Homologs in group_402

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16240 FBDBKF_16240 35.4 Morganella morganii S1 radC DNA repair protein RadC
EHELCC_16275 EHELCC_16275 35.4 Morganella morganii S2 radC DNA repair protein RadC
NLDBIP_17065 NLDBIP_17065 35.4 Morganella morganii S4 radC DNA repair protein RadC
LHKJJB_16985 LHKJJB_16985 35.4 Morganella morganii S3 radC DNA repair protein RadC
HKOGLL_16855 HKOGLL_16855 35.4 Morganella morganii S5 radC DNA repair protein RadC
F4V73_RS17360 F4V73_RS17360 37.2 Morganella psychrotolerans radC DNA repair protein RadC
PMI_RS15605 PMI_RS15605 44.5 Proteus mirabilis HI4320 radC DNA repair protein RadC

Distribution of the homologs in the orthogroup group_402

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_402

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q9KR57 5.67e-56 176 56 1 151 3 VC_1786 UPF0758 protein VC_1786 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KUK8 1.57e-50 162 50 1 151 3 VC_0510 UPF0758 protein VC_0510 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F402 4.1e-48 158 56 0 140 3 VC0395_A2597 UPF0758 protein VC0395_A2597/VC395_0249 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KVC9 4.1e-48 158 56 0 140 3 VC_0217 UPF0758 protein VC_0217 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LQH9 4.1e-48 158 56 0 140 3 VCM66_0205 UPF0758 protein VCM66_0205 Vibrio cholerae serotype O1 (strain M66-2)
A1WZF2 5.27e-48 158 55 1 143 3 Hhal_2301 UPF0758 protein Hhal_2301 Halorhodospira halophila (strain DSM 244 / SL1)
Q87T86 3.76e-47 155 55 0 140 3 VP0184 UPF0758 protein VP0184 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MSP7 5.16e-47 155 55 0 140 3 VIBHAR_00653 UPF0758 protein VIBHAR_00653 Vibrio campbellii (strain ATCC BAA-1116)
B7VHK2 5.94e-47 155 54 0 140 3 VS_0182 UPF0758 protein VS_0182 Vibrio atlanticus (strain LGP32)
Q1QT91 7.54e-47 155 58 0 128 3 Csal_2972 UPF0758 protein Csal_2972 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8DDY0 1.88e-46 154 54 0 140 3 VV1_0825 UPF0758 protein VV1_0825 Vibrio vulnificus (strain CMCP6)
Q7MPS7 1.88e-46 154 54 0 140 3 VV0285 UPF0758 protein VV0285 Vibrio vulnificus (strain YJ016)
A4VGS8 2.21e-46 154 52 0 140 3 PST_0473 UPF0758 protein PST_0473 Stutzerimonas stutzeri (strain A1501)
A4Y0K7 2.46e-46 153 52 0 140 3 Pmen_4376 UPF0758 protein Pmen_4376 Pseudomonas mendocina (strain ymp)
B8GTE3 3.21e-46 153 55 1 140 3 Tgr7_0100 UPF0758 protein Tgr7_0100 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q0A583 7.96e-46 152 52 1 149 3 Mlg_2664 UPF0758 protein Mlg_2664 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
C1DI57 1.76e-45 151 52 0 140 3 Avin_02940 UPF0758 protein Avin_02940 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B3PG68 2.16e-45 151 49 1 163 3 CJA_3522 UPF0758 protein CJA_3522 Cellvibrio japonicus (strain Ueda107)
A1U6L4 3.93e-45 150 51 0 139 3 Maqu_3564 UPF0758 protein Maqu_3564 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2P8B0 3.95e-45 150 53 0 142 3 XOO0462 UPF0758 protein XOO0462 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4UPP0 4.22e-45 150 56 0 128 3 XC_3944 UPF0758 protein XC_3944 Xanthomonas campestris pv. campestris (strain 8004)
Q8P456 4.22e-45 150 56 0 128 3 XCC3860 UPF0758 protein XCC3860 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q3JEI0 4.78e-45 150 54 0 140 3 Noc_0236 UPF0758 protein Noc_0236 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6VEC6 6.98e-45 150 50 0 140 3 PSPA7_6095 UPF0758 protein PSPA7_6095 Pseudomonas aeruginosa (strain PA7)
Q9HTN5 1.16e-44 149 50 0 140 3 PA5319 UPF0758 protein PA5319 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PFR3 1.41e-44 149 56 0 128 3 XAC3915 UPF0758 protein XAC3915 Xanthomonas axonopodis pv. citri (strain 306)
Q5H5M1 1.47e-44 149 52 0 142 3 XOO0495 UPF0758 protein XOO0495 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SS21 1.47e-44 149 52 0 142 3 PXO_02919 UPF0758 protein PXO_02919 Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q02E43 1.63e-44 149 50 0 140 3 PA14_70230 UPF0758 protein PA14_70230 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V5L0 1.63e-44 149 50 0 140 3 PLES_57141 UPF0758 protein PLES_57141 Pseudomonas aeruginosa (strain LESB58)
C3K471 2.68e-44 148 50 0 140 3 PFLU_5982 UPF0758 protein PFLU_5982 Pseudomonas fluorescens (strain SBW25)
A1SR15 2.88e-44 148 47 0 140 3 Ping_0056 UPF0758 protein Ping_0056 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4K3S4 4.14e-44 148 50 0 140 3 PFL_6051 UPF0758 protein PFL_6051 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6WIA6 4.54e-44 148 51 0 134 3 Shew185_0376 UPF0758 protein Shew185_0376 Shewanella baltica (strain OS185)
Q3BNA4 5.96e-44 147 55 0 128 3 XCV4028 UPF0758 protein XCV4028 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q0VT58 6.97e-44 147 56 0 126 3 ABO_0214 UPF0758 protein ABO_0214 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q07WG1 1.11e-43 147 48 0 139 3 Sfri_3828 UPF0758 protein Sfri_3828 Shewanella frigidimarina (strain NCIMB 400)
C4L814 1.35e-43 146 51 0 140 3 Tola_0183 UPF0758 protein Tola_0183 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0KEM8 1.73e-43 146 51 0 140 3 AHA_0160 UPF0758 protein AHA_0160 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q12SF5 1.8e-43 146 50 0 138 3 Sden_0326 UPF0758 protein Sden_0326 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B5FFF6 2.15e-43 146 49 0 140 3 VFMJ11_0123 UPF0758 protein VFMJ11_0123 Aliivibrio fischeri (strain MJ11)
B8E4J5 2.34e-43 146 51 0 134 3 Sbal223_0402 UPF0758 protein Sbal223_0402 Shewanella baltica (strain OS223)
A9KY04 2.34e-43 146 51 0 134 3 Sbal195_0388 UPF0758 protein Sbal195_0388 Shewanella baltica (strain OS195)
