0F7U103 1.91e-80 301 27 27 942 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
A0A0F7U103 1.18e-24 118 31 6 226 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
A0A0F7U103 3.98e-18 96 28 13 320 3 ausA Non-reducing polyketide synthase ausA Penicillium brasilianum
P0DUT7 2.41e-80 301 27 31 958 1 Ba17a Highly reducing polyketide synthase 17 Metarhizium anisopliae
Q559A9 3.56e-80 301 25 24 951 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q559A9 6.48e-13 79 28 7 205 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
Q559A9 2.2e-07 61 25 5 186 3 pks13 Probable polyketide synthase 13 Dictyostelium discoideum
S0DRI1 4.48e-80 300 27 30 970 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DRI1 6.59e-05 52 23 10 339 1 FUB1 Reducing polyketide synthase FUB1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q2UB00 6.29e-80 300 28 33 947 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UB00 2.07e-20 103 29 3 223 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UB00 9.14e-13 79 32 5 158 3 ppsB Reducing polyketide synthase ppsB Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2T4N2 6.87e-80 300 37 5 444 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 1.59e-73 279 34 6 473 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N2 4.54e-08 63 25 4 197 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A455M7S4 7.76e-80 299 26 23 933 1 atnG Non-reducing polyketide synthase atnG Arthrinium sp.
B8N8R0 7.89e-80 298 27 21 906 2 afvB Non-reducing polyketide synthase afvB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A1CFL8 1.38e-79 297 30 22 753 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CFL8 1.12e-17 94 23 12 410 1 patK 6-methylcalicylic acide synthase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q6DQW3 1.41e-79 298 27 24 931 1 CTB1 Non-reducing polyketide synthase CTB1 Cercospora nicotianae
A0A161CEU9 1.56e-79 298 26 23 901 1 citS Citrinin polyketide synthase Monascus ruber
A0A161CEU9 1.36e-23 114 27 13 373 1 citS Citrinin polyketide synthase Monascus ruber
A0A161CEU9 4.75e-18 96 28 11 315 1 citS Citrinin polyketide synthase Monascus ruber
Q65Z23 1.56e-79 298 26 23 901 1 pksCT Citrinin polyketide synthase Monascus purpureus
Q65Z23 1.36e-23 114 27 13 373 1 pksCT Citrinin polyketide synthase Monascus purpureus
Q65Z23 4.75e-18 96 28 11 315 1 pksCT Citrinin polyketide synthase Monascus purpureus
Q54KU3 1.59e-79 298 26 29 932 3 pks25 Probable polyketide synthase 25 Dictyostelium discoideum
N4WHA7 1.9e-79 298 26 29 926 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
N4WHA7 1.11e-09 68 25 13 339 3 PKS2 Reducing polyketide synthase PKS2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
G3Y419 2.29e-79 297 28 21 822 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3Y419 1.79e-19 100 24 9 385 1 yanA 6-methylsalicylic acid synthase Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q7SHI6 2.96e-79 297 27 28 913 2 srdA Highly reducing polyketide synthase srdA Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A0A455R5P9 3.16e-79 297 27 24 913 1 ascC Non-reducing polyketide synthase ascC Acremonium egyptiacum
F9XMW3 3.33e-79 297 26 25 904 3 PKS1 Non-reducing polyketide synthase PKS1 Zymoseptoria tritici (strain CBS 115943 / IPO323)
A0A1B5L6A0 3.55e-79 297 26 24 905 1 UVI_02036160 Non-reducing polyketide synthase ustP Ustilaginoidea virens
P0CU67 4.11e-79 296 27 24 911 1 claG Atrochrysone carboxylic acid synthase Passalora fulva
I3ZNU9 5.4e-79 296 26 27 924 1 armB Orsellinic acid synthase armB Armillaria mellea
Q4WAZ9 7.36e-79 297 28 28 863 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAZ9 0.001 48 19 7 326 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A2G5IC96 7.87e-79 296 27 25 931 3 CTB1 Non-reducing polyketide synthase CTB1 Cercospora beticola
I1RL11 7.93e-79 296 26 23 928 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RL11 3.13e-18 96 28 12 300 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RL11 1.15e-15 88 29 7 240 1 dpfgA Non-reducing polyketide synthase dpfgA Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WET6 8.23e-79 296 25 28 969 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
P9WET6 1.63e-13 81 27 12 322 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
P9WET6 5.42e-13 79 24 10 325 1 Preu3 Non-reducing polyketide synthase Preu3 Preussia isomera
Q55CN6 8.38e-79 296 26 22 860 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
Q55CN6 7.33e-05 52 21 10 369 3 pks3 Probable polyketide synthase 3 Dictyostelium discoideum
B8M9J9 8.46e-79 296 25 24 913 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8M9J9 8.5e-23 112 29 14 317 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
B8M9J9 2.93e-08 63 27 5 170 1 tropA 3-methylorcinaldehyde synthase tropA Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
S4W172 9.64e-79 296 29 34 932 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
S4W172 7.03e-18 95 34 1 146 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
S4W172 1.16e-12 78 23 13 371 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
S4W172 8.3e-12 75 35 2 110 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
A0A0R8YWJ7 1.05e-78 296 27 26 959 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
A0A0R8YWJ7 3.45e-16 90 27 7 301 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
A0A0R8YWJ7 6.74e-15 85 27 11 312 1 mpas Methylphloroacetophenone synthase Cladonia uncialis
B8NJG3 1.42e-78 296 27 33 950 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NJG3 1.46e-22 111 34 2 202 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NJG3 2.71e-17 94 26 20 405 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NJG3 9.21e-14 82 21 29 825 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A481WNP4 1.82e-78 295 29 32 964 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A0A481WNP4 3.22e-14 83 21 10 387 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A0A481WNP4 1.31e-09 68 34 6 166 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A0A481WNP4 2e-06 57 27 7 202 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
E4V2N2 1.91e-78 294 26 22 983 3 nscA Non-reducing polyketide synthase nscA Arthroderma gypseum (strain ATCC MYA-4604 / CBS 118893)
M3A326 1.92e-78 294 26 23 902 2 PKS8-1 Non-reducing polyketide synthase PKS8-1 Pseudocercospora fijiensis (strain CIRAD86)
A0A3T0QHT6 2.13e-78 295 28 24 836 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
A0A3T0QHT6 2.61e-13 80 30 1 140 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
A0A3T0QHT6 2.85e-11 73 21 9 362 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
A0A3T0QHT6 3.15e-08 63 33 3 121 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
Q4W944 2.18e-78 294 26 20 897 1 encA Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q55E72 2.56e-78 295 26 27 885 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q55E72 3.62e-08 63 30 7 205 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q55E72 2.42e-05 54 25 11 237 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q55E72 0.000376 50 19 9 348 1 stlA Probable polyketide synthase 1 Dictyostelium discoideum
Q3S2U6 3e-78 294 27 35 959 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
Q3S2U6 6.1e-22 108 32 8 231 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
Q3S2U6 7.43e-17 92 30 6 213 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
Q3S2U6 1.33e-13 81 25 11 369 1 mokB Lovastatin diketide synthase mokB Monascus pilosus
Q5SBL6 4.09e-78 294 27 27 953 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
Q5SBL6 6.33e-17 92 31 3 196 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
Q5SBL6 9.17e-13 79 31 4 147 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
Q5SBL6 5.64e-05 53 19 13 436 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
B0G0Z9 6.72e-78 293 26 30 933 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
B0G0Z9 6.71e-07 59 25 7 205 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
B0G0Z9 9.73e-06 55 24 8 246 3 pks6 Probable polyketide synthase 6 Dictyostelium discoideum
F2S6Z9 6.99e-78 292 27 21 906 3 nscA Non-reducing polyketide synthase nscA Trichophyton tonsurans (strain CBS 112818)
A0A6J4B487 7.92e-78 293 27 33 958 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A6J4B487 7.06e-19 99 21 24 812 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A6J4B487 6.92e-07 59 36 4 150 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A6J4B487 5.81e-06 56 33 7 187 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A481WQB6 1.06e-77 293 25 24 909 1 claF Clavatol synthase claF Penicillium crustosum
A0A481WQB6 2.31e-16 90 30 8 255 1 claF Clavatol synthase claF Penicillium crustosum
A0A481WQB6 7.13e-11 72 24 15 360 1 claF Clavatol synthase claF Penicillium crustosum
N4WHE3 1.08e-77 292 27 31 975 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
N4WHE3 5.07e-08 63 28 5 194 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
N4WHE3 4.28e-05 53 23 12 358 3 PKS1 Reducing polyketide synthase PKS1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
D7PI15 1.14e-77 291 27 21 948 1 gsfA Non-reducing polyketide synthase gsfA Penicillium aethiopicum
P0CU84 1.22e-77 292 27 30 935 1 apmlA Highly reducing polyketide synthase apmlA Arthrinium phaeospermum
B1GVX7 1.45e-77 292 29 33 860 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
B1GVX7 1.15e-11 75 22 19 493 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
B1GVX7 4.15e-09 66 32 5 165 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
B1GVX7 4.53e-08 63 23 13 353 2 BOA6 Reducing polyketide synthase BOA6 Botryotinia fuckeliana (strain B05.10)
D2E9X0 1.49e-77 292 27 28 950 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
D2E9X0 2.04e-09 67 22 4 206 2 DEP5 Reducing polyketide synthase DEP5 Alternaria brassicicola
A0A2I1BSV9 1.54e-77 291 27 22 832 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
A0A2I1BSV9 7.49e-23 112 29 16 347 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
A0A2I1BSV9 2.42e-20 103 29 7 232 1 nvfA Non-reducing polyketide synthase nvfA Aspergillus novofumigatus (strain IBT 16806)
G0R6S9 1.78e-77 292 25 28 923 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
G0R6S9 6.43e-23 112 28 8 249 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
G0R6S9 8.66e-13 79 26 9 237 2 sor2 Non-reducing polyketide synthase sor2 Hypocrea jecorina (strain QM6a)
A0A097ZPE0 1.84e-77 291 26 31 950 1 andM Non-reducing polyketide synthase andM Emericella variicolor
A0A097ZPE0 2.36e-22 110 31 8 267 1 andM Non-reducing polyketide synthase andM Emericella variicolor
A0A097ZPE0 3.84e-19 99 26 13 349 1 andM Non-reducing polyketide synthase andM Emericella variicolor
A0A0S6XH49 2e-77 291 27 31 959 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A0S6XH49 2.62e-21 107 34 6 195 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A0S6XH49 3.65e-11 73 27 5 210 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
A0A0S6XH49 5.14e-08 63 29 6 207 1 frbB Highly reducing polyketide synthase frbB Fungal sp. (strain No.11243)
P22367 2.59e-77 290 28 24 837 1 None 6-methylsalicylic acid synthase Penicillium patulum
P22367 7.75e-16 89 22 11 408 1 None 6-methylsalicylic acid synthase Penicillium patulum
A0A455LXK0 2.63e-77 291 24 23 922 2 ntnG Non-reducing polyketide synthase ntnG Nectria sp.
