Homologs in group_2348

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17790 FBDBKF_17790 89.6 Morganella morganii S1 prfC peptide chain release factor 3
EHELCC_09815 EHELCC_09815 89.6 Morganella morganii S2 prfC peptide chain release factor 3
NLDBIP_10195 NLDBIP_10195 89.6 Morganella morganii S4 prfC peptide chain release factor 3
LHKJJB_07560 LHKJJB_07560 89.6 Morganella morganii S3 prfC peptide chain release factor 3
HKOGLL_07110 HKOGLL_07110 89.6 Morganella morganii S5 prfC peptide chain release factor 3
F4V73_RS15175 F4V73_RS15175 87.5 Morganella psychrotolerans prfC peptide chain release factor 3

Distribution of the homologs in the orthogroup group_2348

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2348

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EWB0 0.0 1101 100 0 529 3 prfC Peptide chain release factor 3 Proteus mirabilis (strain HI4320)
Q7MZN3 0.0 996 89 0 529 3 prfC Peptide chain release factor 3 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DJU6 0.0 990 88 0 529 3 prfC Peptide chain release factor 3 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4W691 0.0 984 87 0 529 3 prfC Peptide chain release factor 3 Enterobacter sp. (strain 638)
Q6D9Z5 0.0 983 87 0 529 3 prfC Peptide chain release factor 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8ALY7 0.0 983 87 0 529 3 prfC Peptide chain release factor 3 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8G9G8 0.0 982 87 0 529 3 prfC Peptide chain release factor 3 Serratia proteamaculans (strain 568)
A7MGA3 0.0 978 87 0 529 3 prfC Peptide chain release factor 3 Cronobacter sakazakii (strain ATCC BAA-894)
Q56121 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TU33 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella schwarzengrund (strain CVM19633)
B5BL11 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella paratyphi A (strain AKU_12601)
C0Q7L6 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella paratyphi C (strain RKS4594)
A9N7C9 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PK12 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4G3 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella newport (strain SL254)
B4TGZ2 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella heidelberg (strain SL476)
B5R2J0 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella enteritidis PT4 (strain P125109)
B5FTB7 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella dublin (strain CT_02021853)
Q57G48 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella choleraesuis (strain SC-B67)
B5F516 0.0 977 86 0 529 3 prfC Peptide chain release factor 3 Salmonella agona (strain SL483)
Q8Z0U8 0.0 976 86 0 529 3 prfC Peptide chain release factor 3 Salmonella typhi
B5Y282 0.0 976 87 0 529 3 prfC Peptide chain release factor 3 Klebsiella pneumoniae (strain 342)
B5R9U3 0.0 975 86 0 529 3 prfC Peptide chain release factor 3 Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MRB6 0.0 975 86 0 529 3 prfC Peptide chain release factor 3 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q327M2 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Shigella dysenteriae serotype 1 (strain Sd197)
B1LEH8 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain SMS-3-5 / SECEC)
B7NH42 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A7I4 0.0 974 86 0 529 1 prfC Peptide chain release factor RF3 Escherichia coli (strain K12)
P0A7I5 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1XFI4 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain K12 / DH10B)
C4ZT56 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain K12 / MC4100 / BW2952)
B7MTC0 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O81 (strain ED1a)
B5Z4Q6 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A7I6 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O157:H7
B7LEM0 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain 55989 / EAEC)
B7UR02 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A6THZ0 0.0 974 87 0 529 3 prfC Peptide chain release factor 3 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q2NW08 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Sodalis glossinidius (strain morsitans)
Q31SW4 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Shigella boydii serotype 4 (strain Sb227)
B2TZQ6 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I2Q6 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain SE11)
B1IS45 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A8A3 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O9:H4 (strain HS)
A7ZVR5 0.0 974 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LXT6 0.0 973 86 0 529 3 prfC Peptide chain release factor 3 Escherichia coli O8 (strain IAI1)
Q83P06 0.0 973 86 0 529 3 prfC Peptide chain release factor 3 Shigella flexneri
Q1R270 0.0 972 87 0 521 3 prfC Peptide chain release factor 3 Escherichia coli (strain UTI89 / UPEC)
A1AJU2 0.0 972 87 0 521 3 prfC Peptide chain release factor 3 Escherichia coli O1:K1 / APEC
Q3YU19 0.0 972 85 0 529 3 prfC Peptide chain release factor 3 Shigella sonnei (strain Ss046)
Q0SX36 0.0 971 85 0 529 3 prfC Peptide chain release factor 3 Shigella flexneri serotype 5b (strain 8401)
C5BHI4 0.0 969 86 0 529 3 prfC Peptide chain release factor 3 Edwardsiella ictaluri (strain 93-146)
B2VH43 0.0 966 85 0 529 3 prfC Peptide chain release factor 3 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A1JJ92 0.0 963 85 0 529 3 prfC Peptide chain release factor 3 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JL43 0.0 953 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EW6 0.0 953 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3I2 0.0 953 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMI1 0.0 953 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TQJ9 0.0 952 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pestis (strain Pestoides F)
Q1CMZ7 0.0 952 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R055 0.0 952 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIR0 0.0 952 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pestis
Q1C156 0.0 952 84 0 529 3 prfC Peptide chain release factor 3 Yersinia pestis bv. Antiqua (strain Antiqua)
P57879 0.0 944 84 0 529 3 prfC Peptide chain release factor 3 Pasteurella multocida (strain Pm70)
Q7MI34 0.0 936 83 0 529 3 prfC Peptide chain release factor 3 Vibrio vulnificus (strain YJ016)
Q8DBT6 0.0 936 83 0 529 3 prfC Peptide chain release factor 3 Vibrio vulnificus (strain CMCP6)
B3GZM0 0.0 936 84 0 524 3 prfC Peptide chain release factor 3 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q65SF0 0.0 935 83 0 529 3 prfC Peptide chain release factor 3 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VN03 0.0 935 84 0 524 3 prfC Peptide chain release factor 3 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BRI9 0.0 934 83 0 524 3 prfC Peptide chain release factor 3 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B0USE8 0.0 933 83 0 524 3 prfC Peptide chain release factor 3 Histophilus somni (strain 2336)
