Homologs in group_4232

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4232

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4232

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8ANW4 6.06e-94 275 62 2 205 3 cysC Adenylyl-sulfate kinase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83JX9 7.46e-94 275 62 2 205 3 cysC Adenylyl-sulfate kinase Shigella flexneri
B2TZI1 3.16e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3YYB2 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Shigella sonnei (strain Ss046)
Q0T1I1 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Shigella flexneri serotype 5b (strain 8401)
Q32CI0 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Shigella dysenteriae serotype 1 (strain Sd197)
Q31XB2 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Shigella boydii serotype 4 (strain Sb227)
B1LQ71 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain SMS-3-5 / SECEC)
B6I6E0 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain SE11)
B7N6Y0 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6J1 4.9e-93 273 61 2 205 1 cysC Adenylyl-sulfate kinase Escherichia coli (strain K12)
A8A3M9 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O9:H4 (strain HS)
B1XCS6 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain K12 / DH10B)
C4ZZQ4 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXG2 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O8 (strain IAI1)
B5Z3B2 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6J2 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O157:H7
B7LEG8 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain 55989 / EAEC)
A7ZQJ4 4.9e-93 273 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TD42 6.38e-93 273 63 1 200 3 cysC Adenylyl-sulfate kinase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XV31 6.38e-93 273 63 1 200 3 cysC Adenylyl-sulfate kinase Klebsiella pneumoniae (strain 342)
B1IUS9 1.75e-92 271 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LWK5 3.33e-92 271 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R7U1 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli (strain UTI89 / UPEC)
Q8FEJ2 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AEU4 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O1:K1 / APEC
B7MYQ5 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O81 (strain ED1a)
B7NT94 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MKM4 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHG9 4.99e-92 270 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A4WDV5 6.08e-92 270 63 1 200 3 cysC Adenylyl-sulfate kinase Enterobacter sp. (strain 638)
Q8ZBP3 1.78e-91 269 63 1 200 3 cysC Adenylyl-sulfate kinase Yersinia pestis
Q0TEA8 2.31e-91 268 61 2 205 3 cysC Adenylyl-sulfate kinase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7MJ70 5.61e-91 268 61 1 200 3 cysC Adenylyl-sulfate kinase Cronobacter sakazakii (strain ATCC BAA-894)
B2VG00 5.59e-90 265 62 1 200 3 cysC Adenylyl-sulfate kinase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9MF25 3.81e-87 258 60 2 203 3 cysC Adenylyl-sulfate kinase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C0PXB0 6.51e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella paratyphi C (strain RKS4594)
Q57KJ1 6.51e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella choleraesuis (strain SC-B67)
P63889 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63890 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella typhi
B4TTW4 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella schwarzengrund (strain CVM19633)
A9N2D7 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T460 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella newport (strain SL254)
B4TFX0 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella heidelberg (strain SL476)
