Homologs in group_286

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06720 FBDBKF_06720 27.5 Morganella morganii S1 dps DNA starvation/stationary phase protection protein Dps
EHELCC_04250 EHELCC_04250 27.5 Morganella morganii S2 dps DNA starvation/stationary phase protection protein Dps
NLDBIP_04250 NLDBIP_04250 27.5 Morganella morganii S4 dps DNA starvation/stationary phase protection protein Dps
LHKJJB_10080 LHKJJB_10080 27.5 Morganella morganii S3 dps DNA starvation/stationary phase protection protein Dps
HKOGLL_08895 HKOGLL_08895 27.5 Morganella morganii S5 dps DNA starvation/stationary phase protection protein Dps
F4V73_RS00875 F4V73_RS00875 26.9 Morganella psychrotolerans dps DNA starvation/stationary phase protection protein Dps
PMI_RS03110 PMI_RS03110 26.8 Proteus mirabilis HI4320 dps DNA starvation/stationary phase protection protein Dps

Distribution of the homologs in the orthogroup group_286

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_286

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A3A7 1.11e-18 82 35 2 135 3 all0458 Uncharacterized low temperature-induced protein all0458 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0A3A8 1.11e-18 82 35 2 135 3 None Uncharacterized low temperature-induced protein all0458 homolog Anabaena variabilis
P37960 4.12e-18 80 32 1 137 1 mrgA Metalloregulation DNA-binding stress protein Bacillus subtilis (strain 168)
P73321 5.24e-18 79 29 2 144 1 mrgA Protein MrgA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8UCK6 1.66e-15 73 33 0 149 1 dps DNA protection during starvation protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9RS64 1.47e-14 72 28 0 145 1 dps1 DNA protection during starvation protein 1 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P45173 2.11e-13 67 27 1 154 1 HI_1349 Uncharacterized protein HI_1349 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8RPQ2 2.13e-13 67 30 3 143 1 dps2 DNA protection during starvation protein 2 Bacillus anthracis
P43313 2.31e-12 64 25 0 128 1 dps DNA protection during starvation protein Helicobacter pylori (strain ATCC 700392 / 26695)
P83695 2.4e-12 64 29 1 137 1 dps DNA protection during starvation protein Brevibacillus brevis
P16665 5.57e-12 64 25 0 129 1 tpf1 Antigen TpF1 Treponema pallidum (strain Nichols)
P17915 5.62e-12 64 25 0 129 3 None Antigen TyF1 Treponema pallidum subsp. pertenue
Q9ZMJ1 1.61e-11 62 25 0 128 3 dps DNA protection during starvation protein Helicobacter pylori (strain J99 / ATCC 700824)
P0C935 1.08e-10 60 25 1 147 2 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
C6DEE2 1.74e-10 60 27 1 151 3 dps DNA protection during starvation protein Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q8RPQ1 5.74e-10 58 26 2 138 1 dps1 DNA protection during starvation protein 1 Bacillus anthracis
Q6D3H7 7.12e-10 58 27 1 151 3 dps DNA protection during starvation protein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2RMG0 9.07e-10 58 25 1 147 1 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q6FCX7 2.01e-09 57 28 1 149 3 dps DNA protection during starvation protein Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0P891 5.31e-09 55 24 0 128 1 dps DNA protection during starvation protein Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7MEY6 1.08e-08 55 27 2 172 3 dps DNA protection during starvation protein Cronobacter sakazakii (strain ATCC BAA-894)
Q8FJM0 1.13e-08 55 27 2 172 3 dps DNA protection during starvation protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9HMP7 4.02e-08 53 45 0 59 1 dps DNA protection during starvation protein Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B2VBZ3 5.4e-08 53 26 2 172 3 dps DNA protection during starvation protein Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6Y1R6 7.1e-08 53 26 2 177 3 dps DNA protection during starvation protein Proteus hauseri
P29714 7.21e-08 52 28 3 122 3 None Uncharacterized protein in bpoA2 5'region (Fragment) Kitasatospora aureofaciens
Q3Z3X3 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Shigella sonnei (strain Ss046)
P0ABT4 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Shigella flexneri
Q32I91 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Shigella dysenteriae serotype 1 (strain Sd197)
Q323Y1 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Shigella boydii serotype 4 (strain Sb227)
B2TVB6 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6XZR0 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Kluyvera cryocrescens
B7LMB6 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1REB2 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain UTI89 / UPEC)
B1LMA4 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain SMS-3-5 / SECEC)
B6I7W9 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain SE11)
B7NAB2 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABT2 9.42e-08 52 26 2 172 1 dps DNA protection during starvation protein Escherichia coli (strain K12)
B1IXF6 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TJN6 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZY70 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O9:H4 (strain HS)
B1X7E2 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / DH10B)
C4ZXY4 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / MC4100 / BW2952)
B7M787 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O8 (strain IAI1)
B7MQR6 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O81 (strain ED1a)
B7NNP4 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSA4 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABT3 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O157:H7
B7LC95 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli (strain 55989 / EAEC)
B7MGS0 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UM08 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJM7 9.42e-08 52 26 2 172 3 dps DNA protection during starvation protein Escherichia coli O139:H28 (strain E24377A / ETEC)
A4W8F0 1.78e-07 52 28 4 172 3 dps DNA protection during starvation protein Enterobacter sp. (strain 638)
Q84FI1 2.36e-07 51 26 2 172 3 dps DNA protection during starvation protein Enterobacter cloacae
Q2NUI3 2.81e-07 51 27 2 158 3 dps DNA protection during starvation protein Sodalis glossinidius (strain morsitans)
Q84FI0 4.16e-07 50 26 2 172 3 dps DNA protection during starvation protein Klebsiella pneumoniae
P0CB53 4.27e-07 50 22 3 161 1 dps DNA protection during starvation protein Streptococcus suis
C5VZF1 4.27e-07 50 22 3 161 3 dps DNA protection during starvation protein Streptococcus suis (strain P1/7)
Q84AP1 9.02e-07 50 27 1 151 3 dps DNA protection during starvation protein Citrobacter freundii
A8AIW9 9.29e-07 50 28 4 172 3 dps DNA protection during starvation protein Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q7CQV9 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF78 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella typhi
B4TQX5 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella schwarzengrund (strain CVM19633)
B5BBZ6 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain AKU_12601)
C0PX17 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella paratyphi C (strain RKS4594)
A9MST4 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PG12 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T089 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella newport (strain SL254)
B4TC86 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella heidelberg (strain SL476)
B5R797 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXT6 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella enteritidis PT4 (strain P125109)
B5FP96 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella dublin (strain CT_02021853)
Q57RC9 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella choleraesuis (strain SC-B67)
B5F0B0 1.24e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella agona (strain SL483)
Q84AP0 1.32e-06 49 26 2 172 3 dps DNA protection during starvation protein Serratia marcescens
A9MIS0 1.57e-06 49 28 4 172 3 dps DNA protection during starvation protein Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P80879 1.96e-06 48 23 2 141 1 dps General stress protein 20U Bacillus subtilis (strain 168)
A6T6Q6 2.71e-06 48 25 2 172 3 dps DNA protection during starvation protein Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYT2 2.71e-06 48 25 2 172 3 dps DNA protection during starvation protein Klebsiella pneumoniae (strain 342)
Q8YQL3 1.66e-05 46 22 0 148 3 dpsA Nutrient stress-induced DNA-binding protein Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A8GBU5 1.78e-05 46 24 3 173 3 dps DNA protection during starvation protein Serratia proteamaculans (strain 568)
P0C558 3.21e-05 45 26 1 145 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis
A0R692 3.21e-05 45 26 1 145 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9KWH3 3.47e-05 45 23 1 142 1 dps DNA protection during starvation protein Streptococcus mutans
B1JHA1 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669E1 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLZ3 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pestis (strain Pestoides F)
Q1CHU6 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6H6 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Angola)
Q7CJ65 4.22e-05 45 28 3 148 1 dps DNA protection during starvation protein Yersinia pestis
B2K7Y0 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6F4 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGU7 4.22e-05 45 28 3 148 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q47953 0.000373 43 38 0 60 1 ftpA Fine tangled pili major subunit Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1JU34 0.000715 42 25 1 133 3 dps DNA protection during starvation protein Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08845
Feature type CDS
Gene -
Product DNA starvation/stationary phase protection protein
Location 1934432 - 1934986 (strand: 1)
Length 555 (nucleotides) / 184 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_286
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00210 Ferritin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0783 Inorganic ion transport and metabolism (P)
Defense mechanisms (V)		 PV DNA-binding ferritin-like protein (oxidative damage protectant)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04047 starvation-inducible DNA-binding protein - -