A0A2Z5XAL7 2.83e-77 291 29 26 827 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
A0A2Z5XAL7 8.49e-13 79 30 1 155 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
A0A2Z5XAL7 9.47e-13 79 35 4 131 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
Q12053 2.88e-77 291 26 21 902 1 aflC Norsolorinic acid synthase Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
A0A7L9EYL1 3.98e-77 291 28 25 861 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A7L9EYL1 5.72e-17 92 33 6 199 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A7L9EYL1 9.73e-09 65 29 4 158 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A7L9EYL1 2.92e-08 63 21 7 327 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A7L9EYL1 1.24e-07 62 24 11 267 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
A0A0D2YG10 4.33e-77 290 27 31 970 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
A0A0D2YG10 3.9e-06 57 22 13 357 1 FUB1 Reducing polyketide synthase FUB1 Fusarium oxysporum f. sp. lycopersici (strain 4287 / CBS 123668 / FGSC 9935 / NRRL 34936)
P9WEX6 4.9e-77 290 28 27 921 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
P9WEX6 1.22e-15 88 25 14 341 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
P9WEX6 1.38e-14 84 24 10 329 1 dpmaA Non-reducing polyketide synthase dpmaA Metarhizium anisopliae
P0DO30 5.02e-77 291 27 28 972 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
P0DO30 7.13e-20 102 31 3 197 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
P0DO30 9.89e-20 102 30 11 273 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
P0DO30 1.51e-09 68 22 12 368 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q54ED6 5.03e-77 290 26 29 929 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
Q54ED6 3.48e-13 80 23 19 395 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
Q54ED6 1.77e-06 58 23 7 227 3 pks41 Probable polyketide synthase 41 Dictyostelium discoideum
A0A2H3CTK0 5.04e-77 290 26 27 924 1 armB Orsellinic acid synthase armB Armillaria gallica
A0A0C6E0I7 5.3e-77 290 28 28 861 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
A0A0C6E0I7 1.45e-13 81 34 9 188 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
A0A0C6E0I7 2.45e-11 74 38 5 131 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
A0A0C6E0I7 6.46e-08 62 21 11 367 1 bet1 Highly reducing polyketide synthase bet1 Neocamarosporium betae
G3XMD1 5.55e-77 290 26 30 967 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XMD1 1.27e-17 94 32 5 177 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XMD1 1.13e-11 75 33 5 166 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XMD1 2.76e-07 60 28 6 206 1 azaB Highly reducing polyketide synthase azaB Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
E9F5E7 5.95e-77 290 27 27 933 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9F5E7 2.02e-15 87 26 14 341 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9F5E7 1.45e-13 81 23 9 321 1 subA Non-reducing polyketide synthase subA Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A1W7M1U5 6.13e-77 290 26 23 919 1 pgmA Non-reducing polyketide synthase pgmA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q5BH30 6.65e-77 289 26 21 900 3 mdpG Atrochrysone carboxylic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
W7LKX1 6.9e-77 290 26 26 964 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
W7LKX1 6.42e-21 105 29 5 209 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
W7LKX1 4.5e-14 83 31 4 166 2 FUM1 Highly reducing polyketide synthase FUM1 Gibberella moniliformis (strain M3125 / FGSC 7600)
A1D8I9 6.92e-77 289 26 28 1006 3 nscA Non-reducing polyketide synthase nscA Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A0A0N7D745 7.28e-77 289 24 27 926 2 Dhc5 Non-reducing polyketide synthase Dhc5 Alternaria cinerariae
A0A084API3 7.9e-77 290 26 26 943 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A084API3 2.71e-09 67 21 12 388 3 SAT13 Highly reducing polyketide synthase SAT13 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
W7MT31 1.06e-76 289 26 31 970 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
W7MT31 1.38e-05 55 22 12 357 1 FUB1 Reducing polyketide synthase FUB1 Gibberella moniliformis (strain M3125 / FGSC 7600)
D4AWH3 1.4e-76 288 27 25 913 3 nscA Non-reducing polyketide synthase nscA Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q4WQZ5 1.42e-76 288 26 24 908 2 tpcC Atrochrysone carboxylic acid synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
S7ZFK6 1.64e-76 289 27 39 959 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7ZFK6 1.03e-18 98 31 4 199 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7ZFK6 4.52e-15 86 32 11 223 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7ZFK6 2.7e-10 70 23 8 291 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7ZFK6 0.000566 49 20 13 391 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1L9WLD9 1.66e-76 288 26 21 938 1 AacuL Atrochrysone carboxylic acid synthase AacuL Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WN37 1.82e-76 287 28 27 869 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WN37 1.15e-13 81 23 15 419 1 acuA 6-methylsalicylic acid synthase acuA Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1W5T1U1 1.93e-76 289 27 39 959 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1W5T1U1 1.03e-18 98 31 4 199 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1W5T1U1 4.56e-15 86 32 11 223 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1W5T1U1 2.67e-10 70 23 8 291 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1W5T1U1 0.000566 49 20 13 391 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A284RE13 2.05e-76 288 26 27 924 1 armB Orsellinic acid synthase ArmB Armillaria ostoyae
Q54KU5 2.08e-76 288 26 26 941 3 pks24 Probable polyketide synthase 24 Dictyostelium discoideum
Q8J0F5 2.22e-76 288 27 30 959 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
Q8J0F5 1.17e-22 111 30 7 233 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
Q8J0F5 4.71e-16 89 24 12 371 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
Q8J0F5 2.6e-13 80 27 7 244 1 mlcB Compactin diketide synthase mlcB Penicillium citrinum
G3XMC4 2.6e-76 288 26 31 931 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XMC4 1.26e-11 75 28 8 249 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XMC4 1.37e-07 61 27 13 274 1 azaA Non-reducing polyketide synthase azaA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
A0A6F9DYX9 2.76e-76 288 26 27 915 1 men2 Non-reducing polyketide synthase men2 Menisporopsis theobromae
G4N296 2.97e-76 288 27 21 861 2 PKS19 Highly reducing polyketide synthase 19 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
W3X7U2 3.11e-76 287 25 22 910 2 PfmaE Conidial pigment polyketide synthase PfmaE Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A067XNI2 3.39e-76 286 26 27 910 2 ptaA Non-reducing polyketide synthase ptaA Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P40872 3.93e-76 288 36 9 484 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 9.96e-74 280 37 7 436 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 2.07e-69 266 34 8 445 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 6.87e-17 92 27 11 302 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 4.93e-16 89 29 9 305 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 4.82e-10 70 19 4 331 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
P40872 8.36e-07 59 20 14 446 1 pksM Polyketide synthase PksM Bacillus subtilis (strain 168)
B0G100 4.09e-76 287 26 33 956 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
B0G100 2.56e-07 60 27 6 174 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
B0G100 0.000101 52 25 5 175 3 pks7 Probable polyketide synthase 7 Dictyostelium discoideum
B4XYB8 4.2e-76 286 28 16 809 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
B4XYB8 5.12e-07 59 24 6 222 1 aziB 5-methyl-1-naphthoate synthase Streptomyces sahachiroi
Q86AE3 4.38e-76 287 26 30 952 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
Q86AE3 1.93e-08 64 28 6 174 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
Q86AE3 5.77e-07 59 28 6 176 2 pks9 Probable polyketide synthase 9/36 Dictyostelium discoideum
B6HN77 5.9e-76 287 26 32 927 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HN77 2.85e-22 110 29 7 270 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HN77 1.13e-14 85 28 9 246 3 sorB Non-reducing polyketide synthase sorB Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A0B5KU17 6.94e-76 286 28 19 755 1 mpaC' Non-reducing polyketide synthase mapC' Penicillium brevicompactum
Q50LG3 7.04e-76 287 29 19 722 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
Q50LG3 1.02e-21 108 32 10 241 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
Q50LG3 4.28e-11 73 28 5 215 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
Q50LG3 4.09e-10 70 19 8 366 3 AFT9-1 Highly reducing polyketide synthase AFT9-1 Alternaria alternata
A0A089FSA4 7.82e-76 287 28 30 867 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
A0A089FSA4 3.41e-13 80 26 11 266 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
A0A089FSA4 3.51e-12 77 33 1 122 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
A0A089FSA4 1.56e-06 58 19 13 376 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
S0EEY3 9.66e-76 286 28 22 849 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EEY3 2.44e-19 100 21 25 814 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EEY3 1.06e-09 68 33 5 185 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EEY3 2.58e-09 67 35 3 147 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q0C8A4 9.88e-76 286 26 21 934 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8A4 6.8e-24 115 32 8 249 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8A4 1.27e-17 94 26 13 351 1 trt4 Non-reducing polyketide synthase trt4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A125R003 9.89e-76 286 28 26 852 1 cla3 Non-reducing polyketide synthase cla3 Cladosporium cladosporioides
D4CZZ2 1.14e-75 285 26 24 913 3 nscA Non-reducing polyketide synthase nscA Trichophyton verrucosum (strain HKI 0517)
C5FM57 1.15e-75 285 25 23 990 3 nscA Non-reducing polyketide synthase nscA Arthroderma otae (strain ATCC MYA-4605 / CBS 113480)
A0A2Z5TM64 1.54e-75 286 28 28 858 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A2Z5TM64 3.56e-08 63 18 11 358 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A455M2Y3 2.02e-75 285 27 31 927 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
A0A455M2Y3 3.83e-12 76 30 5 171 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
A0A455M2Y3 8.12e-08 62 30 4 136 2 ntnH Highly reducing polyketide synthase ntnH Nectria sp.
F2T0M0 2.22e-75 284 26 24 913 3 nscA Non-reducing polyketide synthase nscA Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
B3FWS8 2.76e-75 284 25 21 902 1 hpm3 Non-reducing polyketide synthase hmp3 Hypomyces subiculosus
Q2T4N1 3.78e-75 285 34 12 534 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 4.44e-66 255 35 8 448 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 7.99e-66 254 35 7 426 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.21e-55 220 33 6 436 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 7.28e-24 115 27 8 302 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 1.91e-21 107 31 10 254 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 8.03e-12 75 23 8 348 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4N1 7.65e-10 69 25 3 171 2 thaG Polyketide synthase ThaG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A0A3G1DJF3 3.96e-75 284 26 27 910 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJF3 1.13e-17 95 31 6 206 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJF3 2.64e-16 90 33 10 219 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJF3 0.000146 51 23 10 363 2 pks2 Squalestatin hexaketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
Q54QD3 4.34e-75 284 24 22 926 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
Q54QD3 0.000521 50 27 6 192 3 pks22 Probable polyketide synthase 22 Dictyostelium discoideum
Q4WA61 4.36e-75 283 26 31 964 3 nscA Non-reducing polyketide synthase nscA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0CRQ5 4.91e-75 284 26 22 910 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CRQ5 1.62e-20 104 26 11 357 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CRQ5 3.54e-15 86 26 8 263 1 ATEG_03629 5-methylorsellinic acid synthase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q2HBN0 5.08e-75 284 27 25 853 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HBN0 9.56e-13 79 34 4 160 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HBN0 2.17e-09 67 31 1 161 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A4P8GHJ1 5.13e-75 284 26 30 960 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A4P8GHJ1 8.71e-25 118 32 11 255 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A4P8GHJ1 1.44e-10 71 23 12 324 1 eupA 3-methylorcinaldehyde synthase Phoma sp.