B5QW21 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella enteritidis PT4 (strain P125109)
B5FTS8 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella dublin (strain CT_02021853)
B5F414 7.5e-87 257 59 2 205 3 cysC Adenylyl-sulfate kinase Salmonella agona (strain SL483)
B5BEY7 1.94e-86 256 58 2 205 3 cysC Adenylyl-sulfate kinase Salmonella paratyphi A (strain AKU_12601)
Q5PEH3 1.94e-86 256 58 2 205 3 cysC Adenylyl-sulfate kinase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDQ6 6.27e-86 255 58 2 205 3 cysC Adenylyl-sulfate kinase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A1U3X8 1.39e-84 251 58 2 201 3 cysC Adenylyl-sulfate kinase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q12QM6 4.11e-82 245 61 3 200 3 cysC Adenylyl-sulfate kinase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A8H0A6 6.79e-80 239 61 2 193 3 cysC Adenylyl-sulfate kinase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0KP33 3.14e-78 235 58 2 195 3 cysC Adenylyl-sulfate kinase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8EQN3 5.55e-78 234 57 2 202 3 cysC Adenylyl-sulfate kinase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B0TTD2 1.28e-77 234 60 2 193 3 cysC Adenylyl-sulfate kinase Shewanella halifaxensis (strain HAW-EB4)
B9DLK2 1.71e-77 233 53 2 203 3 cysC Adenylyl-sulfate kinase Staphylococcus carnosus (strain TM300)
A1S9N4 2.18e-77 233 62 1 177 3 cysC Adenylyl-sulfate kinase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q07Y94 2.9e-77 233 57 2 195 3 cysC Adenylyl-sulfate kinase Shewanella frigidimarina (strain NCIMB 400)
Q9KP21 8.01e-77 232 57 2 199 3 cysC Adenylyl-sulfate kinase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A4SRG6 1.29e-76 231 58 2 196 3 cysC Adenylyl-sulfate kinase Aeromonas salmonicida (strain A449)
Q0HYA3 3.11e-76 230 57 2 193 3 cysC Adenylyl-sulfate kinase Shewanella sp. (strain MR-7)
A0KTI5 3.99e-76 230 57 2 193 3 cysC Adenylyl-sulfate kinase Shewanella sp. (strain ANA-3)
O06735 4.75e-76 230 54 2 203 3 yisZ Probable adenylyl-sulfate kinase Bacillus subtilis (strain 168)
Q0HFM7 5.98e-76 229 57 2 193 3 cysC Adenylyl-sulfate kinase Shewanella sp. (strain MR-4)
Q88X60 6.97e-76 229 56 2 200 3 cysC Adenylyl-sulfate kinase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9KCT0 1.29e-75 229 55 2 196 3 BH1489 Probable adenylyl-sulfate kinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q87SX6 1.45e-75 229 56 2 199 3 cysC Adenylyl-sulfate kinase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1RGG0 1.51e-75 229 57 2 192 3 cysC Adenylyl-sulfate kinase Shewanella sp. (strain W3-18-1)
A4Y9X0 1.51e-75 229 57 2 192 3 cysC Adenylyl-sulfate kinase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EB13 3.22e-75 228 59 1 179 3 cysC Adenylyl-sulfate kinase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6WJU6 5.68e-75 227 57 2 192 3 cysC Adenylyl-sulfate kinase Shewanella baltica (strain OS185)
B8EE63 5.68e-75 227 57 2 192 3 cysC Adenylyl-sulfate kinase Shewanella baltica (strain OS223)
A9L392 1.13e-74 226 57 2 192 3 cysC Adenylyl-sulfate kinase Shewanella baltica (strain OS195)
A3D819 1.83e-74 226 56 2 192 3 cysC Adenylyl-sulfate kinase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q49UM5 4.39e-74 225 54 2 199 3 cysC Adenylyl-sulfate kinase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9M543 9.74e-74 224 54 2 198 3 cysC Adenylyl-sulfate kinase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q7MPF0 1.03e-73 224 61 1 176 3 cysC Adenylyl-sulfate kinase Vibrio vulnificus (strain YJ016)
Q8DE75 1.03e-73 224 61 1 176 3 cysC Adenylyl-sulfate kinase Vibrio vulnificus (strain CMCP6)
Q97MT8 1.34e-72 221 53 3 198 3 cysC Adenylyl-sulfate kinase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7VE24 1.5e-72 221 49 2 201 3 cysC Adenylyl-sulfate kinase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8K9D4 3.7e-72 220 49 1 198 3 cysC Adenylyl-sulfate kinase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A5G863 8.3e-72 219 54 2 197 3 cysC Adenylyl-sulfate kinase Geotalea uraniireducens (strain Rf4)