Protein Sequence

MSSKKLTPAEVNDAHKLQTRPLSTPTDLAPKATKEVSAAMNAILADVFALYLKTKNFHWHVSGPHFRDYHLMLDEQGDQLFAMTDPIAERVRKIGGMTLRSIGQISKMQRIKDNDAEFVEPLDMLAELCQDNQLLAAELRKAHVVCDENNDISTASLIENWIDETERRTWFLFEACRRAETSGH

Flanking regions ( +/- flanking 50bp)

TACGATGTTGTTCTCTCAATAATACTTTTTCGATTTATTAGGAGATGAAAATGAGCAGTAAAAAACTAACCCCTGCTGAAGTTAATGATGCACATAAACTCCAAACCCGTCCTCTATCTACCCCTACAGATTTAGCACCTAAAGCAACAAAAGAAGTTAGTGCAGCGATGAATGCTATTCTTGCGGATGTGTTTGCTTTATATCTAAAAACAAAGAACTTCCACTGGCATGTGAGCGGTCCTCATTTTCGTGACTATCATCTAATGTTAGATGAACAAGGTGATCAGCTCTTTGCCATGACAGATCCTATTGCCGAGCGTGTACGTAAAATTGGTGGCATGACATTACGCTCTATAGGCCAGATCTCAAAAATGCAACGTATTAAAGATAATGATGCTGAATTTGTTGAACCTTTAGATATGTTAGCTGAGCTATGTCAAGATAATCAATTACTTGCAGCAGAACTGAGAAAAGCACATGTTGTCTGTGATGAAAATAACGATATTTCTACCGCAAGCTTAATTGAAAATTGGATCGATGAAACAGAGCGTCGTACTTGGTTCTTATTTGAAGCTTGTCGACGTGCAGAAACATCAGGGCACTAATTAATCTATTTGCTAGCTATGTGACTATTTTGGCAGGGATCCCCCCTGCC