A3CZJ6 2.34e-43 146 51 0 134 3 Sbal_0377 UPF0758 protein Sbal_0377 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B6EPP3 2.53e-43 146 49 0 140 3 VSAL_I0192 UPF0758 protein VSAL_I0192 Aliivibrio salmonicida (strain LFI1238)
Q2SN69 3.29e-43 145 50 0 138 3 HCH_01020 UPF0758 protein HCH_01020 Hahella chejuensis (strain KCTC 2396)
A4Y2L1 3.53e-43 145 50 0 134 3 Sputcn32_0462 UPF0758 protein Sputcn32_0462 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1REU4 3.53e-43 145 50 0 134 3 Sputw3181_0338 UPF0758 protein Sputw3181_0338 Shewanella sp. (strain W3-18-1)
A1S2D2 4.34e-43 145 51 0 138 3 Sama_0327 UPF0758 protein Sama_0327 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8E9M2 4.53e-43 145 50 0 134 3 SO_4248 UPF0758 protein SO_4248 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HE56 4.89e-43 145 50 0 134 3 Shewmr4_3597 UPF0758 protein Shewmr4_3597 Shewanella sp. (strain MR-4)
Q6LVN4 5.07e-43 145 50 0 140 3 PBPRA0202 UPF0758 protein PBPRA0202 Photobacterium profundum (strain SS9)
A6VSX9 5.65e-43 145 62 0 112 3 Mmwyl1_0624 UPF0758 protein Mmwyl1_0624 Marinomonas sp. (strain MWYL1)
A0L1R9 5.75e-43 145 50 0 134 3 Shewana3_3770 UPF0758 protein Shewana3_3770 Shewanella sp. (strain ANA-3)
Q0HZU3 5.75e-43 145 50 0 134 3 Shewmr7_0359 UPF0758 protein Shewmr7_0359 Shewanella sp. (strain MR-7)
Q5QZB4 8.08e-43 144 46 0 140 3 IL0240 UPF0758 protein IL0240 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A3QIP9 8.13e-43 144 48 0 139 3 Shew_3481 UPF0758 protein Shew_3481 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q5E8M5 9.21e-43 144 48 0 140 3 VF_0126 UPF0758 protein VF_0126 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9PGZ8 1.27e-42 144 53 0 128 3 XF_0148 UPF0758 protein XF_0148 Xylella fastidiosa (strain 9a5c)
Q87F21 1.57e-42 144 53 0 128 3 PD_0117 UPF0758 protein PD_0117 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q3SFR5 1.84e-42 144 48 0 140 3 Tbd_2588 UPF0758 protein Tbd_2588 Thiobacillus denitrificans (strain ATCC 25259)
B0TQL1 3.4e-42 143 47 0 139 3 Shal_0429 UPF0758 protein Shal_0429 Shewanella halifaxensis (strain HAW-EB4)
B2FJW1 3.78e-42 143 53 1 146 3 Smlt0399 UPF0758 protein Smlt0399 Stenotrophomonas maltophilia (strain K279a)
A8GLE5 4.18e-42 143 48 0 140 3 Spro_4842 UPF0758 protein Spro_4842 Serratia proteamaculans (strain 568)
A8H9B0 4.46e-42 142 47 0 139 3 Spea_3837 UPF0758 protein Spea_3837 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B4STE3 5.65e-42 142 52 1 146 3 Smal_0281 UPF0758 protein Smal_0281 Stenotrophomonas maltophilia (strain R551-3)
B1KL05 1.04e-41 142 48 0 139 3 Swoo_4561 UPF0758 protein Swoo_4561 Shewanella woodyi (strain ATCC 51908 / MS32)
Q21EE6 1.09e-41 142 49 0 140 3 Sde_3678 UPF0758 protein Sde_3678 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0AHY0 1.23e-41 141 50 0 140 3 Neut_0782 UPF0758 protein Neut_0782 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3K4M8 1.26e-41 141 51 0 122 3 Pfl01_5539 UPF0758 protein Pfl01_5539 Pseudomonas fluorescens (strain Pf0-1)
A4STD5 1.52e-41 141 51 1 140 3 ASA_4229 UPF0758 protein ASA_4229 Aeromonas salmonicida (strain A449)
C5CWP0 2.34e-41 141 50 0 140 3 Vapar_4033 UPF0758 protein Vapar_4033 Variovorax paradoxus (strain S110)
B8CM29 4.68e-41 140 46 0 139 3 swp_2203 UPF0758 protein swp_2203 Shewanella piezotolerans (strain WP3 / JCM 13877)
C5BLG5 4.71e-41 140 49 0 140 3 TERTU_0184 UPF0758 protein TERTU_0184 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q12EY8 5.36e-41 140 52 1 139 3 Bpro_0948 UPF0758 protein Bpro_0948 Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1JHX2 7.25e-41 139 46 0 140 3 YE0063 UPF0758 protein YE0063 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JQX3 1.17e-40 139 47 0 140 3 YPK_4155 UPF0758 protein YPK_4155 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TSD7 1.17e-40 139 47 0 140 3 YPDSF_3856 UPF0758 protein YPDSF_3856 Yersinia pestis (strain Pestoides F)
Q1CD02 1.17e-40 139 47 0 140 3 YPN_3801 UPF0758 protein YPN_3801 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1C267 1.17e-40 139 47 0 140 3 YPA_3493 UPF0758 protein YPA_3493 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCT4 1.17e-40 139 47 0 140 3 YpsIP31758_0061 UPF0758 protein YpsIP31758_0061 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A9R674 1.17e-40 139 47 0 140 3 YpAngola_A0055 UPF0758 protein YpAngola_A0055 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZJP3 1.17e-40 139 47 0 140 3 YPO0049 UPF0758 protein YPO0049/y0092/YP_0050 Yersinia pestis
B2JYN3 1.17e-40 139 47 0 140 3 YPTS_0048 UPF0758 protein YPTS_0048 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q66GD6 1.17e-40 139 47 0 140 3 YPTB0046 UPF0758 protein YPTB0046 Yersinia pseudotuberculosis serotype I (strain IP32953)
A1VSK8 1.22e-40 139 51 1 139 3 Pnap_3339 UPF0758 protein Pnap_3339 Polaromonas naphthalenivorans (strain CJ2)
Q4ZZX7 1.64e-40 139 47 0 140 3 Psyr_0222 UPF0758 protein Psyr_0222 Pseudomonas syringae pv. syringae (strain B728a)
A8FQ75 1.96e-40 138 47 0 138 3 Ssed_0385 UPF0758 protein Ssed_0385 Shewanella sediminis (strain HAW-EB3)
A2SJB0 2.6e-40 138 55 0 142 3 Mpe_A2695 UPF0758 protein Mpe_A2695 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A6T144 4.15e-40 137 50 1 143 3 mma_2551 UPF0758 protein mma_2551 Janthinobacterium sp. (strain Marseille)
A6VK98 4.93e-40 137 51 2 129 3 Asuc_0013 UPF0758 protein Asuc_0013 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A4G7V9 9.98e-40 137 49 1 143 3 HEAR2468 UPF0758 protein HEAR2468 Herminiimonas arsenicoxydans
Q82UL9 1.37e-39 136 50 0 140 3 NE1464 UPF0758 protein NE1464 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B1J4M1 1.77e-39 136 50 0 122 3 PputW619_0186 UPF0758 protein PputW619_0186 Pseudomonas putida (strain W619)
A1TTN2 2.04e-39 136 49 0 140 3 Aave_3773 UPF0758 protein Aave_3773 Paracidovorax citrulli (strain AAC00-1)