A0A7R7ZK98 5.36e-75 283 27 19 902 3 AcPKS Atrochrysone carboxylic acid synthase Aspergillus chevalieri
B6HV32 6.07e-75 283 25 26 920 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HV32 5.6e-16 89 32 5 228 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HV32 2.85e-15 87 26 16 379 1 adrD Non-reducing polyketide synthase adrD Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
W7MLD7 7.76e-75 283 28 24 848 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
W7MLD7 1.42e-21 108 20 23 810 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
W7MLD7 1.63e-09 68 40 1 84 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
W7MLD7 4.1e-09 67 34 4 166 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
P9WET1 8.09e-75 282 26 24 918 1 Preu7 Non-reducing polyketide synthase Preu7 Preussia isomera
A0A068ABB7 9e-75 283 27 29 949 1 Bref-PKS Highly reducing polyketide synthase Eupenicillium brefeldianum
Q54QD1 1.02e-74 283 24 23 940 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
Q54QD1 0.000548 49 28 4 150 3 pks23 Probable polyketide synthase 23 Dictyostelium discoideum
B8MYS6 1.13e-74 282 25 21 896 1 pks27 Non-reducing polyketide synthase pks27 Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B6QK81 1.8e-74 281 26 25 923 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN6 1.8e-74 281 26 25 923 3 pks12 Non-reducing polyketide synthase pks12 Talaromyces marneffei
K3VA96 1.92e-74 282 28 23 871 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
K3VA96 5.47e-25 119 37 6 199 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
K3VA96 3.08e-14 83 25 10 279 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
K3VA96 4.12e-08 63 23 10 326 3 PKS40 Highly reducing polyketide synthase 40 Fusarium pseudograminearum (strain CS3096)
A2QX22 1.98e-74 281 26 27 922 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G9N4B2 2e-74 281 26 21 875 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
G9N4B2 2.67e-06 57 24 5 203 1 virA Highly reducing polyketide synthase virA Hypocrea virens (strain Gv29-8 / FGSC 10586)
Q05470 2.31e-74 282 36 10 474 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 4.13e-74 281 34 10 487 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 1.99e-71 272 33 7 478 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 2.41e-54 216 29 6 430 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 9.67e-17 92 21 16 558 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
Q05470 6.32e-16 89 24 17 470 1 pksL Polyketide synthase PksL Bacillus subtilis (strain 168)
C5H882 2.46e-74 281 25 25 925 3 radS2 Non-reducing polyketide synthase rads2 Floropilus chiversii
Q4WLD4 2.68e-74 281 26 29 951 1 pyr2 Non-reducing polyketide synthase pyr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A1L7U4V5 3e-74 281 28 36 981 2 FMN1 Reducing polyketide synthase 8 Fusarium mangiferae
A0A8F4S6Z6 3.29e-74 281 27 34 961 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A8F4S6Z6 1.85e-15 87 32 4 164 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A8F4S6Z6 2.12e-10 71 31 2 111 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A8F4S6Z6 6.99e-08 62 24 4 197 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A8F4S6Z6 1.15e-07 62 19 6 356 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A5PHD6 3.59e-74 281 26 25 868 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
A5PHD6 4.86e-17 92 26 9 342 1 aspks1 3-methylorcinaldehyde synthase Sarocladium schorii
Q86JI5 3.71e-74 281 25 32 962 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
Q86JI5 3.8e-07 60 26 5 175 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
Q86JI5 2.19e-05 54 26 7 206 2 pks5 Probable polyketide synthase 5 Dictyostelium discoideum
A0A0G0AID6 3.79e-74 281 28 27 870 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0G0AID6 6.12e-21 105 35 6 189 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0G0AID6 3.38e-14 83 22 13 424 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0G0AID6 1.03e-13 82 32 3 161 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A2QTE9 4.74e-74 280 25 30 927 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QTE9 1.43e-11 74 31 6 189 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QTE9 3.14e-07 60 28 12 252 3 epaA Non-reducing polyketide synthase epaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
G3KLH6 6.17e-74 279 26 27 922 1 adaA Non-reducing polyketide synthase adaA Aspergillus niger
B6QK76 6.53e-74 280 25 26 909 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
B6QK76 1.57e-15 87 31 9 251 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
B6QK76 8.48e-13 79 29 15 355 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
D7RJN5 6.53e-74 280 25 26 909 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
D7RJN5 1.57e-15 87 31 9 251 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
D7RJN5 8.48e-13 79 29 15 355 3 pks11 Non-reducing polyketide synthase pks11 Talaromyces marneffei
A1CLY8 7e-74 280 28 26 861 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CLY8 2.17e-19 100 36 3 161 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CLY8 2.42e-16 90 36 5 151 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CLY8 2.77e-09 67 19 7 371 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CLY8 3.32e-06 57 23 4 172 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A0A345BJN0 7.93e-74 280 26 26 914 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A345BJN0 9.69e-13 78 31 11 219 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A345BJN0 4.85e-12 76 28 7 206 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A345BJN0 0.000204 51 23 10 364 1 clz14 Squalestatin hexaketide synthase clz14 Cochliobolus lunatus
A0A4P8DJU2 8.37e-74 279 26 25 908 3 dmx-nrPKS Atrochrysone carboxylic acid synthase Cryptosporiopsis sp. (strain 8999)
A0A0N9HNS9 1.12e-73 278 27 24 900 3 desS Desertorin synthase Aspergillus desertorum
Q5B0D0 1.2e-73 278 26 21 902 1 aptA Non-reducing polyketide synthase aptA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A179H2I8 1.21e-73 279 26 34 1007 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
A0A179H2I8 7.54e-21 105 32 7 217 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
A0A179H2I8 1.45e-17 94 31 7 214 2 lcsB Highly reducing polyketide synthase lcsB Purpureocillium lilacinum
Q12397 1.26e-73 279 26 21 910 2 stcA Norsolorinic acid synthase stcA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9Y7D5 1.32e-73 279 26 33 966 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
Q9Y7D5 1.01e-20 105 32 6 206 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
Q9Y7D5 4.31e-12 76 28 6 209 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
Q9Y7D5 2.21e-11 74 26 11 372 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus
S0DTP6 1.34e-73 279 26 27 931 2 FSR1 Non-reducing polyketide synthase fsr1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
I1RLA7 1.56e-73 279 25 28 986 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RLA7 1.92e-15 87 30 6 185 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RLA7 1.97e-14 84 22 19 570 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RLA7 1.11e-12 78 26 8 223 2 FGR1 Highly reducing polyketide synthase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WET5 1.61e-73 278 25 23 990 1 Preu4 Non-reducing polyketide synthase Preu4 Preussia isomera
A0A1Y0BRF1 1.87e-73 278 26 21 763 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
A0A1Y0BRF1 6.29e-16 89 31 5 228 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
A0A1Y0BRF1 5.43e-14 82 30 14 311 3 adrD Non-reducing polyketide synthase adrD Penicillium roqueforti
G3J453 2.57e-73 278 27 31 939 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
G3J453 1.99e-15 87 29 4 194 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
G3J453 4.58e-13 79 34 7 162 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
G3J453 7.83e-10 69 27 7 224 1 cm3B Highly reducing polyketide synthase cm3B Cordyceps militaris (strain CM01)
Q0UI00 2.62e-73 277 26 22 917 1 elcA Non-reducing polyketide synthase elcA (Fragment) Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A0A017SEX7 2.64e-73 278 26 33 954 1 fogA Highly reducing polyketide synthase fogA Aspergillus ruber (strain CBS 135680)
Q0CZH1 3.45e-73 263 30 19 665 2 pytA Hybrid PKS-NRPS synthetase pytA (Fragment) Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P9WET2 3.52e-73 277 27 25 934 1 Preu6 Non-reducing polyketide synthase Preu6 Preussia isomera
A0A2V5GX43 3.56e-73 278 27 26 851 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5GX43 1.29e-13 81 21 35 896 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
Q5BG07 3.77e-73 278 26 25 852 1 pkdA Non-reducing polyketide synthase pkdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A8F4S8Q3 4.37e-73 278 28 26 857 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A8F4S8Q3 2.82e-15 87 30 6 208 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A8F4S8Q3 5.72e-10 69 33 2 112 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A8F4S8Q3 2.53e-07 60 24 6 198 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
A0A8F4S8Q3 7.61e-06 55 20 7 328 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
Q54ED7 4.45e-73 277 25 31 955 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
Q54ED7 1.12e-12 78 30 7 178 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
Q54ED7 8.23e-07 59 25 4 168 3 pks40 Probable polyketide synthase 40 Dictyostelium discoideum
A0JJU1 5.89e-73 277 27 35 992 1 tenS Tenellin synthetase Beauveria bassiana
A0JJU1 8.12e-17 92 37 6 161 1 tenS Tenellin synthetase Beauveria bassiana
A0JJU1 2.36e-16 90 33 1 165 1 tenS Tenellin synthetase Beauveria bassiana
A0JJU1 3.74e-07 60 25 6 213 1 tenS Tenellin synthetase Beauveria bassiana
Q8J0F7 6.4e-73 277 28 28 865 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q8J0F7 6.75e-19 99 34 7 215 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q8J0F7 1.84e-10 71 27 6 185 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q8J0F7 1.16e-09 68 24 6 211 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q8J0F7 2.09e-06 57 24 12 273 1 mlcA Compactin nonaketide synthase, polyketide synthase component Penicillium citrinum
Q5BBP5 7.36e-73 276 27 32 971 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BBP5 1.04e-07 62 28 13 268 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BBP5 6.08e-07 59 26 3 134 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BBP5 3.22e-05 53 26 8 220 1 pkhB Highly reducing polyketide synthase pkhB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0C8M3 7.59e-73 277 28 30 870 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8M3 5.95e-19 99 20 23 769 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8M3 5.73e-18 95 32 8 229 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8M3 8.19e-15 85 24 18 435 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0S2CHA9 8.18e-73 276 24 24 925 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
A0A0S2CHA9 6.4e-26 122 29 10 297 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