Q1I2K4 1.13e-71 219 54 2 201 3 cysC Adenylyl-sulfate kinase Pseudomonas entomophila (strain L48)
Q4L9E6 2.74e-71 218 50 2 203 3 cysC Adenylyl-sulfate kinase Staphylococcus haemolyticus (strain JCSC1435)
A7Z4I0 1.64e-70 216 53 2 197 3 cysC Adenylyl-sulfate kinase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8CR04 4.74e-70 214 50 2 202 3 cysC Adenylyl-sulfate kinase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P57497 5.45e-70 214 47 1 201 3 cysC Adenylyl-sulfate kinase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q43295 7.52e-70 217 52 2 197 1 APK1 Adenylyl-sulfate kinase 1, chloroplastic Arabidopsis thaliana
Q5HL02 1.8e-69 213 50 2 202 3 cysC Adenylyl-sulfate kinase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O34577 2.21e-69 213 52 2 198 2 cysC Probable adenylyl-sulfate kinase Bacillus subtilis (strain 168)
A8FD25 3.86e-69 212 52 2 198 3 cysC Adenylyl-sulfate kinase Bacillus pumilus (strain SAFR-032)
Q9K7H6 1e-67 209 53 1 188 3 BH3385 Probable adenylyl-sulfate kinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q65JT8 2.17e-67 207 51 2 199 3 cysC Adenylyl-sulfate kinase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8DJ87 2.51e-67 208 51 2 197 3 cysC Adenylyl-sulfate kinase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A5N960 6.67e-67 206 50 3 194 3 cysC Adenylyl-sulfate kinase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q02196 1.58e-66 206 52 4 202 1 MET14 Adenylyl-sulfate kinase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SRW7 8.81e-66 204 51 3 199 1 APK3 Adenylyl-sulfate kinase 3 Arabidopsis thaliana
Q9HGF8 1.49e-65 203 51 4 202 3 MET14 Adenylyl-sulfate kinase Saccharomyces bayanus
Q9C2Y6 4.5e-65 202 50 4 202 3 MET14 Adenylyl-sulfate kinase Saccharomyces pastorianus
O49196 9.27e-65 204 49 2 201 1 APK2 Adenylyl-sulfate kinase 2, chloroplastic Arabidopsis thaliana
O49204 2.46e-64 204 50 2 199 2 AKN Adenylyl-sulfate kinase, chloroplastic Catharanthus roseus
B0CAX3 3.34e-64 200 52 2 199 3 cysC Adenylyl-sulfate kinase Acaryochloris marina (strain MBIC 11017)
Q9P7G9 1.02e-63 199 50 3 200 3 met14 Adenylyl-sulfate kinase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P72339 3.43e-63 209 55 1 176 3 nodQ Bifunctional enzyme NodQ Rhizobium sp. (strain N33)
B5YJA6 5.79e-63 196 47 2 198 3 cysC Adenylyl-sulfate kinase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q84JF0 6.41e-63 200 53 1 179 1 APK4 Adenylyl-sulfate kinase 4, chloroplastic Arabidopsis thaliana
O07309 2.4e-62 207 56 1 175 3 nodQ Bifunctional enzyme NodQ Rhizobium sp. (strain BR816)
Q7UQW3 4.97e-62 196 49 3 199 3 cysC Adenylyl-sulfate kinase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P13442 6.96e-62 206 53 2 192 3 nodQ Bifunctional enzyme NodQ Rhizobium meliloti (strain 1021)
Q9PD78 1.25e-61 205 52 2 194 3 cysNC Bifunctional enzyme CysN/CysC Xylella fastidiosa (strain 9a5c)
P57702 1.67e-61 192 51 2 184 3 cysC Adenylyl-sulfate kinase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87DG7 1.23e-60 202 52 2 194 3 cysNC Bifunctional enzyme CysN/CysC Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P52978 1.41e-60 202 56 1 175 3 nodQ Bifunctional enzyme NodQ Rhizobium tropici
Q12657 9.06e-60 189 46 4 207 1 None Adenylyl-sulfate kinase Penicillium chrysogenum
Q92203 1e-58 186 49 6 202 3 sD Adenylyl-sulfate kinase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P28604 1.57e-58 196 52 2 186 3 nodQ Bifunctional enzyme NodQ Azospirillum brasilense
Q27128 8.61e-57 192 52 3 180 1 None Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase Urechis caupo
Q5LES5 8.79e-57 181 47 2 190 3 cysC Adenylyl-sulfate kinase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