Q48Q04 5e-39 135 45 0 140 3 PSPPH_0210 UPF0758 protein PSPPH_0210 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6DAV7 5.09e-39 135 47 0 140 3 ECA0145 UPF0758 protein ECA0145 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DIC1 5.2e-39 135 47 0 140 3 PC1_4100 UPF0758 protein PC1_4100 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B9MEH2 5.25e-39 135 48 0 140 3 Dtpsy_2777 UPF0758 protein Dtpsy_2777 Acidovorax ebreus (strain TPSY)
Q3IFE5 6.28e-39 134 50 0 140 3 PSHAa2643 UPF0758 protein PSHAa2643 Pseudoalteromonas translucida (strain TAC 125)
A1WBD9 6.95e-39 135 48 0 140 3 Ajs_3450 UPF0758 protein Ajs_3450 Acidovorax sp. (strain JS42)
Q1I2U3 1.81e-38 133 50 0 122 3 PSEEN5431 UPF0758 protein PSEEN5431 Pseudomonas entomophila (strain L48)
A9BYK1 2.37e-38 133 48 0 140 3 Daci_1904 UPF0758 protein Daci_1904 Delftia acidovorans (strain DSM 14801 / SPH-1)
A5WB02 2.51e-38 133 50 0 122 3 Pput_5194 UPF0758 protein Pput_5194 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88C97 2.56e-38 133 50 0 122 3 PP_5284 UPF0758 protein PP_5284 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2Y740 2.56e-38 133 48 0 140 3 Nmul_A2138 UPF0758 protein Nmul_A2138 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q88BD1 2.59e-38 133 45 0 140 3 PSPTO_0086 UPF0758 protein PSPTO_0086 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1H4K1 5.35e-38 132 52 1 127 3 Mfla_0315 UPF0758 protein Mfla_0315 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B0KQ87 6.28e-38 132 46 0 128 3 PputGB1_5335 UPF0758 protein PputGB1_5335 Pseudomonas putida (strain GB-1)
Q7MY28 6.69e-38 132 48 0 122 3 plu4865 UPF0758 protein plu4865 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q15ZW0 7.48e-38 132 54 0 113 3 Patl_0046 UPF0758 protein Patl_0046 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B5EMA3 2.71e-37 130 47 1 142 3 Lferr_0528 UPF0758 protein Lferr_0528 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4A8 2.71e-37 130 47 1 142 3 AFE_0358 UPF0758 protein AFE_0358 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q21TE2 3.33e-37 130 52 0 119 3 Rfer_3252 UPF0758 protein Rfer_3252 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1WIF4 3.38e-37 130 47 0 140 3 Veis_1654 UPF0758 protein Veis_1654 Verminephrobacter eiseniae (strain EF01-2)
B6J5S7 4.5e-37 130 45 0 131 3 CbuK_0488 UPF0758 protein CbuK_0488 Coxiella burnetii (strain CbuK_Q154)
A9KGS6 4.5e-37 130 45 0 131 3 CBUD_1789 UPF0758 protein CBUD_1789 Coxiella burnetii (strain Dugway 5J108-111)
B5XTG5 8.95e-37 129 43 0 140 3 KPK_0116 UPF0758 protein KPK_0116 Klebsiella pneumoniae (strain 342)
A8ARM5 2.05e-36 128 44 0 140 3 CKO_05095 UPF0758 protein CKO_05095 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5X240 3.29e-36 127 44 1 129 3 lpp2553 UPF0758 protein lpp2553 Legionella pneumophila (strain Paris)
B1Y0I9 3.47e-36 127 51 0 140 3 Lcho_0695 UPF0758 protein Lcho_0695 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A6TFM9 3.53e-36 127 48 0 119 3 KPN78578_39390 UPF0758 protein KPN78578_39390 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8XWN0 3.58e-36 127 45 0 140 3 RSc2444 UPF0758 protein RSc2444 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5IEW9 3.63e-36 127 44 1 129 3 LPC_1989 UPF0758 protein LPC_1989 Legionella pneumophila (strain Corby)
Q5ZSM8 3.67e-36 127 44 1 129 3 lpg2489 UPF0758 protein lpg2489 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WTW4 4e-36 127 45 0 122 3 lpl2409 UPF0758 protein lpl2409 Legionella pneumophila (strain Lens)
A7MQ95 2.67e-35 125 44 0 140 3 ESA_04094 UPF0758 protein ESA_04094 Cronobacter sakazakii (strain ATCC BAA-894)
Q47685 2.75e-35 123 42 4 172 3 ykfG UPF0758 protein YkfG Escherichia coli (strain K12)
B2UAP0 2.84e-35 125 43 0 140 3 Rpic_2712 UPF0758 protein Rpic_2712 Ralstonia pickettii (strain 12J)
P44952 3.72e-35 125 50 0 122 3 HI_0952 UPF0758 protein HI_0952 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5P7Z7 3.99e-35 125 48 1 141 3 AZOSEA04420 UPF0758 protein AZOSEA04420 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q13UX3 4.08e-35 125 42 0 139 3 Bxeno_A3578 UPF0758 protein Bxeno_A3578 Paraburkholderia xenovorans (strain LB400)
Q4QLV5 4.14e-35 125 54 1 112 3 NTHI1125 UPF0758 protein NTHI1125 Haemophilus influenzae (strain 86-028NP)
Q7NTH5 4.38e-35 125 50 1 138 3 CV_3079 UPF0758 protein CV_3079 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0I0X9 5.22e-35 124 44 0 128 3 HS_0144 UPF0758 protein HS_0144 Histophilus somni (strain 129Pt)
B0UUW7 5.22e-35 124 44 0 128 3 HSM_0009 UPF0758 protein HSM_0009 Histophilus somni (strain 2336)
P57913 6.96e-35 124 51 2 114 3 PM1152 UPF0758 protein PM1152 Pasteurella multocida (strain Pm70)
Q46XP0 7.16e-35 124 50 0 122 3 Reut_A2732 UPF0758 protein Reut_A2732 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A5UDB6 7.74e-35 124 49 0 122 3 CGSHiEE_07200 UPF0758 protein CGSHiEE_07200 Haemophilus influenzae (strain PittEE)
A1K4J9 1.99e-34 123 48 3 144 3 azo1137 UPF0758 protein azo1137 Azoarcus sp. (strain BH72)
A8A6A0 2.12e-34 123 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O9:H4 (strain HS)
P52140 2.5e-34 121 52 0 117 3 yfjY UPF0758 protein YfjY Escherichia coli (strain K12)
A9MKN7 2.65e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2TTV2 2.81e-34 122 42 0 140 3 yicR UPF0758 protein YicR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N279 2.93e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O81 (strain ED1a)
Q31UY8 2.99e-34 122 42 0 140 3 yicR UPF0758 protein YicR Shigella boydii serotype 4 (strain Sb227)
B7L757 2.99e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain 55989 / EAEC)
B5BI12 3.05e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella paratyphi A (strain AKU_12601)
Q5PC30 3.05e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P25531 3.16e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain K12)