A0A0S2CHA9 2.34e-15 87 27 13 320 1 pigA Non-reducing polyketide synthase pigA Monascus ruber
A0A1V6NYI6 8.57e-73 276 28 34 955 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
A0A1V6NYI6 1.56e-22 110 32 3 195 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
A0A1V6NYI6 8.92e-19 98 30 6 199 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
A0A1V6NYI6 2.73e-06 57 24 4 192 3 verA Highly reducing polyketide synthase verA Penicillium polonicum
G3JUI8 9.08e-73 276 26 35 977 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
G3JUI8 2.03e-08 64 25 4 187 1 milA Highly reducing polyketide synthase milA Cordyceps militaris (strain CM01)
B0G101 9.68e-73 276 25 32 955 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
B0G101 3.92e-09 67 27 6 176 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
B0G101 7.68e-07 59 27 8 217 3 pks8 Probable polyketide synthase 8/35 Dictyostelium discoideum
A0A411L027 1.1e-72 276 28 20 849 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A411L027 2.63e-16 90 28 5 225 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A411L027 2.2e-13 80 34 6 163 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A411L027 1.03e-05 55 20 12 370 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A1V6PAF7 1.18e-72 276 27 30 962 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
A0A1V6PAF7 9.87e-13 78 33 5 164 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
A0A1V6PAF7 1.57e-11 74 33 2 138 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
A0A1V6PAF7 2.5e-08 64 25 5 207 1 calA Highly reducing polyketide synthase calA Penicillium decumbens
Q5AUX7 1.27e-72 276 25 24 836 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUX7 4.02e-24 116 31 8 247 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUX7 2.54e-11 73 29 9 219 1 dbaI Non-reducing polyketide synthase dbaI Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1B7YCC9 1.35e-72 275 27 23 908 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
A0A1B7YCC9 2.9e-14 83 25 12 330 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
A0A1B7YCC9 6.83e-13 79 28 8 244 1 dpchA Non-reducing polyketide synthase dpchA Colletotrichum higginsianum (strain IMI 349063)
A0A167LUQ4 1.67e-72 276 26 29 990 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
A0A167LUQ4 1.34e-16 91 30 5 201 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
A0A167LUQ4 2.93e-14 84 34 6 190 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
A0A167LUQ4 2.25e-05 54 26 5 167 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
I1S166 2.3e-72 275 27 23 875 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S166 2.93e-13 80 30 7 229 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S166 1.7e-09 68 40 1 83 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S166 0.000156 51 20 12 413 2 FSL1 Fusarielin synthase FSL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A7L8UVC9 2.32e-72 275 28 30 873 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0A7L8UVC9 1.04e-14 85 33 3 161 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0A7L8UVC9 2e-12 77 29 7 189 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
A0A7L8UVC9 2.36e-05 54 22 7 200 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
K2QVI8 2.34e-72 275 27 30 904 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
K2QVI8 2.75e-18 97 29 13 313 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
K2QVI8 6.12e-13 79 24 11 326 1 dpmpA Non-reducing polyketide synthase dpmpA Macrophomina phaseolina (strain MS6)
F2PWS5 2.98e-72 274 26 23 907 3 nscA Non-reducing polyketide synthase nscA Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
J4KMC1 3.52e-72 275 27 33 988 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
J4KMC1 7.99e-17 92 37 7 164 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
J4KMC1 1.88e-16 91 33 1 165 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
J4KMC1 7.62e-07 59 24 5 214 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
A0A411KUP8 3.53e-72 275 27 33 940 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
A0A411KUP8 3.45e-07 60 20 7 302 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
J4UHQ6 3.74e-72 274 27 27 911 1 OpS1 Orsellinic acid synthase Beauveria bassiana (strain ARSEF 2860)
L7XAV2 4.34e-72 274 25 31 929 1 curS2 Non-reducing polyketide synthase curS2 Aspergillus terreus
A0A142C799 4.4e-72 274 26 29 934 1 phnA Non-reducing polyketide synthase phnA Penicillium herquei
P9WES1 4.57e-72 273 26 31 910 1 None Atrochrysone carboxylic acid synthase PKS1 Calonarius odorifer
A2QK66 6.36e-72 272 26 22 903 3 ktnS Kotanin synthase Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9Y8A5 1.36e-71 273 28 30 870 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
Q9Y8A5 1.73e-18 97 33 10 230 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
Q9Y8A5 2.79e-14 84 24 18 435 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
Q9Y8A5 9.63e-10 68 25 5 210 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
Q9Y8A5 5.48e-08 63 23 7 265 1 lovB Lovastatin nonaketide synthase, polyketide synthase component Aspergillus terreus
A0A3T0ZHJ0 2.13e-71 271 27 26 807 1 cle1 Triacetic acid lactone synthase cle1 Aspergillus versicolor
B0G103 2.51e-71 271 27 18 759 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
B0G103 1.35e-11 75 29 6 183 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
B0G103 1.59e-06 58 24 4 179 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
B0G103 0.000141 51 22 14 359 3 pks10 Probable polyketide synthase 10 Dictyostelium discoideum
A0A5C1RD96 3.01e-71 271 25 30 917 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
A0A5C1RD96 1.32e-16 91 32 6 200 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
A0A5C1RD96 1e-08 65 26 13 352 3 pksAC Non-reducing polyketide synthase AC Didymella fabae
P9WES2 3.07e-71 270 26 26 857 1 None Atrochrysone carboxylic acid synthase PKS4 Calonarius odorifer
A0A4P8WAE5 3.51e-71 271 26 35 969 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A4P8WAE5 4.13e-21 106 37 3 161 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A4P8WAE5 1.82e-16 91 26 19 435 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A4P8WAE5 3.9e-06 57 23 5 186 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
S0DS59 7.11e-71 270 28 28 846 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DS59 4.26e-17 93 31 3 196 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DS59 8.92e-13 79 36 2 110 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DS59 1.81e-10 71 23 13 371 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q4WKW9 7.25e-71 270 26 29 928 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WKW9 9.84e-21 105 31 6 240 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WKW9 2.47e-13 80 27 8 259 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WKW9 0.000841 49 22 10 395 1 fgnA Fumigermin synthase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5B8A0 1.86e-70 268 25 22 841 1 pkfA Non-reducing polyketide synthase pkfA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CF75 2.15e-70 268 25 32 1006 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CF75 9.01e-18 95 30 7 216 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CF75 1.66e-12 77 28 8 221 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CF75 5.2e-07 59 26 7 206 1 ATEG_07659 Highly reducing polyketide synthase ATEG_07659 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A481WR96 2.43e-70 268 26 27 940 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
A0A481WR96 1.05e-09 68 23 10 363 3 claI Highly reducing polyketide synthase claI Penicillium crustosum
A0A1R3RGK0 2.46e-70 268 27 28 887 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK0 3.97e-15 86 27 10 288 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK0 3.51e-13 80 25 8 324 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK0 1.34e-09 68 25 15 468 1 otaA Highly reducing polyketide synthase otaA Aspergillus carbonarius (strain ITEM 5010)
R4WH05 3.99e-70 268 25 29 941 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
R4WH05 6.22e-21 105 34 7 187 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
R4WH05 1.14e-13 81 27 6 244 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
R4WH05 6.77e-09 66 24 4 215 3 ACRTS2 Highly reducing polyketide synthase ACRTS2 Alternaria alternata
V5Y0F7 4.63e-70 267 28 27 862 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
V5Y0F7 2.51e-16 90 24 14 382 3 AFT16-1 Reducing polyketide synthase AFT16-1 Alternaria alternata
A2R6H1 4.76e-70 267 27 32 893 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H1 2.11e-14 84 29 12 286 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H1 1.93e-13 80 28 5 242 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H1 2.4e-05 54 22 11 362 2 otaA Highly reducing polyketide synthase otaA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q3S2T9 5.54e-70 267 28 29 855 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q3S2T9 6.35e-20 102 35 6 207 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q3S2T9 2.84e-14 84 29 9 229 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q3S2T9 5.19e-12 76 25 7 241 1 mokA Lovastatin nonaketide synthase mokA Monascus pilosus
Q54T36 5.73e-70 267 24 26 964 3 pks19 Probable polyketide synthase 19 Dictyostelium discoideum
A0A0H2ZGJ4 1.19e-69 265 34 8 452 1 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGJ4 3.1e-20 103 24 11 439 1 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGJ4 5.92e-10 69 24 3 185 1 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain UCBPP-PA14)
K2QYX5 1.24e-69 266 26 28 940 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
K2QYX5 1.25e-14 85 28 5 206 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
K2QYX5 4.36e-12 76 33 3 121 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
K2QYX5 9.08e-10 68 23 3 211 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
Q54TW0 2.78e-69 265 25 27 965 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q54TW0 0.00057 49 25 2 110 2 pks18 Probable polyketide synthase 18 Dictyostelium discoideum
Q5AZ32 3.29e-69 265 25 23 916 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AZ32 7.45e-10 69 29 7 226 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AZ32 3.26e-09 67 22 14 356 1 pkbA Non-reducing polyketide synthase pkbA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9HWG4 7.01e-69 263 34 8 452 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HWG4 1.53e-20 104 24 11 439 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HWG4 5.45e-10 69 24 3 185 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5BEJ4 7.59e-69 263 27 32 985 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BEJ4 1.47e-18 97 24 15 415 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BEJ4 2.6e-12 77 28 7 201 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BEJ4 1.2e-11 75 27 6 217 1 afoG Asperfuranone polyketide synthase afoG Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q558Y6 8.73e-69 263 25 32 977 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