Q0I2G9 0.0 933 83 0 524 3 prfC Peptide chain release factor 3 Histophilus somni (strain 129Pt)
A3MYA2 0.0 933 83 0 524 3 prfC Peptide chain release factor 3 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UFG5 0.0 931 84 0 523 3 prfC Peptide chain release factor 3 Haemophilus influenzae (strain PittGG)
C3LSR4 0.0 931 82 0 529 3 prfC Peptide chain release factor 3 Vibrio cholerae serotype O1 (strain M66-2)
Q9KU64 0.0 931 82 0 529 3 prfC Peptide chain release factor 3 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P43928 0.0 931 83 0 523 3 prfC Peptide chain release factor 3 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QJL3 0.0 930 83 0 523 3 prfC Peptide chain release factor 3 Haemophilus influenzae (strain 86-028NP)
A5F904 0.0 929 82 0 529 3 prfC Peptide chain release factor 3 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5UBE8 0.0 927 83 0 523 3 prfC Peptide chain release factor 3 Haemophilus influenzae (strain PittEE)
B7VJG2 0.0 922 81 0 524 3 prfC Peptide chain release factor 3 Vibrio atlanticus (strain LGP32)
Q7VNX4 0.0 915 82 0 524 3 prfC Peptide chain release factor 3 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A7MUW8 0.0 913 80 0 529 3 prfC Peptide chain release factor 3 Vibrio campbellii (strain ATCC BAA-1116)
Q87M18 0.0 912 80 0 529 3 prfC Peptide chain release factor 3 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q12QG7 0.0 912 82 0 521 3 prfC Peptide chain release factor 3 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B5FA93 0.0 907 80 0 524 3 prfC Peptide chain release factor 3 Aliivibrio fischeri (strain MJ11)
Q5E7K1 0.0 904 80 0 524 3 prfC Peptide chain release factor 3 Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1RH82 0.0 904 81 1 529 3 prfC Peptide chain release factor 3 Shewanella sp. (strain W3-18-1)
Q3IHI5 0.0 903 80 0 529 3 prfC Peptide chain release factor 3 Pseudoalteromonas translucida (strain TAC 125)
B6ENF7 0.0 895 79 0 524 3 prfC Peptide chain release factor 3 Aliivibrio salmonicida (strain LFI1238)
A0KU03 0.0 889 80 1 521 3 prfC Peptide chain release factor 3 Shewanella sp. (strain ANA-3)
Q0HXQ8 0.0 889 80 1 521 3 prfC Peptide chain release factor 3 Shewanella sp. (strain MR-7)
Q0HLF4 0.0 889 80 1 521 3 prfC Peptide chain release factor 3 Shewanella sp. (strain MR-4)
B4RU35 0.0 887 79 0 529 3 prfC Peptide chain release factor 3 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A8H733 0.0 886 80 1 521 3 prfC Peptide chain release factor 3 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8E6N9 0.0 884 80 1 521 3 prfC Peptide chain release factor 3 Shewanella baltica (strain OS223)
A4Y9B3 0.0 884 80 1 521 3 prfC Peptide chain release factor 3 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3QGT8 0.0 883 80 1 521 3 prfC Peptide chain release factor 3 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q15W54 0.0 883 78 1 529 3 prfC Peptide chain release factor 3 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A3D7J9 0.0 882 80 1 521 3 prfC Peptide chain release factor 3 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B0TQ95 0.0 881 80 1 521 3 prfC Peptide chain release factor 3 Shewanella halifaxensis (strain HAW-EB4)
Q086G5 0.0 880 79 1 521 3 prfC Peptide chain release factor 3 Shewanella frigidimarina (strain NCIMB 400)
A8FYR3 0.0 876 79 1 521 3 prfC Peptide chain release factor 3 Shewanella sediminis (strain HAW-EB3)
B1KRQ3 0.0 873 79 1 521 3 prfC Peptide chain release factor 3 Shewanella woodyi (strain ATCC 51908 / MS32)
Q5QXU1 0.0 865 77 2 530 3 prfC Peptide chain release factor 3 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q487B0 0.0 862 77 1 522 3 prfC Peptide chain release factor 3 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q2S9X0 0.0 857 78 1 521 3 prfC Peptide chain release factor 3 Hahella chejuensis (strain KCTC 2396)
A1ST34 0.0 831 74 1 529 3 prfC Peptide chain release factor 3 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0VRV7 0.0 777 70 0 528 3 prfC Peptide chain release factor 3 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C5BNW9 0.0 772 70 2 529 3 prfC Peptide chain release factor 3 Teredinibacter turnerae (strain ATCC 39867 / T7901)
B8GTY2 0.0 769 70 1 521 3 prfC Peptide chain release factor 3 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A6VU13 0.0 761 67 1 529 3 prfC Peptide chain release factor 3 Marinomonas sp. (strain MWYL1)
Q21HQ0 0.0 756 70 2 518 3 prfC Peptide chain release factor 3 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5ZX60 0.0 753 68 1 525 3 prfC Peptide chain release factor 3 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6N0 0.0 753 68 1 525 3 prfC Peptide chain release factor 3 Legionella pneumophila (strain Paris)
A5IG41 0.0 749 68 1 525 3 prfC Peptide chain release factor 3 Legionella pneumophila (strain Corby)
Q5WY34 0.0 748 68 1 525 3 prfC Peptide chain release factor 3 Legionella pneumophila (strain Lens)
B6J6N8 0.0 738 67 1 517 3 prfC Peptide chain release factor 3 Coxiella burnetii (strain CbuK_Q154)
A4XQE4 0.0 738 67 1 521 3 prfC Peptide chain release factor 3 Pseudomonas mendocina (strain ymp)
Q83DC7 0.0 738 66 1 517 1 prfC Peptide chain release factor 3 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDA0 0.0 738 66 1 517 3 prfC Peptide chain release factor 3 Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFG7 0.0 738 66 1 517 3 prfC Peptide chain release factor 3 Coxiella burnetii (strain Dugway 5J108-111)
A4VI89 0.0 736 67 1 521 3 prfC Peptide chain release factor 3 Stutzerimonas stutzeri (strain A1501)
B6J0P2 0.0 736 66 1 517 3 prfC Peptide chain release factor 3 Coxiella burnetii (strain CbuG_Q212)
Q5NIF4 0.0 734 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JV7 0.0 734 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. tularensis (strain FSC 198)
A0Q892 0.0 734 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. novicida (strain U112)
Q3J9L6 0.0 734 65 1 529 3 prfC Peptide chain release factor 3 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4IW75 0.0 734 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. tularensis (strain WY96-3418)
B2SF23 0.0 734 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. mediasiatica (strain FSC147)
Q3KI56 0.0 733 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas fluorescens (strain Pf0-1)
C3K5A9 0.0 733 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas fluorescens (strain SBW25)
Q0BKK2 0.0 733 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1V8 0.0 733 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. holarctica (strain LVS)
