Homologs in group_1056

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05980 FBDBKF_05980 68.0 Morganella morganii S1 cdsA phosphatidate cytidylyltransferase
EHELCC_09025 EHELCC_09025 68.0 Morganella morganii S2 cdsA phosphatidate cytidylyltransferase
NLDBIP_09405 NLDBIP_09405 68.0 Morganella morganii S4 cdsA phosphatidate cytidylyltransferase
LHKJJB_08350 LHKJJB_08350 68.0 Morganella morganii S3 cdsA phosphatidate cytidylyltransferase
HKOGLL_07900 HKOGLL_07900 68.0 Morganella morganii S5 cdsA phosphatidate cytidylyltransferase
F4V73_RS15915 F4V73_RS15915 68.3 Morganella psychrotolerans cdsA phosphatidate cytidylyltransferase

Distribution of the homologs in the orthogroup group_1056

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1056

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABG3 3.75e-106 313 56 0 281 3 cdsA Phosphatidate cytidylyltransferase Shigella flexneri
P0ABG1 3.75e-106 313 56 0 281 1 cdsA Phosphatidate cytidylyltransferase Escherichia coli (strain K12)
P0ABG2 3.75e-106 313 56 0 281 3 cdsA Phosphatidate cytidylyltransferase Escherichia coli O157:H7
P44937 3.2e-77 239 47 5 292 3 cdsA Phosphatidate cytidylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q59640 1.52e-55 183 42 5 280 3 cdsA Phosphatidate cytidylyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4L5W3 2.81e-34 128 37 4 232 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q8CST9 4.4e-31 119 35 3 217 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPT0 4.4e-31 119 35 3 217 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A121 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain MW2)
Q6G9V2 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain MSSA476)
Q6GHH4 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain MRSA252)
Q7A5Y4 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain N315)
Q99UL1 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGH0 4.78e-31 119 35 5 220 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus aureus (strain COL)
Q49X46 1.8e-30 118 37 5 218 3 cdsA Phosphatidate cytidylyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O31752 2.24e-27 110 36 0 149 3 cdsA Phosphatidate cytidylyltransferase Bacillus subtilis (strain 168)
P63759 1.06e-21 95 39 3 139 3 cdsA Phosphatidate cytidylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4ULR7 1.28e-21 94 40 2 132 3 cdsA Phosphatidate cytidylyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P9WPF7 1.71e-21 95 39 3 139 1 cdsA Phosphatidate cytidylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPF6 1.71e-21 95 39 3 139 3 cdsA Phosphatidate cytidylyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P76091 1.85e-21 94 47 3 114 3 ynbB Uncharacterized protein YnbB Escherichia coli (strain K12)
Q1RII7 3.54e-21 92 38 2 131 3 cdsA Phosphatidate cytidylyltransferase Rickettsia bellii (strain RML369-C)
Q68WV5 4.13e-21 92 40 2 125 3 cdsA Phosphatidate cytidylyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q92I31 4.97e-21 92 40 2 126 3 cdsA Phosphatidate cytidylyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P73548 2.58e-20 91 45 4 116 3 cdsA Phosphatidate cytidylyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9ZDA8 4.68e-20 89 40 3 133 3 cdsA Phosphatidate cytidylyltransferase Rickettsia prowazekii (strain Madrid E)
O25004 1.67e-19 89 40 4 142 3 cdsA Phosphatidate cytidylyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
Q9X1B7 7.15e-19 87 38 2 135 1 cdsA Phosphatidate cytidylyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9CBU1 2.18e-18 86 39 1 118 3 cdsA Phosphatidate cytidylyltransferase Mycobacterium leprae (strain TN)
Q9ZML7 5.92e-18 84 38 4 142 3 cdsA Phosphatidate cytidylyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
Q9Z7Y6 8.53e-16 79 34 2 138 3 cdsA Phosphatidate cytidylyltransferase Chlamydia pneumoniae
O67292 1.65e-15 77 37 2 124 3 cdsA Phosphatidate cytidylyltransferase Aquifex aeolicus (strain VF5)
Q8YHH2 6.86e-15 76 40 2 138 3 cdsA Phosphatidate cytidylyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8G0E0 2.94e-14 74 40 2 138 3 cdsA Phosphatidate cytidylyltransferase Brucella suis biovar 1 (strain 1330)
P0C102 5.1e-14 73 40 2 138 3 cdsA Phosphatidate cytidylyltransferase Brucella abortus biovar 1 (strain 9-941)
Q2YRP9 5.1e-14 73 40 2 138 3 cdsA Phosphatidate cytidylyltransferase Brucella abortus (strain 2308)
Q94A03 1.31e-13 73 39 1 106 1 CDS4 Phosphatidate cytidylyltransferase 4, chloroplastic Arabidopsis thaliana
Q9PJU1 4.41e-13 71 34 2 147 3 cdsA Phosphatidate cytidylyltransferase Chlamydia muridarum (strain MoPn / Nigg)
O84457 4.45e-13 71 33 1 116 3 cdsA Phosphatidate cytidylyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9M001 1.53e-12 70 39 1 104 1 CDS5 Phosphatidate cytidylyltransferase 5, chloroplastic Arabidopsis thaliana
Q95ZE3 4.84e-08 57 28 4 158 3 CDS1 Phosphatidate cytidylyltransferase Encephalitozoon cuniculi (strain GB-M1)
Q9P381 6.58e-08 56 27 4 172 1 SPBC13A2.03 Putative phosphatidate cytidylyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O04928 1.1e-06 53 28 5 167 1 CDS1 Phosphatidate cytidylyltransferase 1 Arabidopsis thaliana
O95674 2.46e-06 52 24 3 173 1 CDS2 Phosphatidate cytidylyltransferase 2 Homo sapiens
Q1PE48 3.84e-06 51 27 4 167 1 CDS3 Phosphatidate cytidylyltransferase 3 Arabidopsis thaliana
A0JNC1 4.01e-06 51 24 3 173 2 CDS2 Phosphatidate cytidylyltransferase 2 Bos taurus
Q92903 4.68e-06 51 25 5 170 1 CDS1 Phosphatidate cytidylyltransferase 1 Homo sapiens
O35052 4.85e-06 51 25 4 170 1 Cds1 Phosphatidate cytidylyltransferase 1 Rattus norvegicus
P98191 4.98e-06 51 25 4 170 1 Cds1 Phosphatidate cytidylyltransferase 1 Mus musculus
Q99L43 5.25e-06 50 25 3 170 1 Cds2 Phosphatidate cytidylyltransferase 2 Mus musculus
P56079 9.39e-06 50 27 4 167 1 Cds Phosphatidate cytidylyltransferase, photoreceptor-specific Drosophila melanogaster
O49639 9.97e-06 50 27 4 167 1 CDS2 Phosphatidate cytidylyltransferase 2 Arabidopsis thaliana
P53439 1.04e-05 50 26 3 172 3 cdgs-1 Phosphatidate cytidylyltransferase Caenorhabditis elegans
P75160 1.57e-05 49 28 6 148 3 cdsA Putative phosphatidate cytidylyltransferase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
O04940 2.64e-05 48 27 2 167 1 CDS1 Phosphatidate cytidylyltransferase 1 Solanum tuberosum
Q91XU8 8.26e-05 47 26 4 169 1 Cds2 Phosphatidate cytidylyltransferase 2 Rattus norvegicus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11255
Feature type CDS
Gene cdsA
Product phosphatidate cytidylyltransferase
Location 2477900 - 2478763 (strand: -1)
Length 864 (nucleotides) / 287 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1056
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01148 Cytidylyltransferase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0575 Lipid transport and metabolism (I) I CDP-diglyceride synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MLKYRVITALILIPIVIAALFLLPPAGFGLVIIAISGLAGWEWAQFIGWHSQGKRIATGVGFAALLVLMQASLPDFDHLLDTAMIKNSLWAGLFWWVAAILLVVSYPNSANMWKNSVLLKLLFGILTIVPFYCGMMTLRMLGYSTNSYTGAWWLLYVMLLVWAADSGAYAFGRLMGKHKMAPKVSPGKTLEGLVGGLITAGVVSWLFTRFAPITEVPNHLLLISGIVVIVSVFGDLAESMFKRVSGIKDSSQLIPGHGGVLDRIDSLTAAIPVFAGLVFLVSSGFQM