Q558Y6 1.58e-09 68 26 7 209 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
Q558Y6 1.29e-06 58 22 6 222 3 pks14 Probable polyketide synthase 14 Dictyostelium discoideum
Q55DM7 1.63e-68 263 25 30 925 3 pks2 Probable polyketide synthase 2 Dictyostelium discoideum
Q5AUX1 1.93e-68 262 26 27 926 1 orsA Orsellinic acid synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0F7GFS4 1.96e-68 262 26 27 884 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A0F7GFS4 4.57e-17 93 34 5 164 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A0F7GFS4 4.07e-13 80 31 3 132 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A0F7GFS4 0.000233 51 21 9 346 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
S0EET5 2.69e-68 261 28 27 875 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EET5 1.74e-13 81 31 7 223 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EET5 1.26e-10 71 28 6 233 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EET5 3.61e-07 60 20 10 357 2 PKS19 Polyketide synthase 19 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P9WEQ0 3.34e-68 261 27 30 938 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
P9WEQ0 9.26e-06 55 25 5 181 3 olcA Non-reducing polyketide synthase olcA Penicillium canescens
A0A2I1C3X5 4.22e-68 260 26 28 902 1 nsrB Atrochrysone carboxylic acid synthase nsrB Aspergillus novofumigatus (strain IBT 16806)
Q54FD2 4.3e-68 261 25 26 913 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
Q54FD2 2.13e-10 70 28 3 145 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
Q54FD2 1.64e-08 64 21 10 365 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
Q54FD2 1.26e-05 55 25 3 147 3 pks38 Probable polyketide synthase 38 Dictyostelium discoideum
G2Q9A5 4.55e-68 261 28 29 886 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
G2Q9A5 4.01e-19 99 33 7 208 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
G2Q9A5 3.52e-10 70 27 6 209 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
G2Q9A5 1.1e-05 55 21 4 185 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
A0A6F8RNP4 5.16e-68 261 27 27 912 1 grgA Reducing polyketide synthase grgA Penicillium sp.
A0A6F8RNP4 1.86e-19 100 31 8 248 1 grgA Reducing polyketide synthase grgA Penicillium sp.
A0A6F8RNP4 4.57e-16 89 29 8 213 1 grgA Reducing polyketide synthase grgA Penicillium sp.
Q54FQ1 5.18e-68 261 25 26 887 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
Q54FQ1 1.43e-11 74 23 10 336 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
Q54FQ1 5.28e-11 73 28 4 167 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
Q54FQ1 2.39e-05 54 24 3 147 3 pks31 Probable polyketide synthase 31 Dictyostelium discoideum
A0A411PQP9 6.28e-68 259 25 21 901 3 Agnpks1 Atrochrysone carboxylic acid synthase Agnpks1 Paecilomyces divaricatus
A0A6F9DXA0 7.69e-68 260 35 11 445 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
A0A6F9DXA0 5.85e-12 76 21 11 351 1 men1 Partially reducing polyketide synthase men1 Menisporopsis theobromae
A0A2L0P0K3 9.01e-68 260 26 28 862 1 TwmB Polyketide synthase-nonribosomal peptide synthetase TwmB Talaromyces wortmannii
G4MVZ2 9.3e-68 260 27 28 885 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4MVZ2 2.31e-15 87 33 5 162 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4MVZ2 6.49e-14 82 29 8 224 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4MVZ2 4.4e-08 63 21 8 289 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4MVZ2 1.45e-05 55 22 11 349 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A0M4L8I7 1.71e-67 259 26 29 1000 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
A0A0M4L8I7 1.44e-19 101 30 3 213 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
A0A0M4L8I7 7.07e-19 99 31 6 226 1 aurA Highly reducing polyketide synthase aurA Calcarisporium arbuscula
P48633 2.34e-67 258 32 19 571 3 irp2 High-molecular-weight protein 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P48633 8.19e-66 253 33 12 529 3 irp2 High-molecular-weight protein 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P48633 1.6e-13 81 24 10 365 3 irp2 High-molecular-weight protein 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P9WEV0 3.8e-67 258 27 23 866 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
P9WEV0 4.16e-17 93 27 7 292 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
P9WEV0 2.25e-16 90 25 14 432 3 valA Highly reducing polyketide synthase valA Aspergillus terreus
B0G138 7.5e-67 257 23 23 965 3 pks21 Probable polyketide synthase 21 Dictyostelium discoideum
Q0UK48 1e-66 256 27 28 865 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0UK48 1.21e-14 85 30 10 246 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0UK48 3.72e-13 80 33 6 166 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0UK48 4.87e-09 66 23 10 343 1 sthA Highly reducing polyketide synthase sthA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q4WAY3 1.44e-66 256 26 31 972 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAY3 5.48e-05 53 25 8 238 1 af370 Fumagillin dodecapentaenoate synthase af370 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A0U5GFS8 1.44e-66 256 24 25 915 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
A0A0U5GFS8 7.84e-21 105 26 10 315 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
A0A0U5GFS8 4.38e-20 102 28 14 335 1 ausA Non-reducing polyketide synthase ausA Aspergillus calidoustus
Q5B7U4 2.42e-66 255 24 25 927 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B7U4 3.45e-21 106 25 12 366 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B7U4 4.67e-14 83 28 11 250 1 pkiA Non-reducing polyketide synthase pkiA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A084B9Z6 3.8e-66 254 23 22 909 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A084B9Z6 4.67e-24 116 31 7 248 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A084B9Z6 4.51e-17 93 28 16 327 3 SAT8 Non-reducing polyketide synthase SAT8 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
Q54FQ2 4.22e-66 254 25 26 888 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q54FQ2 9.6e-11 72 26 7 215 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q54FQ2 1.77e-08 64 22 12 385 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q54FQ2 1.67e-05 54 25 3 147 3 pks30 Probable polyketide synthase 30 Dictyostelium discoideum
Q54FN7 5.35e-66 254 25 26 885 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q54FN7 1.37e-10 71 28 3 145 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q54FN7 8.73e-10 68 22 16 452 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q54FN7 7.94e-06 55 25 3 147 3 pks33 Probable polyketide synthase 33 Dictyostelium discoideum
Q2ABP6 6.39e-66 253 34 11 431 1 pksF Reducing polyketide synthase pksF Alternaria solani
Q2ABP6 3.06e-10 70 21 10 380 1 pksF Reducing polyketide synthase pksF Alternaria solani
Q2ABP6 2.14e-07 61 22 19 439 1 pksF Reducing polyketide synthase pksF Alternaria solani
Q54FQ3 7.39e-66 254 25 25 882 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FQ3 6.04e-12 76 29 4 167 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FQ3 1.9e-09 67 22 12 386 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
Q54FQ3 1.43e-05 55 28 3 121 3 pks29 Probable polyketide synthase 29 Dictyostelium discoideum
P12276 7.92e-66 253 25 25 829 1 FASN Fatty acid synthase Gallus gallus
P12276 2.87e-06 57 36 1 84 1 FASN Fatty acid synthase Gallus gallus
Q54FN2 9.54e-66 253 25 24 886 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54FN2 2.2e-10 70 28 3 145 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54FN2 2.2e-10 70 22 16 451 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54FN2 1.83e-05 54 24 3 146 3 pks34 Probable polyketide synthase 34 Dictyostelium discoideum
Q54FP8 2.79e-65 252 25 27 892 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q54FP8 2.53e-11 73 24 11 282 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q54FP8 1.27e-09 68 23 11 336 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q54FP8 1.04e-05 55 25 3 147 3 pks32 Probable polyketide synthase 32 Dictyostelium discoideum
Q86ZD9 2.86e-65 251 25 32 976 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
Q86ZD9 1.5e-14 84 30 8 231 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
Q86ZD9 4.82e-14 83 30 6 211 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
Q86ZD9 1.9e-10 71 26 5 192 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain C2932)
S3D9F1 9.31e-65 250 31 9 438 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D9F1 1.22e-24 117 28 11 313 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D9F1 3.5e-15 86 22 14 457 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D9F1 2.05e-11 74 27 6 212 1 gloL Highly reducing polyketide synthase gloL Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q54D44 1.06e-64 250 26 25 788 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
Q54D44 1.56e-12 78 29 5 171 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
Q54D44 1.48e-11 74 28 8 213 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
Q54D44 6.64e-09 66 23 17 446 3 pks42 Probable polyketide synthase 42 Dictyostelium discoideum
B0G170 1.09e-64 249 24 25 894 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
B0G170 2.65e-10 70 26 7 207 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
B0G170 1.8e-05 54 22 12 360 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
B0G170 0.000172 51 25 4 167 3 pks28 Probable polyketide synthase 28 Dictyostelium discoideum
P9WET4 1.32e-64 249 24 33 1021 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
P9WET4 1.02e-17 95 34 6 179 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
P9WET4 1.51e-12 78 27 8 219 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
P9WET4 1.36e-10 71 26 4 195 1 Preu5 Highly reducing polyketide synthase Preu5 Preussia isomera
Q71SP7 1.82e-64 249 25 29 888 1 FASN Fatty acid synthase Bos taurus
Q71SP7 6.9e-05 52 34 3 102 1 FASN Fatty acid synthase Bos taurus
P19096 2.16e-64 249 25 28 840 1 Fasn Fatty acid synthase Mus musculus
P19096 2.06e-05 54 34 2 100 1 Fasn Fatty acid synthase Mus musculus
P19096 9.73e-05 52 25 5 210 1 Fasn Fatty acid synthase Mus musculus
E5AE40 2.38e-64 248 24 30 1025 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5AE40 2.47e-19 100 34 6 188 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5AE40 5.73e-14 82 27 6 222 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
E5AE40 5.61e-08 63 22 6 244 2 PKS2 Highly reducing polyketide synthase PKS2 Leptosphaeria maculans (strain JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8)
O68006 7.21e-64 248 29 10 538 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.7e-11 74 19 12 583 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.2e-10 72 21 14 452 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.17e-05 55 21 14 431 3 bacA Bacitracin synthase 1 Bacillus licheniformis
A0A4P8DJV2 9.33e-64 246 38 8 375 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
A0A4P8DJV2 2.51e-18 97 24 14 437 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
A0A4P8DJV2 4.97e-06 56 30 6 188 3 dmxL2 Highly reducing polyketide synthase dmxL2 Cryptosporiopsis sp. (strain 8999)