A7NE28 0.0 733 67 1 525 3 prfC Peptide chain release factor 3 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q9HXB0 0.0 732 67 1 521 3 prfC Peptide chain release factor 3 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S69 0.0 732 67 1 521 3 prfC Peptide chain release factor 3 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VBK5 0.0 732 67 1 521 3 prfC Peptide chain release factor 3 Pseudomonas aeruginosa (strain LESB58)
B0TWY6 0.0 732 67 1 526 3 prfC Peptide chain release factor 3 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q4KIC9 0.0 729 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZNI9 0.0 728 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas syringae pv. syringae (strain B728a)
Q48DZ2 0.0 727 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C1DQ00 0.0 727 66 1 521 3 prfC Peptide chain release factor 3 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A6V0K2 0.0 726 66 1 521 3 prfC Peptide chain release factor 3 Pseudomonas aeruginosa (strain PA7)
Q87WH1 0.0 725 65 1 521 3 prfC Peptide chain release factor 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B1JBG6 0.0 723 65 2 529 3 prfC Peptide chain release factor 3 Pseudomonas putida (strain W619)
Q1IEF7 0.0 721 65 2 529 3 prfC Peptide chain release factor 3 Pseudomonas entomophila (strain L48)
Q88PH8 0.0 719 65 2 529 3 prfC Peptide chain release factor 3 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B2FR00 0.0 719 66 0 521 1 prfC Peptide chain release factor 3 Stenotrophomonas maltophilia (strain K279a)
B0KQD8 0.0 718 65 2 529 3 prfC Peptide chain release factor 3 Pseudomonas putida (strain GB-1)
Q606M6 0.0 717 66 1 520 3 prfC Peptide chain release factor 3 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q31H08 0.0 714 65 2 521 3 prfC Peptide chain release factor 3 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q6F823 0.0 714 63 0 529 3 prfC Peptide chain release factor 3 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B4SSC0 0.0 712 65 0 521 3 prfC Peptide chain release factor 3 Stenotrophomonas maltophilia (strain R551-3)
Q4FUQ9 0.0 711 64 0 522 3 prfC Peptide chain release factor 3 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QDP8 0.0 710 64 0 522 3 prfC Peptide chain release factor 3 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9K0H6 0.0 706 62 1 527 3 prfC Peptide chain release factor 3 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5H1V2 0.0 705 64 0 525 3 prfC Peptide chain release factor 3 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SSM9 0.0 705 64 0 525 3 prfC Peptide chain release factor 3 Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P4Q8 0.0 705 64 0 525 3 prfC Peptide chain release factor 3 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B8D9W5 0.0 705 59 1 529 3 prfC Peptide chain release factor 3 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A5WH45 0.0 704 64 0 522 3 prfC Peptide chain release factor 3 Psychrobacter sp. (strain PRwf-1)
B8D867 0.0 704 59 1 529 3 prfC Peptide chain release factor 3 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A1KSN4 0.0 703 62 1 527 3 prfC Peptide chain release factor 3 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P57608 0.0 701 59 1 529 3 prfC Peptide chain release factor 3 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9JVH7 0.0 700 61 1 527 3 prfC Peptide chain release factor 3 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5FA25 0.0 700 61 1 527 3 prfC Peptide chain release factor 3 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B4RJN1 0.0 699 61 1 527 3 prfC Peptide chain release factor 3 Neisseria gonorrhoeae (strain NCCP11945)
Q8P6V6 0.0 692 64 0 522 3 prfC Peptide chain release factor 3 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RQB0 0.0 692 64 0 522 3 prfC Peptide chain release factor 3 Xanthomonas campestris pv. campestris (strain B100)
Q4UXA5 0.0 692 64 0 522 3 prfC Peptide chain release factor 3 Xanthomonas campestris pv. campestris (strain 8004)
Q8PI56 0.0 689 64 0 522 3 prfC Peptide chain release factor 3 Xanthomonas axonopodis pv. citri (strain 306)
Q8K935 0.0 689 59 0 529 3 prfC Peptide chain release factor 3 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q3BQQ3 0.0 687 64 0 522 3 prfC Peptide chain release factor 3 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A5EVN8 0.0 679 62 2 518 3 prfC Peptide chain release factor 3 Dichelobacter nodosus (strain VCS1703A)
P39883 0.0 679 62 2 518 3 prfC Peptide chain release factor 3 Dichelobacter nodosus
Q9PGX4 0.0 676 61 0 526 3 prfC Peptide chain release factor 3 Xylella fastidiosa (strain 9a5c)
B0U262 0.0 676 61 0 526 3 prfC Peptide chain release factor 3 Xylella fastidiosa (strain M12)
Q7NVF7 0.0 675 61 1 521 3 prfC Peptide chain release factor 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q87F03 0.0 675 61 0 526 3 prfC Peptide chain release factor 3 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6P5 0.0 675 61 0 526 3 prfC Peptide chain release factor 3 Xylella fastidiosa (strain M23)
Q3A709 0.0 668 60 1 521 3 prfC Peptide chain release factor 3 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1WSZ8 0.0 668 62 3 526 3 prfC Peptide chain release factor 3 Halorhodospira halophila (strain DSM 244 / SL1)
B8FGS8 0.0 664 59 0 521 3 prfC Peptide chain release factor 3 Desulfatibacillum aliphaticivorans
Q8XPH8 0.0 657 61 5 528 3 prfC Peptide chain release factor 3 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0JY21 0.0 655 60 5 533 3 prfC Peptide chain release factor 3 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B3RDA4 0.0 651 60 5 533 3 prfC Peptide chain release factor 3 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46QA5 0.0 650 60 5 533 3 prfC Peptide chain release factor 3 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q47CH1 0.0 649 59 4 523 3 prfC Peptide chain release factor 3 Dechloromonas aromatica (strain RCB)
Q39Z86 0.0 649 59 2 522 3 prfC Peptide chain release factor 3 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q30V54 0.0 646 59 1 526 3 prfC Peptide chain release factor 3 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q1H0I2 0.0 646 58 4 524 3 prfC Peptide chain release factor 3 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B8DIL5 0.0 644 60 2 515 1 prfC Peptide chain release factor 3 Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B9M7Q2 0.0 642 60 4 528 3 prfC Peptide chain release factor 3 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q3SK69 0.0 641 58 1 521 3 prfC Peptide chain release factor 3 Thiobacillus denitrificans (strain ATCC 25259)
Q2LWC5 0.0 640 58 1 524 3 prfC Peptide chain release factor 3 Syntrophus aciditrophicus (strain SB)