B1X972 3.16e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain K12 / DH10B)
C4ZXN0 3.16e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain K12 / MC4100 / BW2952)
P65959 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Shigella flexneri
Q0SYG5 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Shigella flexneri serotype 5b (strain 8401)
B7LVJ9 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4V4 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain UTI89 / UPEC)
B1LK75 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli (strain SMS-3-5 / SECEC)
B7NEU2 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P65957 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBH1 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHG9 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O1:K1 / APEC
B7M4C3 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O8 (strain IAI1)
B7NPZ9 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YWD6 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O157:H7 (strain EC4115 / EHEC)
P65958 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O157:H7
B7MFJ9 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7ULJ3 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTI9 3.19e-34 122 42 0 140 3 yicR UPF0758 protein YicR Escherichia coli O139:H28 (strain E24377A / ETEC)
P65960 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65961 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella typhi
B4TZY0 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella schwarzengrund (strain CVM19633)
C0Q1X1 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella paratyphi C (strain RKS4594)
B4T9C3 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella heidelberg (strain SL476)
B5RGE9 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5G2 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella enteritidis PT4 (strain P125109)
B5FM62 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella dublin (strain CT_02021853)
Q57IA4 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella choleraesuis (strain SC-B67)
B5EXE3 3.58e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella agona (strain SL483)
B4SXE0 4.49e-34 122 42 0 140 3 yicR UPF0758 protein YicR Salmonella newport (strain SL254)
Q329L9 6.44e-34 122 41 0 140 3 yicR UPF0758 protein YicR Shigella dysenteriae serotype 1 (strain Sd197)
A9IU27 2.73e-33 120 45 0 144 3 Bpet3149 UPF0758 protein Bpet3149 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B2T6H6 3.07e-33 121 43 0 139 3 Bphyt_3148 UPF0758 protein Bphyt_3148 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q39DN9 5.11e-33 120 40 0 140 3 Bcep18194_A5833 UPF0758 protein Bcep18194_A5833 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4S2B7 5.81e-33 119 46 0 113 3 MADE_1000235 UPF0758 protein MADE_1000235 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4W511 1.24e-32 118 46 0 119 3 Ent638_0101 UPF0758 protein Ent638_0101 Enterobacter sp. (strain 638)
Q31EB6 2.16e-32 118 39 1 141 3 Tcr_1917 UPF0758 protein Tcr_1917 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
C1D8V1 4.65e-32 117 42 1 149 3 LHK_01907 UPF0758 protein LHK_01907 Laribacter hongkongensis (strain HLHK9)
Q0K7B3 5.21e-32 117 45 1 125 3 H16_A3033 UPF0758 protein H16_A3033 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P76362 6.59e-32 114 47 1 131 3 yeeS UPF0758 protein YeeS Escherichia coli (strain K12)
Q7VN51 7.24e-32 116 43 0 121 3 HD_0732 UPF0758 protein HD_0732 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B3H340 7.64e-32 116 45 0 122 3 APP7_2058 UPF0758 protein APP7_2058 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BTZ5 7.64e-32 116 45 0 122 3 APJL_2017 UPF0758 protein APJL_2017 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N3Q8 7.64e-32 116 45 0 122 3 APL_1970 UPF0758 protein APL_1970 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3R6F7 8.1e-32 116 48 1 125 3 RALTA_A2508 UPF0758 protein RALTA_A2508 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q3A8G4 1.35e-31 116 40 0 140 3 Pcar_0065 UPF0758 protein Pcar_0065 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6LQP8 1.98e-31 115 40 0 123 3 Cbei_0490 UPF0758 protein Cbei_0490 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B1JXB2 2.01e-31 116 44 0 123 3 Bcenmc03_2526 UPF0758 protein Bcenmc03_2526 Burkholderia orbicola (strain MC0-3)
A0K9S4 2.01e-31 116 44 0 123 3 Bcen2424_2501 UPF0758 protein Bcen2424_2501 Burkholderia cenocepacia (strain HI2424)
Q1BUB2 2.01e-31 116 44 0 123 3 Bcen_1890 UPF0758 protein Bcen_1890 Burkholderia orbicola (strain AU 1054)
Q0BCL9 3.55e-31 115 45 1 132 3 Bamb_2548 UPF0758 protein Bamb_2548 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YV93 3.55e-31 115 45 1 132 3 BamMC406_2419 UPF0758 protein BamMC406_2419 Burkholderia ambifaria (strain MC40-6)
Q5LWK3 9.39e-31 114 42 1 146 3 SPO0054 UPF0758 protein SPO0054 Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A4JH21 4.98e-30 112 43 1 134 3 Bcep1808_2579 UPF0758 protein Bcep1808_2579 Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1AV03 1.96e-29 110 42 1 132 3 Ppro_3582 UPF0758 protein Ppro_3582 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A3N6Q9 3.38e-29 111 45 2 144 3 BURPS668_0979 UPF0758 protein BURPS668_0979 Burkholderia pseudomallei (strain 668)
Q5WER0 3.43e-29 110 42 4 145 3 ABC2615 UPF0758 protein ABC2615 Shouchella clausii (strain KSM-K16)
A3NSE4 4.14e-29 110 45 2 144 3 BURPS1106A_0984 UPF0758 protein BURPS1106A_0984 Burkholderia pseudomallei (strain 1106a)
A3MMZ4 4.14e-29 110 45 2 144 3 BMA10247_2099 UPF0758 protein BMA10247_2099 Burkholderia mallei (strain NCTC 10247)
A1V6U0 4.14e-29 110 45 2 144 3 BMASAVP1_A2646 UPF0758 protein BMASAVP1_A2646 Burkholderia mallei (strain SAVP1)