Flanking regions ( +/- flanking 50bp)

TTTCGGTGGTACAACATCGGAAACAGATACTGTAAATCTGGGAGGATAATTTGCTTAAGTATCGTGTCATTACTGCATTAATACTAATCCCTATTGTTATTGCTGCTTTATTTCTTCTTCCTCCCGCAGGATTTGGATTAGTTATTATTGCCATTTCAGGCTTAGCGGGTTGGGAATGGGCTCAATTTATCGGCTGGCATTCTCAAGGTAAACGTATTGCTACAGGTGTTGGATTTGCTGCACTCTTAGTTCTTATGCAAGCCTCGTTACCGGATTTTGATCACCTGCTTGATACAGCAATGATTAAGAATAGCTTATGGGCTGGGCTCTTTTGGTGGGTAGCGGCGATTTTATTAGTTGTCAGTTATCCGAATTCAGCCAATATGTGGAAAAATTCTGTTCTTCTTAAGTTATTGTTCGGTATATTGACGATTGTTCCTTTTTATTGTGGCATGATGACGCTACGTATGTTGGGATATAGCACAAACTCATATACAGGGGCCTGGTGGTTACTGTATGTCATGTTATTGGTTTGGGCTGCGGACTCAGGGGCTTATGCATTTGGCCGTTTAATGGGTAAACATAAAATGGCACCGAAAGTATCACCGGGTAAAACCTTGGAAGGTCTGGTGGGCGGGTTAATCACTGCTGGTGTTGTTTCATGGCTATTTACGCGTTTCGCACCAATTACTGAAGTGCCTAACCATCTATTACTGATTTCGGGCATCGTGGTGATTGTTTCCGTATTCGGCGATCTGGCTGAGAGTATGTTTAAACGTGTTTCTGGCATAAAAGACAGTAGTCAGCTTATCCCTGGGCATGGTGGTGTGCTAGATCGTATTGATAGTTTGACCGCGGCGATCCCTGTTTTCGCTGGATTGGTGTTTTTAGTTTCTTCTGGCTTTCAAATGTAAAGGTAAGCAATGGGTATCCTGTGGAATCTAGCCGCGTTTATTATCGTTTT