A1AME1 0.0 640 57 2 522 3 prfC Peptide chain release factor 3 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q74GV6 0.0 640 59 4 526 3 prfC Peptide chain release factor 3 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q89A56 0.0 637 55 2 524 3 prfC Peptide chain release factor 3 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1VA24 0.0 635 59 2 521 3 prfC Peptide chain release factor 3 Nitratidesulfovibrio vulgaris (strain DP4)
Q726J1 0.0 635 59 2 521 3 prfC Peptide chain release factor 3 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A0LLL8 0.0 632 58 1 526 3 prfC Peptide chain release factor 3 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A5G9T7 0.0 629 60 4 526 3 prfC Peptide chain release factor 3 Geotalea uraniireducens (strain Rf4)
Q6AJD2 0.0 619 57 1 522 3 prfC Peptide chain release factor 3 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5P409 0.0 598 55 4 530 3 prfC Peptide chain release factor 3 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2KTQ5 0.0 584 53 2 524 3 prfC Peptide chain release factor 3 Bordetella avium (strain 197N)
Q82S73 0.0 575 52 2 523 3 prfC Peptide chain release factor 3 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A9HW20 0.0 575 52 2 523 3 prfC Peptide chain release factor 3 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7W0G3 0.0 568 52 2 523 3 prfC Peptide chain release factor 3 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WDS1 0.0 568 52 2 523 3 prfC Peptide chain release factor 3 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W2S3 0.0 566 52 2 523 3 prfC Peptide chain release factor 3 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q0ADD1 0.0 565 51 2 523 3 prfC Peptide chain release factor 3 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2S204 0.0 561 52 2 522 3 prfC Peptide chain release factor 3 Salinibacter ruber (strain DSM 13855 / M31)
Q9CIK7 7.56e-169 491 47 5 522 3 prfC Peptide chain release factor 3 Lactococcus lactis subsp. lactis (strain IL1403)
Q67MT5 1.43e-168 490 52 3 471 3 prfC Peptide chain release factor 3 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q031X0 1.69e-168 490 47 5 522 3 prfC Peptide chain release factor 3 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI79 1.98e-167 487 47 5 522 3 prfC Peptide chain release factor 3 Lactococcus lactis subsp. cremoris (strain MG1363)
B1I9N0 2.09e-167 487 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain Hungary19A-6)
Q97SE4 3.81e-167 486 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B2ILY0 6.49e-167 485 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain CGSP14)
C1C5H4 1.13e-166 485 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain 70585)
Q49WE9 1.2e-166 485 48 8 525 3 prfC Peptide chain release factor 3 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
C1CPU9 2.06e-166 484 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain Taiwan19F-14)
C1CCK2 2.06e-166 484 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain JJA)
Q8DR09 2.06e-166 484 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZLK3 2.06e-166 484 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q04M39 2.06e-166 484 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1WUZ8 2.53e-166 484 48 7 529 3 prfC Peptide chain release factor 3 Ligilactobacillus salivarius (strain UCC118)
Q7NGL0 4.09e-166 484 47 1 527 3 prfC Peptide chain release factor 3 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B5E1P9 4.4e-166 483 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae serotype 19F (strain G54)
C1CIU0 9.96e-166 482 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus pneumoniae (strain P1031)
Q4L527 1.22e-165 482 46 5 525 3 prfC Peptide chain release factor 3 Staphylococcus haemolyticus (strain JCSC1435)
A4W2D1 1.24e-165 482 47 6 520 3 prfC Peptide chain release factor 3 Streptococcus suis (strain 98HAH33)
Q8NXC0 6.64e-165 481 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain MW2)
Q6GAQ7 6.64e-165 481 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain MSSA476)
Q6GI64 6.64e-165 481 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain MRSA252)
Q2YX08 6.64e-165 481 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A8AYN4 2.84e-164 479 46 6 520 3 prfC Peptide chain release factor 3 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B9EAS8 3.01e-164 479 46 5 525 3 prfC Peptide chain release factor 3 Macrococcus caseolyticus (strain JCSC5402)
B9DQA0 3.32e-164 479 47 5 526 3 prfC Peptide chain release factor 3 Staphylococcus carnosus (strain TM300)
B2G8K6 5.74e-164 478 46 6 529 3 prfC Peptide chain release factor 3 Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VL77 5.74e-164 478 46 6 529 3 prfC Peptide chain release factor 3 Limosilactobacillus reuteri (strain DSM 20016)
A8Z0C4 8.28e-164 478 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain USA300 / TCH1516)
A6QFN0 8.28e-164 478 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain Newman)
O86490 8.28e-164 478 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain COL)
Q2FZP4 8.28e-164 478 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI57 8.28e-164 478 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain USA300)
Q99V72 4.52e-163 476 47 8 525 1 prfC Peptide chain release factor 3 Staphylococcus aureus (strain N315)
A5IRJ6 4.52e-163 476 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain JH9)
A6U0C5 4.52e-163 476 47 8 525 3 prfC Peptide chain release factor 3 Staphylococcus aureus (strain JH1)
P73473 6.63e-163 476 51 2 473 3 prfC Peptide chain release factor 3 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q110K2 1.22e-162 476 49 1 468 3 prfC Peptide chain release factor 3 Trichodesmium erythraeum (strain IMS101)
Q03JD8 1.29e-162 474 48 5 520 3 prfC Peptide chain release factor 3 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M364 1.62e-162 474 48 5 520 3 prfC Peptide chain release factor 3 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYK1 1.62e-162 474 48 5 520 3 prfC Peptide chain release factor 3 Streptococcus thermophilus (strain CNRZ 1066)
B7KCH0 1.86e-162 475 46 2 516 3 prfC Peptide chain release factor 3 Gloeothece citriformis (strain PCC 7424)
B9DUR6 1.91e-162 474 48 5 519 3 prfC Peptide chain release factor 3 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8CPR1 3.6e-162 473 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQE4 3.6e-162 473 46 6 525 3 prfC Peptide chain release factor 3 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q88XF3 1.54e-161 472 47 8 525 3 prfC Peptide chain release factor 3 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03GI2 3.62e-161 471 47 6 530 3 prfC Peptide chain release factor 3 Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B3WFB1 1.04e-160 470 47 6 528 3 prfC Peptide chain release factor 3 Lacticaseibacillus casei (strain BL23)