A2S4Y8 4.14e-29 110 45 2 144 3 BMA10229_A1020 UPF0758 protein BMA10229_A1020 Burkholderia mallei (strain NCTC 10229)
Q62HM6 4.14e-29 110 45 2 144 3 BMA2230 UPF0758 protein BMA2230 Burkholderia mallei (strain ATCC 23344)
Q3JV52 4.14e-29 110 45 2 144 3 BURPS1710b_1139 UPF0758 protein BURPS1710b_1139 Burkholderia pseudomallei (strain 1710b)
Q47BA9 4.95e-29 109 50 1 120 3 Daro_3142 UPF0758 protein Daro_3142 Dechloromonas aromatica (strain RCB)
B9DNE3 6.01e-29 109 43 0 123 3 Sca_1264 UPF0758 protein Sca_1264 Staphylococcus carnosus (strain TM300)
B4SF75 8.31e-29 108 42 0 125 3 Ppha_0935 UPF0758 protein Ppha_0935 Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
B2TK55 9.28e-29 108 38 0 123 3 CLL_A0562 UPF0758 protein CLL_A0562 Clostridium botulinum (strain Eklund 17B / Type B)
B2V090 1.78e-28 108 37 0 123 3 CLH_0547 UPF0758 protein CLH_0547 Clostridium botulinum (strain Alaska E43 / Type E3)
Q2T0G2 5.03e-28 107 44 2 144 3 BTH_I0781 UPF0758 protein BTH_I0781 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A4SFD1 6.66e-28 106 40 0 127 3 Cvib_1178 UPF0758 protein Cvib_1178 Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q65GL3 1.35e-27 105 43 0 122 3 BLi02933 UPF0758 protein BLi02933/BL00636 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8PTC5 1.53e-27 105 41 0 124 3 MM_2791 UPF0758 protein MM_2791 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A5G913 2.11e-27 105 36 0 139 3 Gura_4138 UPF0758 protein Gura_4138 Geotalea uraniireducens (strain Rf4)
Q1MHK3 2.55e-27 106 39 2 164 3 RL2068 UPF0758 protein RL2068 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P72255 3.26e-27 104 43 0 136 2 None UPF0758 protein Rhodobacter capsulatus
C5D5H7 3.71e-27 104 40 3 148 3 GWCH70_2550 UPF0758 protein GWCH70_2550 Geobacillus sp. (strain WCH70)
Q4L700 5.13e-27 104 39 0 123 3 SH1266 UPF0758 protein SH1266 Staphylococcus haemolyticus (strain JCSC1435)
Q8RBC5 5.92e-27 104 40 0 121 3 TTE0897 UPF0758 protein TTE0897 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q67SI7 8.53e-27 103 46 0 120 3 STH371 UPF0758 protein STH371 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9K8H4 8.69e-27 103 42 0 122 3 BH3032 UPF0758 protein BH3032 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A7Z793 8.97e-27 103 43 0 122 3 RBAM_025090 UPF0758 protein RBAM_025090 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B5ZMI0 1.1e-26 104 39 2 164 3 Rleg2_1511 UPF0758 protein Rleg2_1511 Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q8TPD4 1.51e-26 103 41 0 124 3 MA_1979 UPF0758 protein MA_1979 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A4IRD9 1.77e-26 102 38 1 139 3 GTNG_2548 UPF0758 protein GTNG_2548 Geobacillus thermodenitrificans (strain NG80-2)
A8MHM4 1.84e-26 103 41 0 119 3 Clos_1766 UPF0758 protein Clos_1766 Alkaliphilus oremlandii (strain OhILAs)
A9VIS8 1.94e-26 102 35 0 139 3 BcerKBAB4_4299 UPF0758 protein BcerKBAB4_4299 Bacillus mycoides (strain KBAB4)
Q0SR37 2.19e-26 102 39 0 123 3 CPR_2111 UPF0758 protein CPR_2111 Clostridium perfringens (strain SM101 / Type A)
A1B4F1 2.26e-26 103 40 1 149 3 Pden_2304 UPF0758 protein Pden_2304 Paracoccus denitrificans (strain Pd 1222)
A8FFU0 2.33e-26 102 40 0 122 3 BPUM_2444 UPF0758 protein BPUM_2444 Bacillus pumilus (strain SAFR-032)
Q5KWN3 2.49e-26 102 40 0 122 3 GK2618 UPF0758 protein GK2618 Geobacillus kaustophilus (strain HTA426)
B3PXW5 2.63e-26 103 47 0 112 3 RHECIAT_CH0001935 UPF0758 protein RHECIAT_CH0001935 Rhizobium etli (strain CIAT 652)
Q2K946 2.77e-26 103 47 0 112 3 RHE_CH01848 UPF0758 protein RHE_CH01848 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q72ZX2 3.01e-26 102 35 0 139 3 BCE_4545 UPF0758 protein BCE_4545 Bacillus cereus (strain ATCC 10987 / NRS 248)
C3L6Y5 3.11e-26 102 35 0 139 3 BAMEG_4721 UPF0758 protein BAMEG_4721 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9D9 3.11e-26 102 35 0 139 3 BAA_4704 UPF0758 protein BAA_4704 Bacillus anthracis (strain A0248)
Q81LD7 3.11e-26 102 35 0 139 3 BA_4685 UPF0758 protein BA_4685/GBAA_4685/BAS4351 Bacillus anthracis
C1ETQ0 3.11e-26 102 35 0 139 3 BCA_4566 UPF0758 protein BCA_4566 Bacillus cereus (strain 03BB102)
Q6HD72 3.11e-26 102 35 0 139 3 BT9727_4187 UPF0758 protein BT9727_4187 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q2YT78 3.4e-26 102 41 0 123 3 SAB1521c UPF0758 protein SAB1521c Staphylococcus aureus (strain bovine RF122 / ET3-1)
B1I4S0 3.87e-26 102 42 0 120 3 Daud_1467 UPF0758 protein Daud_1467 Desulforudis audaxviator (strain MP104C)
Q2KXW4 4.02e-26 102 55 0 84 3 BAV2405 UPF0758 protein BAV2405 Bordetella avium (strain 197N)
Q3AQF7 4.27e-26 101 40 1 139 3 Cag_1513 UPF0758 protein Cag_1513 Chlorobium chlorochromatii (strain CaD3)
A6TQH8 4.4e-26 102 41 0 123 3 Amet_2289 UPF0758 protein Amet_2289 Alkaliphilus metalliredigens (strain QYMF)
P31337 4.73e-26 101 41 0 123 3 SAOUHSC_01763 UPF0758 protein SAOUHSC_01763 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG75 4.73e-26 101 41 0 123 3 SAUSA300_1608 UPF0758 protein SAUSA300_1608 Staphylococcus aureus (strain USA300)
Q5HFB1 5.67e-26 101 41 0 123 3 SACOL1707 UPF0758 protein SACOL1707 Staphylococcus aureus (strain COL)
Q8NW77 5.67e-26 101 41 0 123 3 MW1604 UPF0758 protein MW1604 Staphylococcus aureus (strain MW2)
Q6G8R5 5.67e-26 101 41 0 123 3 SAS1589 UPF0758 protein SAS1589 Staphylococcus aureus (strain MSSA476)
A6QHJ5 5.67e-26 101 41 0 123 3 NWMN_1555 UPF0758 protein NWMN_1555 Staphylococcus aureus (strain Newman)
Q633Z0 6.43e-26 101 39 0 122 3 BCE33L4198 UPF0758 protein BCE33L4198 Bacillus cereus (strain ZK / E33L)
Q0TNG8 6.51e-26 101 39 0 123 3 CPF_2399 UPF0758 protein CPF_2399 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XIH5 6.51e-26 101 39 0 123 3 CPE2144 UPF0758 protein CPE2144 Clostridium perfringens (strain 13 / Type A)