O43252 3.19e-56 191 53 4 180 1 PAPSS1 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 Homo sapiens
Q60967 3.69e-56 190 53 4 180 1 Papss1 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 Mus musculus
O88428 3.87e-56 190 48 5 205 1 Papss2 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2 Mus musculus
Q64VR1 5.85e-56 179 46 2 190 3 cysC Adenylyl-sulfate kinase Bacteroides fragilis (strain YCH46)
O95340 1.17e-55 189 48 5 205 1 PAPSS2 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2 Homo sapiens
A0A061AE05 1.53e-55 189 49 5 204 1 pps-1 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase pps-1 Caenorhabditis elegans
A6KXG9 1.11e-54 176 49 2 179 3 cysC Adenylyl-sulfate kinase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
O54820 1.81e-54 186 52 3 180 2 PAPSS1 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 Cavia porcellus
Q8AAQ1 5.98e-54 174 47 2 178 3 cysC Adenylyl-sulfate kinase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q0BI00 3.39e-53 171 58 1 156 3 cysC Adenylyl-sulfate kinase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2T3K5 3.94e-52 168 49 4 173 3 cysC Adenylyl-sulfate kinase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B1XN05 2.9e-51 166 47 3 176 3 cysC Adenylyl-sulfate kinase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B7K8N5 1.42e-50 164 48 4 176 3 cysC Adenylyl-sulfate kinase Gloeothece citriformis (strain PCC 7424)
B0JL16 4.99e-50 163 46 5 184 3 cysC Adenylyl-sulfate kinase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q13ZJ7 6.43e-50 162 47 3 173 3 cysC Adenylyl-sulfate kinase Paraburkholderia xenovorans (strain LB400)
B7K5B1 1.24e-49 162 52 2 155 3 cysC Adenylyl-sulfate kinase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q2JUC0 2.69e-49 161 51 3 154 3 cysC Adenylyl-sulfate kinase Synechococcus sp. (strain JA-3-3Ab)
P72940 5.33e-49 160 50 2 155 1 cysC Probable adenylyl-sulfate kinase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WNM5 2.25e-48 169 49 2 178 1 cysNC Bifunctional enzyme CysN/CysC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNM4 2.25e-48 169 49 2 178 3 cysNC Bifunctional enzyme CysN/CysC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8D0S4 3.48e-48 158 45 3 177 3 cysC Adenylyl-sulfate kinase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q2JLM3 8.49e-48 157 51 3 154 3 cysC Adenylyl-sulfate kinase Synechococcus sp. (strain JA-2-3B'a(2-13))
P29811 8.24e-47 156 51 2 156 3 None Probable adenylyl-sulfate kinase Pseudomonas aeruginosa
B9LKC1 7.12e-45 150 47 4 178 3 cysC Adenylyl-sulfate kinase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
O67174 3.33e-44 157 46 3 178 1 sat/cysC Probable bifunctional SAT/APS kinase Aquifex aeolicus (strain VF5)
Q1IYI1 6.76e-44 147 45 3 176 3 cysC Adenylyl-sulfate kinase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
C1CVW7 8.24e-41 139 42 3 177 3 cysC Adenylyl-sulfate kinase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
P56861 1.18e-40 139 42 4 184 3 cysC Adenylyl-sulfate kinase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A9ENT2 1.4e-40 148 47 4 176 3 sat1/cysC1 Probable bifunctional SAT/APS kinase 1 Sorangium cellulosum (strain So ce56)
Q1D6P1 2.68e-40 138 46 3 155 3 cysC Adenylyl-sulfate kinase Myxococcus xanthus (strain DK1622)
A9G7W0 3.41e-40 147 45 3 174 3 sat2/cysC2 Probable bifunctional SAT/APS kinase 2 Sorangium cellulosum (strain So ce56)
Q9YCR6 1.09e-36 129 40 3 161 1 cysC Probable adenylyl-sulfate kinase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P56858 5.71e-35 124 41 2 158 3 cysC Probable adenylyl-sulfate kinase Pyrococcus abyssi (strain GE5 / Orsay)
A1D858 1.93e-34 131 37 3 191 3 met3 Sulfate adenylyltransferase Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4WWN8 2.13e-34 131 37 3 191 3 met3 Sulfate adenylyltransferase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7UMW2 2.21e-34 131 38 2 183 3 cysNC Bifunctional enzyme CysN/CysC Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