Q8DV91 3.85e-160 468 47 6 516 3 prfC Peptide chain release factor 3 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B0JIY7 3.9e-160 469 49 1 467 3 prfC Peptide chain release factor 3 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B2J573 8.62e-160 468 48 1 477 3 prfC Peptide chain release factor 3 Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q03Q83 1.11e-159 467 46 4 525 3 prfC Peptide chain release factor 3 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q037T6 1.17e-159 467 46 6 528 3 prfC Peptide chain release factor 3 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q31KM4 1.5e-159 468 49 1 468 3 prfC Peptide chain release factor 3 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5N192 2.7e-159 468 49 1 468 3 prfC Peptide chain release factor 3 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q3M7Y0 3.28e-159 467 50 1 469 3 prfC Peptide chain release factor 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B8HY03 5.65e-159 466 49 3 470 3 prfC Peptide chain release factor 3 Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q38VL2 6.68e-159 465 45 7 529 3 prfC Peptide chain release factor 3 Latilactobacillus sakei subsp. sakei (strain 23K)
Q8YP23 8.08e-159 466 50 1 469 3 prfC Peptide chain release factor 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1JG54 1.01e-157 462 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M2 (strain MGAS10270)
B5XM60 1.25e-157 462 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M49 (strain NZ131)
P0DD97 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M3 (strain SSI-1)
Q1J5X1 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JL31 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JAY1 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0DD96 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P66021 1.62e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M1
Q04BM6 1.65e-157 462 45 6 530 3 prfC Peptide chain release factor 3 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GB78 1.65e-157 462 45 6 530 3 prfC Peptide chain release factor 3 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
B0C6Z1 1.87e-157 462 46 4 529 3 prfC Peptide chain release factor 3 Acaryochloris marina (strain MBIC 11017)
A2RDW3 1.89e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8P0C7 2.11e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XB97 2.11e-157 461 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8E0G1 5.02e-157 460 46 5 520 3 prfC Peptide chain release factor 3 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E635 5.02e-157 460 46 5 520 3 prfC Peptide chain release factor 3 Streptococcus agalactiae serotype III (strain NEM316)
Q3K1T4 5.02e-157 460 46 5 520 3 prfC Peptide chain release factor 3 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B1WUP2 6.03e-157 461 48 2 480 3 prfC Peptide chain release factor 3 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q48SQ1 6.52e-157 460 46 5 515 3 prfC Peptide chain release factor 3 Streptococcus pyogenes serotype M28 (strain MGAS6180)
A3CLS9 8.1e-157 459 46 4 519 3 prfC Peptide chain release factor 3 Streptococcus sanguinis (strain SK36)
Q74IG8 1.54e-155 457 46 6 521 3 prfC Peptide chain release factor 3 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q837X4 1.56e-155 457 46 4 515 3 prfC Peptide chain release factor 3 Enterococcus faecalis (strain ATCC 700802 / V583)
B7JYV9 3.04e-155 456 46 2 519 3 prfC Peptide chain release factor 3 Rippkaea orientalis (strain PCC 8801 / RF-1)
Q041Z5 4.99e-155 455 46 6 521 3 prfC Peptide chain release factor 3 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5FLA9 3.49e-152 448 44 6 528 3 prfC Peptide chain release factor 3 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8Y8C0 5.15e-152 447 45 4 524 3 prfC Peptide chain release factor 3 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0AHA7 6.61e-152 447 46 5 524 3 prfC Peptide chain release factor 3 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92D33 1.03e-151 447 46 5 524 3 prfC Peptide chain release factor 3 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DEE7 1.41e-151 447 45 4 524 3 prfC Peptide chain release factor 3 Listeria monocytogenes serotype 4a (strain HCC23)
Q721H8 1.41e-151 447 45 4 524 3 prfC Peptide chain release factor 3 Listeria monocytogenes serotype 4b (strain F2365)
C1L1Q9 4.33e-151 445 45 4 524 3 prfC Peptide chain release factor 3 Listeria monocytogenes serotype 4b (strain CLIP80459)
A8YU90 5.99e-150 442 43 6 534 3 prfC Peptide chain release factor 3 Lactobacillus helveticus (strain DPC 4571)
B1GZ80 2.07e-49 184 30 13 482 3 fusA Elongation factor G Endomicrobium trichonymphae
Q8YP62 7.35e-49 182 30 15 483 3 fusA Elongation factor G Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3MDM4 7.65e-49 182 30 15 482 3 fusA Elongation factor G Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q2S3R7 1.9e-48 181 29 12 477 3 fusA Elongation factor G Salinibacter ruber (strain DSM 13855 / M31)
Q04Y01 3.27e-47 178 27 10 471 3 fusA Elongation factor G Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VH3 3.47e-47 178 27 10 471 3 fusA Elongation factor G Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B2J5B0 1.11e-46 176 29 14 486 3 fusA Elongation factor G Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8F983 1.44e-46 176 27 10 471 3 fusA Elongation factor G Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72VM5 1.44e-46 176 27 10 471 3 fusA Elongation factor G Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7NAV3 1.53e-46 176 26 10 472 3 fusA Elongation factor G Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
A6LLL0 1.72e-46 176 30 13 479 3 fusA Elongation factor G Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q2NJ19 2.75e-46 175 28 13 474 3 fusA Elongation factor G Aster yellows witches'-broom phytoplasma (strain AYWB)
A7TFN8 2.9e-46 176 27 11 481 3 MEF1 Elongation factor G, mitochondrial Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P75544 4.58e-46 174 25 10 476 1 fusA Elongation factor G Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
C1CIF3 7.2e-46 174 29 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain P1031)
P64023 1.21e-45 173 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P64022 1.21e-45 173 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CB46 1.21e-45 173 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain 70585)
B5E6U5 1.21e-45 173 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae serotype 19F (strain G54)
Q04MH7 1.21e-45 173 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q73F99 1.49e-45 173 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain ATCC 10987 / NRS 248)
Q03IS1 2.07e-45 172 29 15 488 3 fusA Elongation factor G Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M2M6 2.07e-45 172 29 15 488 3 fusA Elongation factor G Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LY21 2.07e-45 172 29 15 488 3 fusA Elongation factor G Streptococcus thermophilus (strain CNRZ 1066)