B7HE86 7.96e-26 101 39 0 122 3 BCB4264_A4572 UPF0758 protein BCB4264_A4572 Bacillus cereus (strain B4264)
B7HQL1 8.22e-26 101 39 0 122 3 BCAH187_A4587 UPF0758 protein BCAH187_A4587 Bacillus cereus (strain AH187)
B9IZ29 8.22e-26 101 39 0 122 3 BCQ_4241 UPF0758 protein BCQ_4241 Bacillus cereus (strain Q1)
B3QM94 9.32e-26 100 39 1 133 3 Cpar_0627 UPF0758 protein Cpar_0627 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q49Y92 1.18e-25 100 35 0 134 3 SSP1105 UPF0758 protein SSP1105 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q02170 1.2e-25 100 42 0 122 2 ysxA UPF0758 protein YsxA Bacillus subtilis (strain 168)
Q46A65 1.35e-25 100 38 0 124 3 Mbar_A2303 UPF0758 protein Mbar_A2303 Methanosarcina barkeri (strain Fusaro / DSM 804)
B7IIW5 1.36e-25 100 38 0 122 3 BCG9842_B0662 UPF0758 protein BCG9842_B0662 Bacillus cereus (strain G9842)
Q12YU9 1.48e-25 100 39 1 151 3 Mbur_0382 UPF0758 protein Mbur_0382 Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q92PL6 1.59e-25 101 40 1 145 3 R01728 UPF0758 protein R01728 Rhizobium meliloti (strain 1021)
P65955 1.93e-25 100 47 0 109 3 BMEI0718 UPF0758 protein BMEI0718 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M5U5 1.93e-25 100 47 0 109 3 BCAN_A1306 UPF0758 protein BCAN_A1306 Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YRF9 1.93e-25 100 47 0 109 3 BAB1_1301 UPF0758 protein BAB1_1301 Brucella abortus (strain 2308)
Q57CL3 1.93e-25 100 47 0 109 3 BruAb1_1284 UPF0758 protein BruAb1_1284 Brucella abortus biovar 1 (strain 9-941)
P65956 1.93e-25 100 47 0 109 3 radC UPF0758 protein BR1283/BS1330_I1279 Brucella suis biovar 1 (strain 1330)
B2S6C0 1.93e-25 100 47 0 109 3 BAbS19_I12140 UPF0758 protein BAbS19_I12140 Brucella abortus (strain S19)
C0RJP6 2.01e-25 100 47 0 109 3 BMEA_A1330 UPF0758 protein BMEA_A1330 Brucella melitensis biotype 2 (strain ATCC 23457)
B8DHJ9 2.36e-25 100 45 0 103 3 LMHCC_1020 UPF0758 protein LMHCC_1020 Listeria monocytogenes serotype 4a (strain HCC23)
Q8Y6Y2 2.55e-25 99 45 0 103 3 lmo1549 UPF0758 protein lmo1549 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZC0 2.66e-25 99 45 0 103 3 LMOf2365_1569 UPF0758 protein LMOf2365_1569 Listeria monocytogenes serotype 4b (strain F2365)
C1KVJ6 2.66e-25 99 45 0 103 3 Lm4b_01560 UPF0758 protein Lm4b_01560 Listeria monocytogenes serotype 4b (strain CLIP80459)
A1BHA1 2.71e-25 99 42 0 124 3 Cpha266_1761 UPF0758 protein Cpha266_1761 Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A6U9H4 3.01e-25 100 37 2 164 3 Smed_1459 UPF0758 protein Smed_1459 Sinorhizobium medicae (strain WSM419)
B3E339 3.03e-25 99 37 0 129 3 Glov_0523 UPF0758 protein Glov_0523 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A6X071 3.25e-25 100 44 0 118 3 Oant_1909 UPF0758 protein Oant_1909 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A7NFF4 3.27e-25 99 40 0 121 3 Rcas_0037 UPF0758 protein Rcas_0037 Roseiflexus castenholzii (strain DSM 13941 / HLO8)
C1FVY2 3.95e-25 99 37 0 123 3 CLM_3399 UPF0758 protein CLM_3399 Clostridium botulinum (strain Kyoto / Type A2)
B1IM02 3.95e-25 99 37 0 123 3 CLD_1541 UPF0758 protein CLD_1541 Clostridium botulinum (strain Okra / Type B1)
B4S6M7 4.29e-25 99 41 0 129 3 Paes_0735 UPF0758 protein Paes_0735 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q2J299 4.51e-25 99 39 0 130 3 RPB_0700 UPF0758 protein RPB_0700 Rhodopseudomonas palustris (strain HaA2)
C3L3L0 4.54e-25 99 37 0 123 3 CLJ_B3261 UPF0758 protein CLJ_B3261 Clostridium botulinum (strain 657 / Type Ba4)
A7FXW3 4.54e-25 99 37 0 123 3 CLB_3028 UPF0758 protein CLB_3028 Clostridium botulinum (strain ATCC 19397 / Type A)
A5I683 4.54e-25 99 37 0 123 3 CBO3003 UPF0758 protein CBO3003/CLC_2900 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
Q8CNZ4 6.25e-25 99 37 0 123 3 SE_1336 UPF0758 protein SE_1336 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
C3MBW4 7.43e-25 99 36 3 171 3 NGR_c13970 UPF0758 protein NGR_c13970 Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B1KZT0 8.33e-25 98 37 0 123 3 CLK_2387 UPF0758 protein CLK_2387 Clostridium botulinum (strain Loch Maree / Type A3)
A7GHL9 8.51e-25 98 37 0 123 3 CLI_3057 UPF0758 protein CLI_3057 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5N6I5 8.61e-25 98 38 0 123 3 CKL_0865 UPF0758 protein CKL_0865 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E004 8.61e-25 98 38 0 123 3 CKR_0778 UPF0758 protein CKR_0778 Clostridium kluyveri (strain NBRC 12016)
Q9X1P3 1.07e-24 98 40 1 123 3 TM_1557 UPF0758 protein TM_1557 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1AVT6 1.17e-24 98 41 3 149 3 Rxyl_1530 UPF0758 protein Rxyl_1530 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A0AIZ8 1.2e-24 98 43 0 103 3 lwe1562 UPF0758 protein lwe1562 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92BG5 1.29e-24 98 43 0 103 3 lin1584 UPF0758 protein lin1584 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5IM26 1.42e-24 97 40 1 123 3 Tpet_1235 UPF0758 protein Tpet_1235 Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q74G62 1.6e-24 97 37 1 140 3 GSU0386 UPF0758 protein GSU0386 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B8G568 2.24e-24 97 37 0 137 3 Cagg_0777 UPF0758 protein Cagg_0777 Chloroflexus aggregans (strain MD-66 / DSM 9485)
B9LEQ9 2.52e-24 97 38 0 137 3 Chy400_3887 UPF0758 protein Chy400_3887 Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WAJ7 2.52e-24 97 38 0 137 3 Caur_3603 UPF0758 protein Caur_3603 Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A5FMW5 3.22e-24 97 37 1 138 3 Fjoh_0413 UPF0758 protein Fjoh_0413 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8KES1 3.39e-24 97 39 0 123 1 CT0611 UPF0758 protein CT0611 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q7W9B6 3.78e-24 96 37 2 167 3 BPP1850 UPF0758 protein BPP1850 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q0AWG3 4.92e-24 96 39 2 143 3 Swol_1642 UPF0758 protein Swol_1642 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q7VYS4 5.85e-24 96 36 2 167 3 BP1235 UPF0758 protein BP1235 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q38XC8 6.5e-24 96 40 1 112 3 LCA_0852 UPF0758 protein LCA_0852 Latilactobacillus sakei subsp. sakei (strain 23K)