O29953 2.3e-34 122 42 2 153 3 cysC Probable adenylyl-sulfate kinase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q6CFD2 4.44e-32 124 37 3 190 3 MET3 Sulfate adenylyltransferase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q12555 5.02e-30 119 38 3 191 3 met3 Sulfate adenylyltransferase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8NJN1 1.02e-29 118 38 3 191 3 met3 Sulfate adenylyltransferase Aspergillus niger
P56862 2.55e-29 117 37 3 194 3 met3 Sulfate adenylyltransferase Aspergillus terreus
Q1EAF9 4.4e-29 116 42 2 167 3 MET3 Sulfate adenylyltransferase Coccidioides immitis (strain RS)
Q0CC19 4.87e-29 116 37 3 191 3 met3 Sulfate adenylyltransferase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q8NK83 5.52e-29 116 38 3 190 3 met3 Sulfate adenylyltransferase Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2H454 5.74e-29 115 38 3 189 3 MET3 Sulfate adenylyltransferase Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A1CJC1 6.61e-29 115 37 3 191 3 met3 Sulfate adenylyltransferase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q12650 3.2e-28 114 38 3 187 1 met3 Sulfate adenylyltransferase Penicillium chrysogenum
Q7SE75 1.18e-27 112 35 3 189 3 cys-11 Sulfate adenylyltransferase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4I1N3 1.69e-25 106 40 3 167 3 MET3 Sulfate adenylyltransferase Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
O50274 1.06e-24 103 35 4 186 3 cysNC Bifunctional enzyme CysN/CysC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0V6P9 1.37e-24 103 37 3 187 3 MET3 Sulfate adenylyltransferase Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q8J0I4 1.55e-24 103 39 2 167 3 MET3 Sulfate adenylyltransferase Mucor circinelloides f. lusitanicus
Q4P460 1.76e-24 103 38 3 192 3 MET3 Sulfate adenylyltransferase Ustilago maydis (strain 521 / FGSC 9021)
Q8TG24 1.48e-23 100 33 4 193 2 MET3 Sulfate adenylyltransferase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
P0CN04 4.73e-23 99 33 4 193 3 MET3 Sulfate adenylyltransferase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CN05 4.73e-23 99 33 4 193 3 MET3 Sulfate adenylyltransferase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q0P8J9 1.78e-16 76 32 5 152 1 Cj1415c Cytidine diphosphoramidate kinase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11055
Feature type CDS
Gene cysC
Product adenylyl-sulfate kinase
Location 2432613 - 2433227 (strand: -1)
Length 615 (nucleotides) / 204 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4232
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF01583 Adenylylsulphate kinase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0529 Inorganic ion transport and metabolism (P) P Adenylylsulfate kinase or related kinase

Kegg Ortholog Annotation(s)

Protein Sequence

MTIHQDIVWHPHQIGLKEREAQQVHKGCVLWFTGLSGSGKSTLADALEQTLYQYSTLHAPIRTYLLDGDNLRHGLCHDLGFSEQDRHENIRRVGEVAKLMVDAGLIVLTAFISPYQQDRQQVRERFAQGRFIEIFVDTPLALCEARDPKGLYQKARRGEIKQFSGIDSPYEPPTAPEIHLDGSLAINELTQQILAYLQQQQIYR

Flanking regions ( +/- flanking 50bp)

CGCCGCCATTTTCCGCATTGGGGCGCAAGAGACTTACTGGGAGGAAAATAGTGACGATACATCAAGATATTGTCTGGCATCCTCATCAAATAGGGTTAAAAGAGCGTGAAGCACAACAGGTACACAAAGGATGTGTACTTTGGTTTACTGGGTTATCTGGCTCAGGTAAATCAACACTGGCTGATGCGCTAGAGCAAACCTTATATCAGTACTCGACACTCCATGCGCCTATCCGCACCTATTTATTAGATGGTGATAATCTACGCCATGGTTTATGCCATGATCTTGGGTTTAGTGAACAAGATAGGCATGAAAATATTCGCCGTGTAGGGGAAGTGGCTAAACTAATGGTCGATGCCGGATTAATTGTCTTAACAGCATTTATTTCTCCTTATCAGCAAGATAGACAACAAGTAAGAGAAAGGTTTGCTCAAGGGCGATTTATTGAGATCTTTGTTGATACACCTTTAGCCCTTTGTGAAGCACGTGATCCTAAAGGCCTCTATCAAAAAGCACGACGAGGAGAGATCAAACAGTTTTCCGGCATTGATTCACCTTATGAACCACCCACTGCGCCAGAAATTCATTTAGACGGCTCACTCGCGATTAATGAGCTTACACAACAAATCCTCGCTTATTTACAGCAACAACAAATTTACCGCTAATCATATCTCTACATCATTTTCTCTTATCTGGGAAAATATGTAGGGATAGA