Q2HEW5 1.25e-63 246 29 18 699 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HEW5 1.09e-14 85 32 4 163 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HEW5 1.19e-13 82 31 8 193 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HEW5 2.69e-06 57 20 13 432 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A5C1RDA3 2.35e-63 245 33 7 439 3 orf7 Highly reducing polyketide synthase Didymella fabae
A0A1L7U3D7 2.52e-63 245 45 4 280 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A1L7U3D7 3.65e-17 93 22 14 496 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A1L7U3D7 3.96e-16 90 30 11 244 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A1L7U3D7 5.97e-10 69 29 7 216 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
A0A1L7U3D7 3.72e-09 67 23 11 361 2 FPY1 Highly reducing polyketide synthase 40 Fusarium mangiferae
S7RK07 3.71e-63 244 34 10 429 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
W6QDA2 5.29e-63 244 29 26 710 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
W6QDA2 8.53e-06 55 20 5 226 1 anuA Highly reducing polyketide synthase anuA Penicillium roqueforti (strain FM164)
A0A3G9H990 5.4e-63 244 33 11 444 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
A0A3G9H990 8.08e-24 115 30 10 286 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
A0A3G9H990 1.68e-15 87 31 6 180 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
A0A3G9H990 1.62e-11 74 21 10 383 1 ALT1 Highly reducing polyketide synthase ALT1 Alternaria alternata
Q54B51 5.53e-63 244 24 22 853 3 pks44 Probable polyketide synthase 44 Dictyostelium discoideum
Q5BEJ6 7.04e-63 244 24 19 846 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BEJ6 1.1e-21 108 31 10 254 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BEJ6 2.62e-16 90 26 21 387 1 afoE Iterative polyketide synthase afoE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QN18 8.14e-63 243 27 26 874 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QN18 2.33e-21 107 34 5 211 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QN18 3e-12 77 30 8 210 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QN18 1.43e-08 65 23 15 382 1 sdgA Highly reducing polyketide synthase sdgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q54B49 1.55e-62 243 24 24 849 3 pks45 Probable polyketide synthase 45 Dictyostelium discoideum
A0A348HAX6 2.48e-62 242 33 9 444 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
A0A348HAX6 6.85e-12 75 23 10 315 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
A0A348HAX6 2.6e-06 57 23 10 357 1 phiA Highly reducing polyketide synthase phiA Fungal sp. (strain ATCC 74256)
P12785 3.61e-62 241 25 25 871 1 Fasn Fatty acid synthase Rattus norvegicus
P12785 3.9e-05 53 34 2 100 1 Fasn Fatty acid synthase Rattus norvegicus
P12785 0.000315 50 25 5 210 1 Fasn Fatty acid synthase Rattus norvegicus
Q0CSA2 3.7e-62 241 25 29 907 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CSA2 1.28e-26 124 30 14 369 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CSA2 5.21e-13 79 25 13 329 1 tazA Non-reducing polyketide synthase tazA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A179H0J7 9.31e-62 240 35 12 409 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
A0A179H0J7 3.01e-19 100 29 6 254 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
A0A179H0J7 4.39e-08 63 28 3 164 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
A0A179H0J7 7.37e-07 59 24 7 266 2 lcsC Highly reducing polyketide synthase lcsC Purpureocillium lilacinum
Q1B6A7 1.05e-61 237 31 12 519 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
Q5AXA9 1.14e-61 239 24 24 956 1 pkgA Non-reducing polyketide synthase pkgA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P49327 2.71e-60 235 25 35 907 1 FASN Fatty acid synthase Homo sapiens
P49327 1.04e-05 55 34 2 100 1 FASN Fatty acid synthase Homo sapiens
G3J9P0 1.46e-59 232 31 8 456 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
Q2T4P1 2.37e-59 232 30 13 527 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4P1 3.02e-16 90 33 7 231 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2T4P1 9e-09 65 27 10 252 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
D7UQ44 5.62e-59 231 33 12 444 1 sol1 Prosolanapyrone synthase Alternaria solani
D7UQ44 6.21e-14 82 29 4 186 1 sol1 Prosolanapyrone synthase Alternaria solani
D7UQ44 6.99e-14 82 34 6 167 1 sol1 Prosolanapyrone synthase Alternaria solani
D7UQ44 2.28e-08 64 21 10 334 1 sol1 Prosolanapyrone synthase Alternaria solani
A0A0K0MCJ4 6.55e-59 231 23 20 844 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A0K0MCJ4 1.66e-22 110 29 10 257 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A0A0K0MCJ4 3.67e-18 96 26 18 383 1 cazM Iterative polyketide synthase CazM Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q0CF73 2.33e-58 229 24 20 851 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CF73 2.59e-22 110 30 9 255 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CF73 2.56e-16 90 26 19 366 1 ATEG_07661 Non-reducing polyketide synthase ATEG_07661 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0V6Q6 3.32e-58 229 26 29 863 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0V6Q6 5.1e-17 92 30 3 195 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0V6Q6 5.82e-14 82 29 7 191 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0V6Q6 0.000219 51 21 4 214 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q0V6Q6 0.000331 50 21 12 362 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P9WQ63 4.68e-58 226 31 10 533 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q73XY1 5.58e-58 225 30 10 529 3 mbtB Phenyloxazoline synthase MbtB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
G0LET7 6.46e-58 227 24 29 921 2 BOA9 Reducing polyketide synthase BOA9 Botryotinia fuckeliana (strain B05.10)
P9WQ62 8.36e-58 226 30 10 533 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q0C9L7 1.03e-57 227 27 21 793 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C9L7 2.65e-14 84 29 3 195 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C9L7 5.29e-12 76 38 2 113 1 ctvA Highly reducing polyketide synthase ctvA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q7TYQ4 2.29e-57 224 30 10 533 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O31784 9.58e-57 223 29 13 553 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 1.28e-50 203 29 10 480 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 2.67e-17 94 29 8 263 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 8.54e-13 79 29 7 231 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
O31784 2.79e-07 60 26 5 175 1 pksR Polyketide synthase PksR Bacillus subtilis (strain 168)
P9WET7 3.2e-56 222 27 15 673 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
P9WET7 5.26e-22 109 31 8 266 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
P9WET7 1.85e-15 87 32 5 179 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
P9WET7 1.68e-07 61 21 10 368 2 Preu2 Reducing polyketide synthase Preu2 Preussia isomera
A0A084R1H6 4.12e-56 221 25 26 924 3 ATR6 Highly reducing polyketide synthase ATR6 Stachybotrys chlorohalonata (strain IBT 40285)
A0A3G1DJH7 1.28e-54 216 33 11 433 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJH7 9.52e-17 92 31 8 234 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJH7 1.32e-13 81 32 7 209 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJH7 6.75e-12 75 21 9 361 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
A0A3G1DJH7 2.33e-08 64 21 14 434 1 pks1 Squalestatin tetraketide synthase Phoma sp. (strain ATCC 20986 / MF5453)
Q558W4 6.04e-54 214 31 15 469 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
Q558W4 1.31e-09 68 24 6 209 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
Q558W4 1.1e-05 55 24 4 207 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
Q558W4 1.66e-05 55 23 7 244 3 pks15 Probable polyketide synthase 15 Dictyostelium discoideum
A0A067MTM1 1.77e-53 212 31 11 437 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
A0A3G9K3K9 5.46e-52 207 23 22 852 1 hisps Hispidin synthase Neonothopanus nambi
B6H999 9.57e-52 207 31 13 450 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6H999 1.62e-07 61 21 11 296 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6H999 2.37e-05 54 21 4 195 1 xilA Highly reducing polyketide synthase xilA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
G4N137 4.69e-51 204 33 8 414 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q54G30 5.27e-51 204 30 9 395 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q54G30 2.07e-09 67 23 8 235 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q54G30 6.14e-08 62 20 8 318 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q54G30 4.66e-06 56 26 4 167 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q54G30 8.24e-06 55 23 12 320 3 pks27 Probable polyketide synthase 27 Dictyostelium discoideum
Q54FI3 6.19e-51 204 31 6 421 1 StlB Polyketide synthase 37 Dictyostelium discoideum
Q54FI3 5.34e-10 69 23 12 287 1 StlB Polyketide synthase 37 Dictyostelium discoideum
A0A384XH94 2.13e-50 202 24 30 947 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
A0A384XH94 3.3e-15 87 32 4 179 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
A0A384XH94 7.52e-09 65 24 7 216 1 stpks1 Highly reducing polyketide synthase stpks1 Strobilurus tenacellus
G3XCV2 2.83e-50 201 29 14 536 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0A9P5GG56 3.75e-50 202 32 11 434 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
A0A9P5GG56 7.57e-08 62 23 11 298 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
A0A9P5GG56 1.57e-05 55 21 6 245 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
A0A9P5GG56 9.01e-05 52 30 7 143 1 xilA Highly reducing polyketide synthase xilA Penicillium crustosum
A0A0H2ZGB9 5.77e-50 200 29 14 536 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5BBP8 1.04e-49 200 30 8 429 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BBP8 5.67e-13 79 20 10 378 1 pkhA Non-reducing polyketide synthase pkhA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0CS88 4.19e-48 195 33 13 443 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CS88 1.95e-10 71 21 11 367 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CS88 5.83e-06 56 26 4 171 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CS88 0.000168 51 21 8 371 2 tazB Highly reducing polyketide synthase tazB Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A345BJP0 8.98e-48 194 30 12 446 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
A0A345BJP0 2.26e-09 67 27 5 202 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
A0A345BJP0 1.97e-06 57 31 3 131 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
A0A345BJP0 4.37e-06 56 21 16 419 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
A0A345BJP0 0.000601 49 34 4 132 3 clz2 Squalestatin tetraketide synthase clz2 Cochliobolus lunatus