Q6FUQ6 2.11e-45 173 27 13 511 3 MEF1 Elongation factor G, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q63H93 2.12e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain ZK / E33L)
B9IZJ1 2.14e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain Q1)
B7HQU1 2.14e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain AH187)
B4U0V9 2.2e-45 172 28 16 521 3 fusA Elongation factor G Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q6YQV9 2.36e-45 172 28 13 474 3 fusA Elongation factor G Onion yellows phytoplasma (strain OY-M)
P47335 2.43e-45 172 25 12 489 3 fusA Elongation factor G Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
C1CC62 2.84e-45 172 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain JJA)
C1CPE5 3.07e-45 172 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain Taiwan19F-14)
B2ISJ9 3.07e-45 172 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain CGSP14)
B8ZKU0 3.19e-45 172 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B9DVS2 3.38e-45 172 28 17 509 3 fusA Elongation factor G Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q6HPR1 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q814C5 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ45 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain B4264)
C1ET36 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain 03BB102)
Q81VT3 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus anthracis
C3P9Q2 3.73e-45 172 28 13 476 3 fusA Elongation factor G Bacillus anthracis (strain A0248)
B7JKB6 3.8e-45 172 28 13 476 3 fusA Elongation factor G Bacillus cereus (strain AH820)
B5XJR1 4.54e-45 172 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M49 (strain NZ131)
C3LJ79 4.86e-45 172 28 13 476 3 fusA Elongation factor G Bacillus anthracis (strain CDC 684 / NRRL 3495)
P0DA85 6.91e-45 171 28 16 521 3 fus Elongation factor G Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VB6 6.91e-45 171 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J8I4 6.91e-45 171 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JIM6 6.91e-45 171 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNH7 6.91e-45 171 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M12 (strain MGAS9429)
P69948 6.91e-45 171 28 16 521 3 fus Elongation factor G Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDW4 6.91e-45 171 28 16 521 1 fus Elongation factor G Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA84 6.91e-45 171 28 16 521 3 fus Elongation factor G Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P69946 6.91e-45 171 28 16 521 3 fus Elongation factor G Streptococcus pyogenes serotype M1
A9VP74 7.69e-45 171 27 13 476 3 fusA Elongation factor G Bacillus mycoides (strain KBAB4)
A2RCI2 7.84e-45 171 28 16 521 3 fusA Elongation factor G Streptococcus pyogenes serotype M5 (strain Manfredo)
C0MF25 1.04e-44 171 28 16 521 3 fusA Elongation factor G Streptococcus equi subsp. zooepidemicus (strain H70)
C0M937 1.04e-44 171 28 16 521 3 fusA Elongation factor G Streptococcus equi subsp. equi (strain 4047)
A8AUR6 1.15e-44 171 28 17 509 3 fusA Elongation factor G Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8DXS7 1.22e-44 171 28 16 508 3 fusA Elongation factor G Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZB5 1.22e-44 171 28 16 508 3 fusA Elongation factor G Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B7IT16 1.22e-44 171 27 13 476 3 fusA Elongation factor G Bacillus cereus (strain G9842)
B1I8Z9 1.29e-44 170 28 17 509 3 fusA Elongation factor G Streptococcus pneumoniae (strain Hungary19A-6)
B1VAM2 1.29e-44 170 27 13 476 3 fusA Elongation factor G Phytoplasma australiense
F4IW10 1.6e-44 171 27 10 473 1 MEFG2 Elongation factor G-2, mitochondrial Arabidopsis thaliana
Q8E3E7 1.71e-44 170 28 16 508 3 fusA Elongation factor G Streptococcus agalactiae serotype III (strain NEM316)
A4VSN3 1.78e-44 170 28 16 521 3 fusA Elongation factor G Streptococcus suis (strain 05ZYH33)
A4VYX6 1.78e-44 170 28 16 521 3 fusA Elongation factor G Streptococcus suis (strain 98HAH33)
A9BCK1 2.53e-44 169 26 11 494 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9211)
Q7URV2 2.6e-44 169 27 12 474 3 fusA Elongation factor G Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q8DVV4 2.84e-44 169 28 12 489 3 fusA Elongation factor G Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6CRY5 3.2e-44 170 27 12 495 3 MEF1 Elongation factor G, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9C641 3.34e-44 170 27 11 473 1 MEFG1 Elongation factor G-1, mitochondrial Arabidopsis thaliana
Q7Q1K8 4.2e-44 169 26 10 483 3 AGAP009737 Elongation factor G, mitochondrial Anopheles gambiae
A4IJI6 4.91e-44 169 28 12 473 3 fusA Elongation factor G Geobacillus thermodenitrificans (strain NG80-2)
A7GK17 5.01e-44 169 27 13 480 3 fusA Elongation factor G Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A3CQM2 5.46e-44 169 28 15 488 3 fusA Elongation factor G Streptococcus sanguinis (strain SK36)
Q5U8S9 6.08e-44 168 27 15 482 3 fusA Elongation factor G Staphylococcus intermedius
C0R543 8.56e-44 168 27 10 497 3 fusA Elongation factor G Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q73IX7 8.56e-44 168 27 10 497 3 fusA Elongation factor G Wolbachia pipientis wMel
Q7VA04 9.08e-44 168 25 11 495 3 fusA Elongation factor G Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P25039 9.43e-44 169 26 13 493 1 MEF1 Elongation factor G, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q927I5 9.5e-44 168 28 13 478 3 fusA Elongation factor G Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7A0X4 9.61e-44 169 26 13 493 3 MEF1 Elongation factor G, mitochondrial Saccharomyces cerevisiae (strain YJM789)
B5VN01 9.61e-44 169 26 13 493 3 MEF1 Elongation factor G, mitochondrial Saccharomyces cerevisiae (strain AWRI1631)
B3LT39 9.61e-44 169 26 13 493 3 MEF1 Elongation factor G, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
Q8DI43 1.02e-43 168 27 14 491 3 fusA Elongation factor G Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B7IHU3 1.15e-43 167 28 12 477 3 fusA Elongation factor G Thermosipho africanus (strain TCF52B)
B3CLA3 1.19e-43 167 26 10 497 3 fusA Elongation factor G Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A6TWI5 1.7e-43 167 28 15 490 3 fusA Elongation factor G Alkaliphilus metalliredigens (strain QYMF)
Q5L400 1.86e-43 167 27 13 486 3 fusA Elongation factor G Geobacillus kaustophilus (strain HTA426)
Q9FE64 1.96e-43 167 26 10 485 2 Os03g0565500 Elongation factor G, mitochondrial Oryza sativa subsp. japonica
A0ALY9 2.05e-43 167 27 13 478 3 fusA Elongation factor G Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A2C4U6 2.08e-43 167 26 11 500 3 fusA Elongation factor G Prochlorococcus marinus (strain NATL1A)