Q7WHF0 6.64e-24 96 36 2 167 3 BB3258 UPF0758 protein BB3258 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3B5A0 7.47e-24 95 37 0 127 3 Plut_0598 UPF0758 protein Plut_0598 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8UEZ6 4.16e-23 95 35 1 145 3 Atu1607 UPF0758 protein Atu1607 Agrobacterium fabrum (strain C58 / ATCC 33970)
B8FVF5 4.18e-23 94 39 0 122 3 Dhaf_4352 UPF0758 protein Dhaf_4352 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q24SM3 4.18e-23 94 39 0 122 3 DSY3180 UPF0758 protein DSY3180 Desulfitobacterium hafniense (strain Y51)
Q6F7Z8 6.56e-23 94 43 0 102 3 ACIAD3126 UPF0758 protein ACIAD3126 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0S3Y4 7.27e-23 93 40 0 122 3 FMG_0357 UPF0758 protein FMG_0357 Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
A0PZG4 8.16e-23 93 36 0 122 3 NT01CX_1687 UPF0758 protein NT01CX_1687 Clostridium novyi (strain NT)
A5URD0 9.62e-23 93 36 1 141 3 RoseRS_0767 UPF0758 protein RoseRS_0767 Roseiflexus sp. (strain RS-1)
Q97JN2 1.02e-22 93 37 0 123 3 CA_C1241 UPF0758 protein CA_C1241 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q892M1 1.02e-22 93 33 0 123 3 CTC_02075 UPF0758 protein CTC_02075 Clostridium tetani (strain Massachusetts / E88)
B3EP05 4.92e-22 91 37 0 127 3 Cphamn1_0831 UPF0758 protein Cphamn1_0831 Chlorobium phaeobacteroides (strain BS1)
Q82ZX1 7.28e-22 90 33 0 108 3 EF_2926 UPF0758 protein EF_2926 Enterococcus faecalis (strain ATCC 700802 / V583)
A4J7K6 7.65e-22 90 37 0 122 3 Dred_2549 UPF0758 protein Dred_2549 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q9JZI3 9.28e-22 90 36 0 122 3 NMB1038 UPF0758 protein NMB1038 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B7GWK9 2.42e-21 89 38 0 113 3 ABBFA_000545 UPF0758 protein ABBFA_000545 Acinetobacter baumannii (strain AB307-0294)
B7I981 2.42e-21 89 38 0 113 3 AB57_3420 UPF0758 protein AB57_3420 Acinetobacter baumannii (strain AB0057)
A3M8S9 2.42e-21 89 38 0 113 3 A1S_2918 UPF0758 protein A1S_2918 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A1KU78 2.54e-21 89 36 0 122 3 NMC1174 UPF0758 protein NMC1174 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q5F8S9 4.4e-21 89 36 0 122 3 NGO0681 UPF0758 protein NGO0681 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RM65 4.4e-21 89 36 0 122 3 NGK_1225 UPF0758 protein NGK_1225 Neisseria gonorrhoeae (strain NCCP11945)
Q2RL23 5.23e-21 88 37 0 122 3 Moth_0536 UPF0758 protein Moth_0536 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1Q8V7 5.65e-21 88 34 0 136 3 Pcryo_2119 UPF0758 protein Pcryo_2119 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9JU84 1.05e-20 87 36 0 122 3 NMA1448 UPF0758 protein NMA1448 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9LZF5 1.05e-20 87 36 0 122 3 NMCC_1157 UPF0758 protein NMCC_1157 Neisseria meningitidis serogroup C (strain 053442)
Q6MAB0 1.23e-20 87 33 0 139 3 pc1765 UPF0758 protein pc1765 Protochlamydia amoebophila (strain UWE25)
A5WCQ5 1.77e-20 87 33 0 135 3 PsycPRwf_0491 UPF0758 protein PsycPRwf_0491 Psychrobacter sp. (strain PRwf-1)
Q8RF15 2.03e-20 87 34 0 123 3 FN0909 UPF0758 protein FN0909 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2S042 3.33e-20 86 38 0 123 3 SRU_2338 UPF0758 protein SRU_2338 Salinibacter ruber (strain DSM 13855 / M31)
B5Y6A0 7.14e-20 85 39 0 111 3 COPRO5265_1522 UPF0758 protein COPRO5265_1522 Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q4FQM6 2.05e-19 84 33 0 136 3 Psyc_1834 UPF0758 protein Psyc_1834 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3AF80 1.25e-17 79 33 1 118 3 CHY_0341 UPF0758 protein CHY_0341 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A2RLC4 7.52e-17 77 31 0 105 3 llmg_1515 UPF0758 protein llmg_1515 Lactococcus lactis subsp. cremoris (strain MG1363)
O67541 1.53e-16 77 31 1 122 3 aq_1610 UPF0758 protein aq_1610 Aquifex aeolicus (strain VF5)
A8AXK6 1.14e-15 74 26 0 136 3 SGO_1229 UPF0758 protein SGO_1229 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q2FT43 1.19e-15 74 39 0 103 3 Mhun_2739 UPF0758 protein Mhun_2739 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q18B06 1.42e-15 74 41 0 92 3 CD630_11440 UPF0758 protein CD630_11440 Clostridioides difficile (strain 630)
Q111G4 1.52e-15 74 36 2 111 3 Tery_2667 UPF0758 protein Tery_2667 Trichodesmium erythraeum (strain IMS101)
B8HRF8 1.66e-15 74 33 0 116 3 Cyan7425_1778 UPF0758 protein Cyan7425_1778 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q9CGT5 1.67e-15 73 31 0 104 3 LL1007 UPF0758 protein LL1007 Lactococcus lactis subsp. lactis (strain IL1403)
A3CN67 1.92e-15 73 25 2 164 3 SSA_1218 UPF0758 protein SSA_1218 Streptococcus sanguinis (strain SK36)
Q7MVX9 2.09e-15 73 28 1 146 3 PG_0894 UPF0758 protein PG_0894 Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8DI83 3.47e-15 73 37 0 98 3 tlr1707 UPF0758 protein tlr1707 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3K0Z6 4.82e-15 72 34 0 93 3 SAK_1186 UPF0758 protein SAK_1186 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8DZK0 4.82e-15 72 34 0 93 3 SAG1101 UPF0758 protein SAG1101 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E564 6.45e-15 72 34 0 93 3 gbs1168 UPF0758 protein gbs1168 Streptococcus agalactiae serotype III (strain NEM316)
B1IBM8 1.56e-14 71 35 0 94 3 SPH_1181 UPF0758 protein SPH_1181 Streptococcus pneumoniae (strain Hungary19A-6)
C1C785 1.56e-14 71 35 0 94 3 SP70585_1163 UPF0758 protein SP70585_1163 Streptococcus pneumoniae (strain 70585)