Q0C8L6 2.94e-46 189 24 34 966 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8L6 1.48e-20 104 32 6 206 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8L6 4.95e-12 76 28 6 209 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0C8L6 7.2e-11 72 27 12 370 1 lovF Lovastatin diketide synthase lovF Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P36189 2.73e-45 172 31 10 377 1 FASN Fatty acid synthase (Fragment) Anser anser anser
A0A1B3PEI6 1.82e-43 180 30 14 465 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1B3PEI6 5.35e-08 63 22 5 211 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1B3PEI6 9.3e-06 55 23 11 347 1 ORF-A Polyunsaturated fatty acid synthase subunit A Thraustochytrium sp. (strain ATCC 26185 / S-3)
G4NEB1 6.97e-41 171 36 3 240 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4NEB1 1.17e-22 111 23 14 451 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4NEB1 1.54e-18 97 29 12 326 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4NEB1 2.81e-09 67 27 7 218 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4NEB1 0.000118 52 24 7 280 1 NEC1 Highly reducing polyketide synthase NEC1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q1IAL0 7.05e-35 151 27 11 462 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
Q1IAL0 4.9e-09 66 22 14 428 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
P9WET0 1.38e-33 147 32 5 264 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
P9WET0 2.55e-15 87 25 17 439 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
P9WET0 2.35e-13 80 31 4 205 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
P9WET0 1.05e-10 72 25 13 345 1 Preu9 Polyketide synthase-like protein Preu9 Preussia isomera
P96285 4.64e-33 145 26 8 432 1 pks1 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P96285 4.63e-23 112 28 11 366 1 pks1 Putative inactive phenolphthiocerol synthesis polyketide synthase type I Pks1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P06231 1.68e-30 130 29 5 266 3 nodE Nodulation protein E Rhizobium meliloti
P06230 1.71e-30 130 29 5 266 3 nodE Nodulation protein E Rhizobium meliloti (strain 1021)
P04683 5.34e-30 129 28 5 275 3 nodE Nodulation protein E Rhizobium leguminosarum bv. viciae
P04684 1.25e-28 124 28 7 268 3 nodE Nodulation protein E Rhizobium leguminosarum bv. trifolii
A0A1V6PAA5 2.57e-28 123 35 5 212 1 calH Methyltransferase calH Penicillium decumbens
A0A1V6PAA5 5.54e-19 95 35 3 177 1 calH Methyltransferase calH Penicillium decumbens
P72331 5.37e-27 120 27 4 266 3 nodE Nodulation protein E Rhizobium sp. (strain N33)
P56902 1.07e-26 119 31 7 280 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Rhizobium meliloti (strain 1021)
Q9D404 1.97e-26 119 30 7 280 1 Oxsm 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Mus musculus
A0A1B3PEI8 2.86e-26 123 24 15 503 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
A0A1B3PEI8 1.08e-09 68 25 12 325 1 ORF-B Polyunsaturated fatty acid synthase subunit B Thraustochytrium sp. (strain ATCC 26185 / S-3)
Q8L3X9 1.85e-25 116 29 6 279 1 KAS 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Arabidopsis thaliana
Q83E37 1.01e-24 113 28 6 278 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
P40804 1.14e-24 113 31 6 275 1 pksF Polyketide biosynthesis malonyl-ACP decarboxylase PksF Bacillus subtilis (strain 168)
Q9NWU1 7.39e-24 111 30 7 280 1 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Homo sapiens
O34340 1.03e-23 110 29 7 281 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Bacillus subtilis (strain 168)
P23902 1.49e-23 110 30 6 272 1 KAS12 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Hordeum vulgare
P52410 1.79e-22 107 32 7 268 1 KAS1 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic Arabidopsis thaliana
P9WQD7 1.06e-21 104 30 8 265 1 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD6 1.06e-21 104 30 8 265 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63457 1.06e-21 104 30 8 265 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KQH9 2.77e-21 103 26 6 284 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O94297 3.67e-21 102 29 5 282 3 SPBC887.13c Putative 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0VCA7 3.79e-21 103 26 13 387 2 OXSM 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial Bos taurus
P55338 8.93e-21 101 26 6 286 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Vibrio harveyi
A7Z4X9 1.42e-20 99 24 6 289 1 baeD Polyketide biosynthesis acyltransferase homolog BaeD Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P0AAI8 1.61e-20 100 28 7 284 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Shigella flexneri
P0AAI5 1.61e-20 100 28 7 284 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli (strain K12)
P0AAI6 1.61e-20 100 28 7 284 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAI7 1.61e-20 100 28 7 284 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Escherichia coli O157:H7
P0A953 3.06e-20 99 27 6 280 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli (strain K12)
P0A954 3.06e-20 99 27 6 280 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5TKS0 4.37e-20 99 26 5 279 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 (Fragment) Staphylococcus aureus
O34877 5.15e-20 97 25 6 290 1 pksD Polyketide biosynthesis acyltransferase homolog PksD Bacillus subtilis (strain 168)
Q05356 5.43e-20 99 25 5 277 3 sch1 Putative polyketide beta-ketoacyl synthase 1 Streptomyces halstedii
Q5W262 5.88e-20 101 29 6 275 1 pigJ Beta-ketoacyl synthase PigJ Serratia sp. (strain ATCC 39006)
Q8NXE1 7.45e-20 98 26 5 281 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MW2)
Q6GAU2 7.45e-20 98 26 5 281 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MSSA476)
Q6GIA3 7.45e-20 98 26 5 281 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain MRSA252)
Q7A6F8 7.45e-20 98 26 5 281 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain N315)
Q99VA6 7.45e-20 98 26 5 281 3 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHA1 7.45e-20 98 26 5 281 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Staphylococcus aureus (strain COL)
Q9CBS7 1.38e-19 97 26 6 271 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium leprae (strain TN)
P73283 1.65e-19 97 29 7 269 1 fabF 3-oxoacyl-[acyl-carrier-protein] synthase 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O69473 4.73e-19 96 28 8 265 3 kasB 3-oxoacyl-[acyl-carrier-protein] synthase 2 Mycobacterium leprae (strain TN)
P39525 7.03e-19 96 26 10 354 1 CEM1 3-oxoacyl-[acyl-carrier-protein] synthase homolog Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A1B4XBK1 2.46e-18 94 25 10 309 3 sdnL Polyketide methyltransferase sdnL Sordaria araneosa
A0A1B4XBK1 4.89e-18 93 26 9 289 3 sdnL Polyketide methyltransferase sdnL Sordaria araneosa
P9WQD9 3.15e-18 94 26 7 272 1 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD8 3.15e-18 94 26 7 272 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8ESN0 3.15e-18 94 26 7 272 2 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P63455 3.15e-18 94 26 7 272 3 kasA 3-oxoacyl-[acyl-carrier-protein] synthase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P23155 4.32e-18 93 24 4 267 3 SCO5318 Putative polyketide beta-ketoacyl synthase 1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4WAZ0 4.4e-18 95 28 8 258 1 psoF Dual-functional monooxygenase/methyltransferase psoF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAZ0 3.78e-10 69 30 5 166 1 psoF Dual-functional monooxygenase/methyltransferase psoF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P41175 7.82e-18 92 24 5 284 3 None Putative polyketide beta-ketoacyl synthase 1 Streptomyces virginiae
Q02578 2.33e-17 91 25 4 252 3 curA Putative polyketide beta-ketoacyl synthase 1 Streptomyces cyaneus
Q9C9P4 5.47e-17 91 29 6 272 1 KAS2 3-oxoacyl-[acyl-carrier-protein] synthase II, chloroplastic Arabidopsis thaliana
P43710 4.26e-16 87 27 7 276 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q02K94 4.49e-16 87 25 12 366 1 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
P71019 4.52e-16 85 24 6 287 3 fabD Malonyl CoA-acyl carrier protein transacylase Bacillus subtilis (strain 168)
A7Z4X8 1.01e-15 84 26 8 288 1 baeC Polyketide biosynthesis malonyl CoA-acyl carrier protein transacylase BaeC Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P16538 4.24e-15 84 26 5 266 1 tcmK Tetracenomycin polyketide synthase ketoacyl synthase alpha subunit Streptomyces glaucescens
A0A1B5L8S2 5.41e-15 84 29 7 228 3 ustM Polyketide methyltransferase ustM Ustilaginoidea virens
A0A1B5L8S2 3.8e-13 78 23 8 227 3 ustM Polyketide methyltransferase ustM Ustilaginoidea virens
P57193 1.06e-13 79 27 7 274 3 fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12840
Feature type CDS
Gene -
Product type I polyketide synthase
Location 2841064 - 2850279 (strand: 1)
Length 9216 (nucleotides) / 3071 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3016
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00109 Beta-ketoacyl synthase, N-terminal domain
PF00550 Phosphopantetheine attachment site
PF00668 Condensation domain
PF00698 Acyl transferase domain
PF00975 Thioesterase domain
PF02801 Beta-ketoacyl synthase, C-terminal domain
PF08242 Methyltransferase domain
PF08659 KR domain
PF16197 Ketoacyl-synthetase C-terminal extension

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3321 Secondary metabolites biosynthesis, transport and catabolism (Q) Q Acyl transferase domain in polyketide synthase (PKS) enzymes

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04786 yersiniabactin nonribosomal peptide/polyketide synthase Biosynthesis of siderophore group nonribosomal peptides -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044300 type I polyketide synthase VF1251 Nutritional/Metabolic factor

Protein Sequence