Q8Y421 2.44e-43 167 27 13 478 3 fusA Elongation factor G Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DAY6 2.44e-43 167 27 13 478 3 fusA Elongation factor G Listeria monocytogenes serotype 4a (strain HCC23)
Q71WB8 2.44e-43 167 27 13 478 3 fusA Elongation factor G Listeria monocytogenes serotype 4b (strain F2365)
C1KZK7 2.44e-43 167 27 13 478 3 fusA Elongation factor G Listeria monocytogenes serotype 4b (strain CLIP80459)
B4R8L3 2.54e-43 167 27 13 488 3 fusA Elongation factor G Phenylobacterium zucineum (strain HLK1)
Q318N4 2.65e-43 167 26 13 495 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9312)
A7HM55 2.83e-43 166 29 15 475 3 fusA Elongation factor G Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B8MJJ5 3.5e-43 167 26 10 486 3 mef1 Elongation factor G, mitochondrial Talaromyces stipitatus (strain ATCC 10500 / CBS 375.48 / QM 6759 / NRRL 1006)
Q5L6S5 3.53e-43 166 27 16 533 3 fusA Elongation factor G Chlamydia abortus (strain DSM 27085 / S26/3)
Q8EX19 4.38e-43 166 26 10 474 3 fusA Elongation factor G Malacoplasma penetrans (strain HF-2)
Q46IW3 4.79e-43 166 26 11 494 3 fusA Elongation factor G Prochlorococcus marinus (strain NATL2A)
C5D3R4 4.83e-43 166 28 14 476 3 fusA Elongation factor G Geobacillus sp. (strain WCH70)
B0K5P0 4.94e-43 166 26 12 479 3 fusA Elongation factor G Thermoanaerobacter sp. (strain X514)
B0KCJ7 4.94e-43 166 26 12 479 3 fusA Elongation factor G Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q16S14 4.99e-43 166 25 11 489 3 AAEL010742 Elongation factor G, mitochondrial Aedes aegypti
Q4WP57 5.12e-43 167 26 14 493 3 mef1 Elongation factor G, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B0Y604 5.12e-43 167 26 14 493 3 mef1 Elongation factor G, mitochondrial Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A1CXG4 5.79e-43 167 26 14 493 3 mef1 Elongation factor G, mitochondrial Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
B3QY21 6.22e-43 166 28 13 487 3 fusA Elongation factor G Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q5AL45 8.25e-43 166 27 12 498 3 MEF1 Elongation factor G, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q74L90 8.49e-43 165 28 17 488 3 fusA Elongation factor G Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q824G0 9.5e-43 165 28 14 494 3 fusA Elongation factor G Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9CDG1 1.02e-42 165 29 16 494 3 fusA Elongation factor G Lactococcus lactis subsp. lactis (strain IL1403)
B8H414 1.04e-42 165 26 10 486 3 fusA Elongation factor G Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A3K4 1.04e-42 165 26 10 486 3 fusA Elongation factor G Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P80868 1.05e-42 165 27 16 488 1 fusA Elongation factor G Bacillus subtilis (strain 168)
A2RP72 1.11e-42 165 29 16 494 3 fusA Elongation factor G Lactococcus lactis subsp. cremoris (strain MG1363)
Q3Z983 1.13e-42 165 27 13 496 3 fusA Elongation factor G Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B7GJ64 1.27e-42 165 28 14 478 3 fusA Elongation factor G Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B6QHL4 1.28e-42 166 25 10 486 3 mef1 Elongation factor G, mitochondrial Talaromyces marneffei (strain ATCC 18224 / CBS 334.59 / QM 7333)
Q65PB0 1.29e-42 165 27 14 479 3 fusA Elongation factor G Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q253F1 1.45e-42 164 28 15 494 3 fusA Elongation factor G Chlamydia felis (strain Fe/C-56)
Q839G9 1.8e-42 164 28 15 505 1 fusA Elongation factor G Enterococcus faecalis (strain ATCC 700802 / V583)
Q2LUL6 1.86e-42 164 26 12 492 3 fusA2 Elongation factor G 2 Syntrophus aciditrophicus (strain SB)
B2GDX1 1.87e-42 164 27 13 494 3 fusA Elongation factor G Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q03ZQ2 1.93e-42 164 27 15 504 3 fusA Elongation factor G Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q2IK81 1.95e-42 164 27 12 478 3 fusA2 Elongation factor G 2 Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3AMT5 2.19e-42 164 26 13 491 3 fusA Elongation factor G Synechococcus sp. (strain CC9605)
Q3AW54 2.44e-42 164 26 12 501 3 fusA Elongation factor G Synechococcus sp. (strain CC9902)
Q7UZY6 2.44e-42 164 26 11 495 3 fusA Elongation factor G Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A5GW13 2.47e-42 164 26 15 499 3 fusA Elongation factor G Synechococcus sp. (strain RCC307)
B1MW21 2.54e-42 164 28 17 506 3 fusA Elongation factor G Leuconostoc citreum (strain KM20)
A7Z0N4 2.69e-42 164 27 14 492 3 fusA Elongation factor G Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3QZH4 2.73e-42 164 26 12 483 3 fusA Elongation factor G Phytoplasma mali (strain AT)
B9W9T4 2.78e-42 164 27 12 498 3 MEF1 Elongation factor G, mitochondrial Candida dubliniensis (strain CD36 / ATCC MYA-646 / CBS 7987 / NCPF 3949 / NRRL Y-17841)
B0WGM1 3.45e-42 164 25 10 485 3 CPIJ005834 Elongation factor G, mitochondrial Culex quinquefasciatus
A7NR66 3.78e-42 163 29 16 498 3 fusA Elongation factor G Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q9USZ1 3.82e-42 164 26 13 511 3 mef1 Elongation factor G, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1WVA0 4.12e-42 163 28 15 490 3 fusA Elongation factor G Ligilactobacillus salivarius (strain UCC118)
Q046C7 4.4e-42 163 28 17 488 3 fusA Elongation factor G Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q0CLP3 4.43e-42 164 26 14 493 3 mef1 Elongation factor G, mitochondrial Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A1CHC3 4.76e-42 164 26 12 492 3 mef1 Elongation factor G, mitochondrial Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
C4KZQ0 4.99e-42 163 26 11 475 3 fusA Elongation factor G Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q1DLM0 5.62e-42 164 26 11 487 3 MEF1 Elongation factor G, mitochondrial Coccidioides immitis (strain RS)
P13550 6.42e-42 163 27 13 486 3 fusA Elongation factor G Arthrospira platensis
B0DSK4 6.81e-42 163 26 14 493 3 MEF1 Elongation factor G, mitochondrial Laccaria bicolor (strain S238N-H82 / ATCC MYA-4686)
Q8K0D5 7.17e-42 163 27 9 478 1 Gfm1 Elongation factor G, mitochondrial Mus musculus
B0S0I4 7.17e-42 162 27 10 471 3 fusA Elongation factor G Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q75CZ5 7.64e-42 163 27 12 474 3 MEF1 Elongation factor G, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q7U4D2 8.12e-42 162 26 13 487 3 fusA Elongation factor G Parasynechococcus marenigrum (strain WH8102)
B0TC53 8.18e-42 162 28 15 494 3 fusA Elongation factor G Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B6K286 8.2e-42 163 25 11 488 3 mef1 Elongation factor G, mitochondrial Schizosaccharomyces japonicus (strain yFS275 / FY16936)
Q9Z9L7 8.25e-42 162 26 12 493 3 fusA Elongation factor G Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A3PEZ8 9.37e-42 162 26 14 496 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9301)