C1CRJ1 1.56e-14 71 35 0 94 3 SPT_1135 UPF0758 protein SPT_1135 Streptococcus pneumoniae (strain Taiwan19F-14)
C1CKF5 1.56e-14 71 35 0 94 3 SPP_1095 UPF0758 protein SPP_1095 Streptococcus pneumoniae (strain P1031)
Q97QW0 1.56e-14 71 35 0 94 1 SP_1088 UPF0758 protein SP_1088 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E4K3 1.56e-14 71 35 0 94 3 SPG_1010 UPF0758 protein SPG_1010 Streptococcus pneumoniae serotype 19F (strain G54)
B8ZPT5 1.56e-14 71 35 0 94 3 SPN23F10090 UPF0758 protein SPN23F10090 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CE75 1.57e-14 71 35 0 94 3 SPJ_1027 UPF0758 protein SPJ_1027 Streptococcus pneumoniae (strain JJA)
B9DS19 2.45e-14 70 31 1 121 3 SUB0843 UPF0758 protein SUB0843 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8DPU7 3.11e-14 70 34 0 94 3 spr0996 UPF0758 protein spr0996 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KJ8 3.11e-14 70 34 0 94 3 SPD_0975 UPF0758 protein SPD_0975 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B1WRJ4 3.13e-14 70 32 0 116 3 cce_2495 UPF0758 protein cce_2495 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q5XC90 3.35e-14 70 35 1 104 3 M6_Spy0838 UPF0758 protein M6_Spy0838 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1J6P2 3.71e-14 70 35 1 104 3 MGAS10750_Spy0991 UPF0758 protein MGAS10750_Spy0991 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JLS3 3.71e-14 70 35 1 104 3 MGAS9429_Spy0959 UPF0758 protein MGAS9429_Spy0959 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JGX3 3.71e-14 70 35 1 104 3 MGAS10270_Spy0956 UPF0758 protein MGAS10270_Spy0956 Streptococcus pyogenes serotype M2 (strain MGAS10270)
A2REK0 3.71e-14 70 35 1 104 3 SpyM50948 UPF0758 protein SpyM50948 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JBU1 3.71e-14 70 35 1 104 3 MGAS2096_Spy0915 UPF0758 protein MGAS2096_Spy0915 Streptococcus pyogenes serotype M12 (strain MGAS2096)
B5XLG6 3.71e-14 70 35 1 104 3 Spy49_0870 UPF0758 protein Spy49_0870 Streptococcus pyogenes serotype M49 (strain NZ131)
P65962 3.71e-14 70 35 1 104 3 SPy_1118 UPF0758 protein SPy_1118/M5005_Spy0840 Streptococcus pyogenes serotype M1
P65963 3.71e-14 70 35 1 104 3 spyM18_1079 UPF0758 protein spyM18_1079 Streptococcus pyogenes serotype M18 (strain MGAS8232)
B2IY74 6.59e-14 70 32 2 128 3 Npun_R6401 UPF0758 protein Npun_R6401 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8YUJ5 6.86e-14 70 33 0 118 3 alr2351 UPF0758 protein alr2351 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MGT8 7.3e-14 70 33 0 118 3 Ava_0172 UPF0758 protein Ava_0172 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q48TN1 1.59e-13 68 34 1 104 3 M28_Spy0816 UPF0758 protein M28_Spy0816 Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0DH29 1.71e-13 68 34 1 104 3 SPs0978 UPF0758 protein SPs0978 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DH28 1.71e-13 68 34 1 104 3 SpyM3_0777 UPF0758 protein SpyM3_0777 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B1XM86 3.22e-13 68 28 1 164 3 SYNPCC7002_A0220 UPF0758 protein SYNPCC7002_A0220 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
C0MEY7 3.44e-13 67 30 0 104 3 SZO_09140 UPF0758 protein SZO_09140 Streptococcus equi subsp. zooepidemicus (strain H70)
B4U337 3.51e-13 67 30 0 104 3 Sez_1052 UPF0758 protein Sez_1052 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B7KF44 3.96e-13 68 30 0 117 3 PCC7424_2073 UPF0758 protein PCC7424_2073 Gloeothece citriformis (strain PCC 7424)
A4W1K3 4.14e-13 68 31 1 108 3 SSU98_1084 UPF0758 protein SSU98_1084 Streptococcus suis (strain 98HAH33)
P52601 6.46e-13 67 31 2 121 3 sll0766 UPF0758 protein sll0766 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0JTF4 2.48e-12 65 29 0 118 3 MAE_44350 UPF0758 protein MAE_44350 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q03JN0 3.64e-12 65 25 0 136 3 STER_1430 UPF0758 protein STER_1430 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LYU6 4.2e-12 65 25 0 136 3 str1465 UPF0758 protein str1465 Streptococcus thermophilus (strain CNRZ 1066)
Q5M3F9 4.42e-12 65 25 0 136 3 stu1465 UPF0758 protein stu1465 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
C0MA71 7.02e-12 64 29 0 104 3 SEQ_1136 UPF0758 protein SEQ_1136 Streptococcus equi subsp. equi (strain 4047)
B0CEV0 1.19e-11 63 26 0 135 3 AM1_4368 UPF0758 protein AM1_4368 Acaryochloris marina (strain MBIC 11017)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12065
Feature type CDS
Gene radC
Product DNA repair protein RadC
Location 2668678 - 2669175 (strand: -1)
Length 498 (nucleotides) / 165 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_402
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF04002 RadC-like JAB domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2003 Replication, recombination and repair (L) L DNA repair protein RadC, contains a helix-hairpin-helix DNA-binding motif

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03630 DNA repair protein RadC - -

Protein Sequence

MKNKKFLAGEEAGTYIVPEQVTEADILDMALKLARGRLSKGRKIEQPSSAFSYLQTLMHEYEHEVFGVLFLDTKHRVIRFEELFKGTLDAASVYPREVTKRALEFNAAAVILVHNHPSGDPEPSEADKRITHRLRDALSLVDIRTLDHVVVASEGCVSLAERGYL

Flanking regions ( +/- flanking 50bp)

TCCGTCCCCTTCAGGGAATGGGTTCGTCTCCGTTTTTTTTGGAGACTCCTATGAAAAACAAAAAATTCTTAGCTGGCGAAGAAGCCGGTACTTACATCGTTCCTGAGCAAGTGACTGAAGCGGATATTTTAGATATGGCGCTTAAGCTTGCCCGTGGTCGATTGAGTAAAGGTCGCAAAATTGAACAGCCATCATCGGCGTTCTCATACCTGCAAACACTGATGCACGAGTATGAGCACGAAGTCTTTGGCGTGCTGTTTCTTGATACAAAGCATCGCGTTATTCGATTTGAAGAGCTGTTCAAAGGCACTTTAGATGCAGCGAGCGTGTATCCAAGGGAAGTAACAAAGCGGGCGTTGGAATTTAATGCGGCAGCAGTGATACTGGTTCATAACCATCCATCGGGTGATCCTGAACCCAGTGAAGCTGATAAACGCATCACTCATCGACTTCGTGACGCCTTGTCACTTGTTGATATTCGAACGCTTGACCATGTCGTGGTCGCATCCGAGGGCTGCGTTTCGCTTGCCGAACGCGGTTATCTTTAATGAATGGGCGCATTGCCCATTCTCCTTCATCACAAAAGCAGTCCTATCAG