MLNFETFYGNSEPIAVIGLSGRFPDAQNIDQFWHNIINKHDSSRLFSEEELKAAGVAEQTYHSPDFVNRGAPLDEAEYFDATLFNYSRSEAELIDPQQRIFLQGAWHALEHAGYAPCNITIKTGVFASARMSSYPAQQDLALHNIGHVRGMQKLLGNDKDYLATRIAYKLNLTGPALTIQTACSSSLVAVHMACESLRSGECSMAIAGGIGITFPQTGGYLYQKGMIFSPDGICRPFDAEANGTFAGNGFGIVVLRRLEDALVDGNTIIAVLRGSAINNDGHQKAGFTAPSVAGQVSVIREAIQLADIKNEDIELIEAHATATPLGDPIEFSALCQVFADRSLTASKCAIGSVKGNIGHLDTAAGITGLIKTILAVNKALIPPSMHFNHPNPQLQIEKSPFYIPKNPKAWSSRIRTAGVSSFGIGGTNCHIIVQSLPDSLVSIKPEQEVDNNFEYSLLLSAATKESLKKLAGDYAPLIKITPANILAHNALQQRQLNLPWRLSIPLTSESDISLLAFSQGSADSLIQYGHTSTNKKIAWLFSGMGSQYPAMGKVMYQHSTTFAETIDRCEQACLQHLTFPLKEVMFGLHSDKLVNASYIQAAIVAYEIAMAAHWRAIGILPEIIVGHSCGEYAAAVIAGFYTIEQMMPLAVYSGQLMESHVNGEMIAVFAEYQDIQIIAKQCHVELAAINGHNNLSFAGQPDDMQKFTQILKAKNIRFREMNNVCAAHTSYIDNILDQLMEFTESLSASQGKIALVSGYTGQLISQKELQHPSYWAQQLRNTVMYQDAIQTLVNHGVTHAMELGPTSVLSDLGEREGITEISWIPTARMGVDEIQMKQQAATTLFIAGYDLPWQSLFKTQGSYIPLPLYPFEKQYYWYEKKDSEKYQPQKSAFDLPISQGRETALKALTTLDLPRLNSFNSTLTTLHNYYVDKMICSCLGHELNTPMSVIDIMRAGRILPRYYQLLVRLLEACVEDGYYIYQQINQHNYYKKIKSISSDKLPLLFHQLQLDSEGLQSIPDTVKRAGEQLYDMMTGVIEPVSVIFPEGASQGVEVLYQDFSFGRYFNQIAAAVLKGLLSHYQPTVAKPLRIIEVGGGTGGTTSWLLPILSTIQHVEYEFTDISPIFTRRAAQKFSQYSFVNYREFNLQQSPEIQGFQSDYYDIIIAANVIHATQHIGDTLTALRTLLRSNGHLLMREITKQARLFDFVFGPLVLPLHDEKIRKGKLFLSPELWHQQCRLAGFQHIRWLPDALPETKDMCEHIILASVSTENDHFDQELPSDTKIQQSSHYQWQLTPCVEQDLIKPTLIFNHQQTLPSEITAILSAIGCLSEQGENQLIVANLADPLIIAEQIRQILLSSSDGFVVITQQAWALTAIETVNPAQRSIRSLLKTIQKEYSSRLIAIVDLGINASWSELVPAFIQIEQGNNEIIVRNHCCYLPQLTPLPSSSTIIAQNIMVSPRWHIITGGFGGLGRITASWLVRQGAKRIAILAPRADSSALDWMNNLQKSNQLEIKWLTCDCRDNAKCHAALTQLENEGGIEGLIHSAGILDDALMTQLTPKRMSDVFSVKAISAKQFCDALEKTDASYLILYSSAAATIGSEGQAAHSLACGYLDGLAEYARRNIKGLTVISIAWGAWQSVGFVAEKQLHDKLQHKGMSTLTTEEGLAHLDACLLDNTSCRLAMRLATPPLMTQKTPLFHQTNHNDHYDNHEINHTRQLCETPTQTDQTEPVSPNRVDYRVGDNLEQWLTACIKQLLRLGDEHIDTHIELFQLGLDSLSFLDLSAEIKKQFAVNIDAEQSYDDMTIAGLASVIRTAAPEKFTVTEALHNQDNISHTMESERYAPFPLTPIQHAYWIGRKNLFNYGGVACHAIFEWDCQRHIWEPASLEKAWNKVIQRHDMLRMIIDDDGQQRILKEVPYFHFIQHDLTNLTQQEQQESLTQIREALSYRVLPTESWPLFEVEISWLNNDCYRLHINLDLLQFDTMSFKILFDDLFNAYSGQELIPQTFTFRDYCLKNQTNRNSDEWKMAWCYWQDLLSDLPSAPYLPIKNSSITEQPRFTTFQHHVSIAQWDKLKQRWKKHGITPSAGLLTLFALVLGRWTKYPAFTLNLTFFNRQPWHPDVTQLIGDFTSVLPIDIYLDNDCTLNESMAKIQRRLWQHLSKSQVNGVEILREWGRYKGDSSQSLLPIVFTSMLGMTLDGDNIDEALNQLFGQPVYSFAQTPQVWLDHQVMEGKEGLTLNWFCMDDIFADGLLTMMFSDYQSLITQLCQDEDNNQSVDKIIAQLPSYQHLAIDNHLQSRYQQLEQTLENHPQIKRAHAMVMVKDDTKVEPPLQLLFEASSDIPLSVIKQPNWLPNLLSPSASLSDIIEKSWQRFEERARYGICHTLYRNALFTELNTPITLAEIVARLKAKPQYERLLSQWLDLLCLHHLLTKEGDQFYATTQFINLCLSAPVFQQPVNDWEYVLWDYLEQSLTQHELLFSGKVSPLSLLFNSDEITTALYAKHPALNYLNQCAKDIVSAMVGATSSLNILEIGAGTGATTQGIVAVLKNTHYSYTFTDISHYFLDKARKKFTAVGEMRYQLFDINAPIQFSHHPDNGYDLIIASNVLHDASHIGHALKRIRSLLKPQGYLLFIEATECQSAMQMATVGFIEGLSAYQDKRILTNKAMLDSESWHDILINTGFETIGQWPQTDSSSLRQTLFLASPTRGGKPYLGKLRDYLSHSLDQNIDSFELFQCENIEATLNGIATSSAQELNEQIQPVAIPDVPTNMINEIIALWSELLGREVNSTNDFFRSGGDSLIATKMISQLHQRGYPATLQQIFTYPCLADFCAHLEQEKQSQREYSSLIPLSAVSAPKPYHYFMVHASDGDPGVYLPLAESLNNTVWGLTVTDASKLTDLDTLLSLHLSSIKTAQQTGPYILIGWSYGAFIASYLAEQLSQQNHSVLLVLIDPVYRHDFIKFCHDDSDSSSDENKQLACTKRLMSFLPESDLPLSDDIACLWLEATNHPTEWTSPEKEWYQRLPPHTQHHYFSGEHWSILQDRATSTHLAEIIDQWVQQKLSNNGYPSEGGN

Flanking regions ( +/- flanking 50bp)

GAAAGAAACGGTTACAACTACGAACTCATAGTAGATAAAGGATATTAATCATGCTGAATTTTGAAACTTTCTATGGTAATAGTGAACCTATAGCTGTTATTGGTCTTTCTGGTCGCTTCCCTGATGCACAAAATATTGATCAATTTTGGCATAACATAATTAATAAACACGATAGCTCTCGTCTTTTTTCTGAAGAAGAACTAAAAGCCGCAGGTGTCGCTGAACAAACTTATCATTCACCTGATTTTGTTAATCGTGGCGCGCCGTTAGATGAAGCGGAATATTTTGACGCTACTCTATTTAATTATTCACGCTCAGAAGCTGAACTTATCGATCCCCAGCAAAGAATTTTTTTACAAGGTGCTTGGCATGCTTTAGAGCATGCTGGATATGCCCCTTGCAATATAACCATCAAAACAGGCGTTTTTGCTTCAGCAAGAATGAGCAGCTATCCTGCCCAGCAAGATTTAGCATTGCACAATATTGGCCATGTCCGTGGCATGCAAAAATTATTAGGGAATGATAAAGACTATCTCGCAACACGTATTGCATATAAATTAAATTTAACTGGTCCAGCATTAACTATACAAACCGCTTGTTCTAGCTCCTTAGTTGCCGTACATATGGCTTGTGAAAGTTTACGCTCTGGTGAATGCAGTATGGCTATTGCTGGTGGAATTGGTATCACATTTCCACAAACCGGTGGTTATCTATATCAGAAAGGCATGATCTTCTCACCAGATGGTATTTGTCGTCCTTTTGATGCAGAGGCAAACGGTACTTTTGCTGGTAATGGATTTGGTATTGTAGTGTTACGTCGTCTTGAAGATGCCTTAGTGGATGGAAACACAATTATTGCTGTATTACGTGGTAGTGCCATTAATAATGATGGTCATCAAAAAGCGGGATTCACAGCTCCCTCCGTAGCAGGCCAAGTTTCAGTTATTAGAGAAGCAATACAACTGGCCGATATTAAAAATGAAGATATTGAACTTATTGAAGCACACGCAACAGCTACACCATTAGGTGATCCAATTGAGTTTAGTGCATTATGTCAGGTTTTCGCTGATCGCTCTCTTACTGCTTCTAAATGCGCTATTGGCTCAGTTAAAGGCAATATCGGACATCTGGATACAGCAGCAGGTATCACTGGCCTAATTAAAACGATATTAGCGGTAAATAAAGCACTTATTCCTCCATCTATGCATTTTAATCACCCAAATCCTCAATTACAAATAGAAAAAAGCCCGTTCTACATTCCTAAAAACCCTAAAGCTTGGTCTAGCAGAATACGAACTGCTGGTGTTTCTTCATTTGGTATTGGTGGAACAAACTGTCATATCATTGTGCAATCATTGCCTGACTCATTAGTATCAATCAAACCTGAACAAGAGGTAGACAATAATTTTGAATACTCATTATTGCTTAGTGCCGCCACAAAAGAGAGTCTAAAAAAACTTGCTGGTGATTATGCACCATTAATAAAAATTACCCCAGCAAACATTCTGGCTCATAATGCATTACAGCAAAGACAACTCAACTTACCATGGCGCTTATCTATCCCCTTAACAAGTGAGAGTGATATTTCACTGTTAGCTTTCTCTCAAGGAAGTGCTGATTCTTTAATACAATATGGTCATACATCAACAAATAAGAAAATAGCGTGGCTATTTTCTGGTATGGGATCACAATATCCTGCTATGGGTAAAGTGATGTACCAACATTCAACAACATTTGCCGAAACAATCGATCGTTGTGAGCAAGCATGCCTGCAACACTTAACATTTCCGTTAAAAGAAGTCATGTTTGGCCTACATAGCGATAAACTTGTTAATGCCAGTTATATTCAAGCGGCTATTGTCGCCTATGAAATCGCAATGGCAGCACATTGGCGAGCAATCGGTATTTTACCTGAAATAATTGTAGGTCATTCTTGCGGAGAATATGCCGCAGCCGTTATCGCTGGTTTCTATACAATCGAACAAATGATGCCACTTGCTGTATATAGTGGACAATTAATGGAAAGTCATGTTAATGGTGAAATGATTGCTGTATTTGCAGAATATCAAGATATTCAAATCATTGCTAAACAATGTCATGTTGAATTAGCTGCAATTAATGGCCATAACAACTTATCATTCGCGGGGCAACCCGATGATATGCAAAAGTTTACTCAAATATTGAAAGCAAAGAATATTCGATTTAGAGAAATGAATAACGTGTGTGCTGCTCATACCTCTTATATTGATAATATTCTTGATCAATTGATGGAATTTACTGAGTCATTATCAGCCTCACAAGGAAAAATAGCCTTAGTCTCAGGCTATACAGGGCAATTAATTTCTCAAAAAGAACTTCAACATCCATCATATTGGGCTCAGCAACTACGCAATACAGTTATGTATCAAGATGCAATACAAACGTTAGTCAATCATGGTGTCACCCATGCTATGGAATTAGGACCAACTTCTGTATTAAGTGATCTTGGTGAACGTGAAGGCATTACTGAGATTAGTTGGATACCAACTGCCAGAATGGGAGTTGATGAAATTCAGATGAAACAACAGGCTGCAACAACCCTATTTATTGCAGGCTATGATTTACCATGGCAGTCACTGTTTAAAACTCAAGGAAGTTATATACCATTACCTCTCTATCCCTTTGAAAAACAATATTATTGGTATGAAAAAAAGGATAGTGAAAAATATCAACCACAAAAAAGCGCATTTGATTTACCTATTAGCCAAGGTCGTGAAACGGCATTAAAAGCGCTTACAACACTCGATCTTCCTCGTTTAAACTCATTTAATTCAACACTTACCACTTTACATAATTATTACGTCGATAAAATGATATGCTCGTGTTTAGGCCATGAGTTGAATACCCCCATGTCTGTAATCGATATTATGCGAGCAGGACGCATTTTACCCCGCTATTATCAATTATTAGTACGTTTATTAGAGGCCTGTGTTGAGGATGGATATTATATTTACCAACAGATAAATCAGCACAACTACTATAAAAAAATAAAATCTATTTCTAGTGATAAATTACCATTATTATTCCATCAATTACAATTAGATAGCGAAGGTCTTCAATCTATTCCTGACACCGTCAAGCGAGCAGGAGAGCAACTCTACGATATGATGACAGGCGTGATTGAACCTGTTTCAGTGATCTTTCCTGAAGGTGCATCTCAAGGTGTTGAAGTTCTCTATCAAGATTTTAGTTTTGGTCGTTATTTTAACCAAATTGCTGCCGCGGTACTTAAAGGATTACTTTCTCACTACCAGCCCACTGTGGCTAAGCCTTTGCGAATTATTGAAGTCGGTGGTGGCACGGGAGGAACCACCTCTTGGCTGCTACCTATTTTATCAACCATACAACATGTTGAATACGAATTTACCGATATTTCACCTATCTTCACCCGACGTGCCGCACAAAAATTTAGTCAATATTCATTTGTTAACTATCGAGAGTTCAATTTACAACAATCCCCTGAAATACAAGGTTTTCAATCTGATTATTATGACATTATTATTGCTGCTAATGTTATTCATGCCACTCAACATATTGGAGATACATTAACTGCTCTTCGTACTTTACTGCGTTCCAATGGTCATTTGCTTATGCGCGAAATAACCAAACAAGCTCGCTTATTTGATTTTGTTTTTGGCCCACTGGTGTTACCCCTCCATGATGAAAAGATCCGTAAAGGAAAACTATTTTTATCACCAGAATTATGGCATCAACAGTGTCGCTTAGCAGGATTTCAACATATTCGCTGGTTACCTGATGCATTACCAGAAACCAAAGATATGTGTGAACATATTATTCTCGCCAGTGTTTCGACAGAAAACGATCACTTTGATCAAGAGTTACCTAGTGACACCAAGATACAACAAAGTTCACACTACCAATGGCAATTAACACCTTGTGTGGAACAAGATCTTATCAAGCCAACATTAATATTTAACCATCAACAAACATTGCCTTCTGAAATCACAGCTATTTTATCCGCTATTGGATGTCTTTCTGAACAGGGCGAAAATCAATTAATCGTTGCCAACCTTGCAGATCCTTTAATTATCGCCGAGCAGATCCGCCAAATATTACTGTCATCGTCTGATGGGTTTGTTGTTATCACGCAACAAGCCTGGGCATTAACTGCCATAGAAACGGTTAATCCAGCACAACGTAGTATTCGAAGTTTATTAAAAACTATTCAAAAAGAATATAGCTCAAGGTTAATTGCCATTGTTGATTTAGGTATAAATGCCTCATGGTCTGAATTAGTTCCTGCTTTTATACAAATAGAACAAGGTAATAATGAAATTATTGTTCGTAACCATTGCTGCTACTTACCACAATTAACCCCACTGCCCTCATCTTCTACGATCATAGCGCAGAACATCATGGTATCCCCGCGCTGGCATATTATTACTGGTGGTTTTGGAGGCTTAGGTCGAATTACAGCAAGTTGGTTAGTAAGGCAAGGTGCTAAACGTATCGCTATTTTGGCACCACGAGCTGATAGCAGCGCATTAGATTGGATGAATAACTTACAGAAATCTAACCAGCTAGAAATAAAATGGCTAACATGTGATTGTCGTGATAACGCTAAATGTCATGCAGCACTCACTCAGCTTGAAAATGAAGGTGGCATTGAGGGGCTTATACACAGTGCAGGTATTTTGGATGATGCACTTATGACACAACTCACCCCTAAGCGTATGTCTGACGTATTTTCTGTTAAAGCGATATCTGCCAAGCAATTTTGTGATGCTTTAGAAAAAACAGATGCCAGTTACCTTATTTTATACTCCTCTGCCGCTGCAACTATAGGCTCTGAAGGACAAGCAGCTCATTCCCTCGCTTGTGGATATTTAGATGGATTAGCTGAATATGCACGTCGCAATATCAAGGGATTAACCGTCATTTCTATCGCTTGGGGGGCATGGCAAAGTGTTGGCTTTGTGGCAGAAAAACAACTCCATGATAAATTACAACACAAAGGTATGAGTACGCTTACTACTGAGGAAGGACTGGCACATTTAGATGCTTGTCTGCTAGATAATACCTCTTGTCGCCTTGCAATGCGCTTAGCGACTCCACCTTTAATGACACAAAAAACGCCTTTATTTCATCAGACTAATCATAATGATCATTATGATAACCATGAAATTAATCACACTCGCCAGCTTTGTGAAACCCCAACTCAAACGGATCAAACAGAGCCGGTAAGCCCTAACAGGGTTGATTATCGCGTTGGTGATAACTTAGAACAGTGGCTAACAGCATGTATCAAACAACTGTTGCGTCTTGGTGATGAACATATTGATACTCACATTGAACTATTCCAATTAGGACTAGATTCTCTCTCTTTCCTCGATCTCAGTGCGGAAATTAAGAAACAGTTTGCGGTCAATATTGACGCTGAACAATCTTATGATGATATGACTATTGCTGGTTTAGCCTCAGTTATTCGAACCGCAGCACCTGAGAAATTTACTGTGACAGAAGCACTCCATAATCAAGACAACATTTCCCACACAATGGAGTCAGAACGATATGCCCCATTTCCATTAACACCAATTCAACACGCCTATTGGATCGGACGTAAAAACCTCTTTAACTACGGAGGCGTTGCTTGCCATGCAATTTTTGAATGGGATTGTCAACGCCATATATGGGAGCCGGCCTCACTTGAAAAAGCTTGGAATAAAGTTATTCAGCGTCATGATATGTTGAGAATGATCATAGATGATGATGGACAACAACGTATCTTAAAAGAAGTTCCTTATTTTCATTTTATTCAACATGACCTAACAAATTTAACCCAACAAGAGCAACAAGAGAGCCTAACACAGATAAGGGAAGCCCTTTCTTATCGGGTATTACCGACTGAGTCATGGCCATTATTTGAAGTTGAAATTTCTTGGCTAAATAACGATTGTTACAGATTACATATCAATCTAGATTTACTGCAGTTTGATACCATGAGCTTTAAAATTCTGTTTGATGATCTATTTAACGCCTATTCAGGACAAGAATTAATACCACAAACATTTACCTTCCGCGACTACTGCTTAAAAAATCAAACAAATCGTAACAGTGATGAGTGGAAAATGGCATGGTGTTACTGGCAGGATCTATTATCTGATTTACCTTCTGCCCCATATTTACCGATAAAGAATTCATCCATTACTGAACAACCTCGTTTTACGACTTTCCAACATCATGTTTCTATAGCGCAATGGGACAAATTAAAACAGAGGTGGAAAAAGCATGGTATTACACCATCAGCAGGGCTTTTAACACTTTTTGCTTTAGTTTTAGGTCGCTGGACAAAATACCCAGCCTTTACACTAAACTTAACTTTCTTTAATCGTCAACCATGGCACCCAGATGTTACACAACTTATTGGTGATTTTACCTCTGTACTCCCTATAGATATTTATCTAGATAACGACTGTACATTAAATGAGTCAATGGCAAAAATACAGCGCAGACTTTGGCAACATTTAAGTAAGTCCCAAGTAAATGGTGTAGAGATTTTACGTGAATGGGGACGCTATAAAGGGGATAGTAGCCAATCTCTGTTACCTATTGTATTTACTAGCATGTTAGGTATGACACTAGATGGTGACAATATTGATGAAGCATTAAATCAGCTTTTCGGCCAACCCGTATATAGCTTCGCGCAAACACCTCAAGTTTGGTTAGATCACCAAGTAATGGAAGGAAAAGAGGGGCTAACATTAAATTGGTTCTGCATGGATGACATCTTTGCTGACGGTTTATTAACAATGATGTTCTCTGATTATCAAAGCTTGATCACTCAATTATGCCAAGATGAAGATAATAATCAATCAGTTGATAAGATTATTGCGCAACTTCCTTCATATCAACATTTAGCAATAGATAATCACCTCCAATCACGCTATCAACAACTCGAGCAAACATTGGAAAATCATCCGCAAATCAAACGTGCTCATGCTATGGTAATGGTAAAAGACGATACGAAAGTAGAGCCTCCTCTACAATTACTGTTTGAAGCCTCTTCTGATATTCCACTATCCGTTATTAAACAGCCCAATTGGTTACCTAATTTACTTTCGCCATCAGCTTCACTCAGTGACATTATTGAAAAGAGTTGGCAACGATTTGAGGAACGAGCACGGTATGGCATATGTCACACACTGTATCGAAATGCTCTTTTTACCGAGCTAAACACACCAATCACCCTAGCTGAAATAGTGGCTCGTTTAAAAGCAAAGCCTCAGTATGAGAGGCTACTTAGTCAGTGGCTAGATTTATTATGCCTGCATCACTTATTAACCAAAGAGGGTGATCAGTTTTATGCCACAACACAGTTTATTAACTTATGTTTATCTGCCCCAGTATTTCAACAACCTGTTAATGATTGGGAATATGTACTTTGGGATTACCTTGAACAATCACTAACCCAACATGAATTACTCTTTAGTGGTAAGGTTTCTCCTCTTTCACTACTTTTTAATTCAGATGAAATTACCACAGCACTATACGCCAAACACCCTGCACTAAATTATTTAAATCAATGTGCAAAAGATATTGTTAGTGCAATGGTTGGTGCAACATCTTCACTCAATATTTTAGAAATAGGGGCAGGTACAGGAGCTACCACTCAAGGTATAGTCGCAGTACTTAAGAATACGCATTACTCATACACCTTTACTGATATATCACATTACTTCCTTGATAAAGCGCGAAAAAAATTCACTGCTGTAGGAGAAATGCGCTATCAACTCTTTGATATTAATGCACCAATACAATTTTCTCATCATCCAGATAATGGCTATGATCTGATCATTGCATCTAATGTATTACATGATGCATCACATATCGGCCACGCACTAAAACGGATTAGAAGCCTGTTAAAACCTCAAGGCTATTTATTATTTATCGAAGCAACCGAGTGTCAAAGTGCTATGCAAATGGCGACTGTTGGCTTTATTGAGGGATTAAGTGCATATCAAGATAAGCGTATATTGACGAATAAAGCGATGCTTGATAGTGAAAGTTGGCATGATATTTTAATCAATACTGGTTTTGAAACTATTGGTCAATGGCCCCAAACAGATTCCTCATCTTTGCGACAAACACTCTTTTTAGCCTCTCCCACTCGTGGAGGAAAACCTTATTTAGGTAAATTACGTGATTATTTATCTCATTCTCTTGATCAGAATATCGACTCTTTTGAGTTGTTCCAATGTGAAAATATTGAAGCAACCCTTAATGGCATAGCAACATCATCCGCTCAAGAGCTAAATGAACAGATACAACCTGTTGCAATACCTGATGTACCAACCAATATGATTAATGAAATCATTGCATTATGGTCTGAGTTATTAGGTCGTGAGGTCAATAGTACAAATGATTTCTTCCGTTCTGGAGGAGATAGTTTGATTGCAACCAAAATGATCAGCCAATTACATCAACGGGGATATCCAGCAACATTACAACAGATTTTTACCTATCCATGCTTAGCCGATTTTTGTGCTCATTTAGAGCAGGAAAAGCAATCTCAACGAGAGTACTCCTCTTTGATACCTCTAAGCGCTGTATCTGCTCCAAAACCTTACCACTACTTTATGGTACATGCTTCTGATGGTGATCCCGGTGTTTACCTACCTCTTGCTGAGTCGTTAAATAATACAGTGTGGGGATTAACAGTTACAGATGCTTCAAAACTAACTGATTTGGATACATTGTTATCATTACATTTATCTAGCATAAAAACAGCACAACAGACTGGCCCTTATATTCTTATTGGTTGGTCATATGGTGCTTTTATTGCCAGTTACCTTGCAGAACAACTCTCGCAACAAAATCATTCCGTATTATTAGTATTAATAGATCCCGTCTATCGACATGATTTTATTAAATTTTGTCATGATGACTCAGATAGTTCATCAGATGAAAATAAGCAGCTTGCATGCACTAAAAGACTTATGTCATTCCTACCTGAAAGTGACCTACCATTATCTGATGATATCGCCTGTTTATGGCTGGAAGCCACCAACCACCCAACAGAATGGACATCACCTGAAAAAGAGTGGTACCAACGATTACCGCCACATACCCAACATCACTATTTTTCAGGGGAGCACTGGTCAATACTGCAAGATCGCGCTACCAGCACACATCTGGCCGAAATCATTGATCAGTGGGTGCAACAAAAACTTTCTAATAACGGATATCCATCCGAAGGAGGTAATTAATGAAACCGGCAAAAAAAGTGGTGATTGTAGGCAGTAAATTTGGAGAGGTT