A2BT84 9.65e-42 162 25 12 500 3 fusA Elongation factor G Prochlorococcus marinus (strain AS9601)
A8YXK3 1e-41 162 28 15 481 3 fusA Elongation factor G Lactobacillus helveticus (strain DPC 4571)
B9DKV7 1.02e-41 162 27 12 478 3 fusA Elongation factor G Staphylococcus carnosus (strain TM300)
B0SUQ6 1.23e-41 162 26 13 493 3 fusA Elongation factor G Caulobacter sp. (strain K31)
B5ZC32 1.32e-41 162 26 11 479 3 fusA Elongation factor G Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q9ZEU4 1.37e-41 162 26 10 480 3 fusA Elongation factor G Apple proliferation phytoplasma
B1YGU7 1.44e-41 162 27 15 478 3 fusA Elongation factor G Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B9E8Q1 1.5e-41 162 27 15 497 3 fusA Elongation factor G Macrococcus caseolyticus (strain JCSC5402)
B1I1I5 1.54e-41 162 27 10 477 3 fusA Elongation factor G Desulforudis audaxviator (strain MP104C)
Q88XY8 1.8e-41 161 27 15 494 3 fusA Elongation factor G Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B9MB70 1.85e-41 161 27 15 487 3 fusA Elongation factor G Acidovorax ebreus (strain TPSY)
A5GIP1 2.01e-41 161 25 14 508 3 fusA Elongation factor G Synechococcus sp. (strain WH7803)
A8F981 2.08e-41 161 27 16 491 3 fusA Elongation factor G Bacillus pumilus (strain SAFR-032)
A1W2Q4 2.12e-41 161 27 15 487 3 fusA Elongation factor G Acidovorax sp. (strain JS42)
A8G709 2.23e-41 161 26 14 496 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9215)
Q5FM92 2.25e-41 161 27 14 481 3 fusA Elongation factor G Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A2BYN5 2.26e-41 161 25 9 491 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9515)
A5IM80 2.28e-41 161 28 11 478 3 fusA Elongation factor G Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A7IFX8 2.87e-41 161 27 11 478 3 fusA Elongation factor G Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B0UHX2 2.93e-41 160 27 12 490 3 fusA Elongation factor G Methylobacterium sp. (strain 4-46)
Q9PPW7 3e-41 160 26 11 479 3 fusA Elongation factor G Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJG4 3e-41 160 26 11 479 3 fusA Elongation factor G Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A9BHA8 3.17e-41 160 27 15 490 3 fusA Elongation factor G Petrotoga mobilis (strain DSM 10674 / SJ95)
Q5WLR5 3.19e-41 160 26 12 481 3 fusA Elongation factor G Shouchella clausii (strain KSM-K16)
B1LBP3 3.26e-41 160 28 11 478 3 fusA Elongation factor G Thermotoga sp. (strain RQ2)
B6H460 3.39e-41 161 26 12 493 3 mef1 Elongation factor G, mitochondrial Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A5USJ2 3.61e-41 160 28 16 498 3 fusA Elongation factor G Roseiflexus sp. (strain RS-1)
Q890N8 3.73e-41 160 27 16 485 3 fusA Elongation factor G Clostridium tetani (strain Massachusetts / E88)
Q6MU82 3.78e-41 160 26 14 477 3 fusA Elongation factor G Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5NQ66 3.81e-41 160 26 14 554 3 fusA Elongation factor G Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A2CC86 4.1e-41 160 24 9 502 3 fusA Elongation factor G Prochlorococcus marinus (strain MIT 9303)
A8WTI8 4.15e-41 160 26 13 485 3 gfm-1 Elongation factor G, mitochondrial Caenorhabditis briggsae
A6LPQ8 4.54e-41 160 27 14 476 3 fusA Elongation factor G Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C3KVQ4 5.29e-41 160 26 16 502 3 fusA Elongation factor G Clostridium botulinum (strain 657 / Type Ba4)
Q660Y4 5.35e-41 160 24 9 485 3 fusA1 Elongation factor G 1 Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
P74228 5.37e-41 160 27 16 490 3 fusB Elongation factor G 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A5D5I7 5.41e-41 160 27 14 481 3 fusA Elongation factor G Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B9K883 5.43e-41 160 27 9 476 3 fusA Elongation factor G Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11980
Feature type CDS
Gene prfC
Product peptide chain release factor 3
Location 2649499 - 2651088 (strand: -1)
Length 1590 (nucleotides) / 529 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2348
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00009 Elongation factor Tu GTP binding domain
PF16658 Class II release factor RF3, C-terminal domain
PF22042 Elongation factor G domain 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4108 Translation, ribosomal structure and biogenesis (J) J Peptide chain release factor RF-3

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02837 peptide chain release factor 3 - -

Protein Sequence

MANQDFLNEINKRRTFAIISHPDAGKTTITEKVLLFGQAIQRAGTVKGRGSNQHAKSDWMEMEKQRGISITTSVMQFPYADCLVNLLDTPGHEDFSEDTYRTLTAVDCCLMVIDSSKGVEDRTRKLMEVTRLRDTPILTFMNKLDRDIRDPMELMDEVETELKIACSPVTWPIGCGKLFKGVYHILRDETYLYQTGQGHTIQNSRVIKGLDNPELDEAIGDDLAVQLRDELELVLGASHEFDHEAFLAGELTPVFFGTALGNFGVNHMLDGLVKWAPAPMPRQTDMREVTAAEETFTGFVFKIQANMDPKHRDRVAFLRVVSGMYDKGMKLHQVRTKKDVVISDALTFMAGDRSHVEHAYPGDIIGLHNHGTIQIGDTFTQGEMLKFTGIPNFAPELFRRIRLRDPLKQKQLLKGLVQLSEEGAVQVFRPLANNDLIVGAVGVLQFDVVVARLKGEYNVEAIYESVNVSTARWVECSNEKKLEEFKRKNEQHLALDGGDNLTYIAPTMVNLNLTRERYPDIEFHQTREH

Flanking regions ( +/- flanking 50bp)

TACTTCCAAAAGTGTGTACAAATCCGTGTACAAACTAAAAGAATTTATACATGGCAAACCAAGATTTTCTTAATGAAATCAATAAGCGAAGGACCTTTGCTATCATCTCCCACCCCGATGCGGGTAAAACAACCATCACTGAAAAAGTGTTGTTATTCGGACAAGCTATCCAACGTGCAGGAACAGTAAAAGGGCGTGGCTCAAATCAGCATGCTAAATCAGACTGGATGGAAATGGAAAAACAACGTGGTATCTCCATTACCACTTCTGTTATGCAGTTTCCTTACGCTGATTGTCTAGTTAACTTACTTGATACCCCAGGGCACGAAGACTTCTCTGAAGATACTTATCGTACTTTAACTGCCGTTGACTGTTGTTTAATGGTCATTGACTCTTCAAAAGGGGTCGAAGATCGTACCCGTAAATTAATGGAAGTGACTCGATTACGTGATACGCCAATTTTGACCTTTATGAATAAATTGGATCGTGATATTCGTGATCCGATGGAATTAATGGACGAAGTTGAAACTGAGCTAAAAATTGCCTGTAGTCCTGTTACTTGGCCGATTGGCTGTGGAAAACTGTTTAAAGGGGTTTACCATATCTTAAGAGATGAAACCTATCTTTATCAAACAGGCCAAGGTCATACTATCCAAAACTCACGAGTAATCAAAGGGTTGGATAATCCTGAGTTAGATGAAGCGATTGGTGATGATTTAGCCGTTCAATTACGTGATGAGCTAGAGTTGGTGTTAGGTGCATCACATGAGTTTGATCATGAAGCTTTCTTAGCGGGTGAATTGACTCCGGTTTTCTTTGGTACCGCATTAGGTAACTTTGGTGTTAATCACATGCTTGATGGTTTGGTGAAGTGGGCGCCAGCGCCAATGCCTCGTCAAACTGATATGCGAGAAGTGACAGCGGCTGAAGAGACATTCACGGGTTTTGTCTTTAAAATTCAAGCTAATATGGATCCCAAACACCGCGACCGTGTTGCTTTTTTACGGGTGGTGTCAGGCATGTATGATAAAGGGATGAAACTGCACCAAGTACGCACGAAAAAAGATGTGGTGATTTCAGATGCATTGACCTTTATGGCAGGGGATCGTTCTCATGTTGAGCATGCTTATCCTGGTGATATTATTGGCCTGCATAATCACGGTACCATTCAAATTGGTGATACTTTTACTCAAGGTGAAATGTTAAAATTCACCGGTATTCCTAACTTCGCTCCGGAATTATTCCGCCGTATTCGTCTGCGTGATCCGCTAAAACAAAAACAATTGTTAAAAGGTCTGGTGCAATTATCTGAAGAAGGTGCGGTACAGGTGTTTAGACCCCTAGCTAATAATGATTTAATTGTTGGCGCAGTTGGGGTGCTACAGTTTGATGTCGTGGTTGCACGCTTAAAAGGTGAGTATAACGTTGAAGCCATTTATGAATCAGTGAATGTATCGACGGCTCGTTGGGTTGAATGTAGTAACGAAAAGAAACTCGAAGAATTTAAGCGTAAAAATGAGCAACATCTGGCATTAGATGGTGGTGATAACTTAACTTATATTGCACCAACGATGGTTAACTTAAATTTAACCCGTGAACGCTATCCTGATATTGAGTTCCATCAAACGCGTGAACACTAATTTTCTGTTATAAATCATATAAAAAGCCATATTTTTTATGGCTTTTTTCA