Homologs in group_1909

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14230 FBDBKF_14230 77.7 Morganella morganii S1 ubiX Flavin prenyltransferase UbiX
EHELCC_08050 EHELCC_08050 77.7 Morganella morganii S2 ubiX Flavin prenyltransferase UbiX
NLDBIP_08375 NLDBIP_08375 77.7 Morganella morganii S4 ubiX Flavin prenyltransferase UbiX
LHKJJB_05890 LHKJJB_05890 77.7 Morganella morganii S3 ubiX Flavin prenyltransferase UbiX
HKOGLL_05025 HKOGLL_05025 77.7 Morganella morganii S5 ubiX Flavin prenyltransferase UbiX
F4V73_RS02680 F4V73_RS02680 78.8 Morganella psychrotolerans - UbiX family flavin prenyltransferase

Distribution of the homologs in the orthogroup group_1909

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1909

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AG03 4.16e-107 307 75 0 188 2 ubiX Flavin prenyltransferase UbiX Escherichia coli (strain K12)
P0AG04 4.16e-107 307 75 0 188 3 ubiX Flavin prenyltransferase UbiX Escherichia coli O157:H7
P0A245 6.3e-105 302 75 0 188 3 ubiX Flavin prenyltransferase UbiX Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A246 6.3e-105 302 75 0 188 3 ubiX Flavin prenyltransferase UbiX Salmonella typhi
P57767 1.31e-82 246 61 2 188 3 ubiX Flavin prenyltransferase UbiX Thauera aromatica
P69772 4.86e-70 214 56 1 191 1 ecdB Probable UbiX-like flavin prenyltransferase Escherichia coli O157:H7
Q9ZD09 1.65e-69 212 55 2 181 3 ubiX Flavin prenyltransferase UbiX Rickettsia prowazekii (strain Madrid E)
P69774 3.32e-69 212 55 1 191 3 ecdB Probable UbiX-like flavin prenyltransferase Escherichia coli
Q9X696 6.55e-68 209 57 0 177 2 vdcB Probable UbiX-like flavin prenyltransferase Streptomyces sp. (strain D7)
P69773 7.64e-68 208 54 1 191 3 ecdB Probable UbiX-like flavin prenyltransferase Escherichia coli O111:H-
F9UT67 6.42e-65 201 51 1 189 2 lpdB Flavin prenyltransferase LpdB Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9JW78 3.73e-62 194 48 2 188 3 ubiX Flavin prenyltransferase UbiX Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JXP4 6.03e-62 193 48 2 188 3 ubiX Flavin prenyltransferase UbiX Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P94404 8.07e-62 193 51 2 186 1 bsdB Probable UbiX-like flavin prenyltransferase Bacillus subtilis (strain 168)
Q4R101 1.05e-61 192 44 1 188 2 shdB Probable UbiX-like flavin prenyltransferase Sedimentibacter hydroxybenzoicus
P33751 6.65e-60 190 50 2 189 1 PAD1 Flavin prenyltransferase PAD1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O29054 2.59e-56 179 46 2 184 1 ubiX Flavin prenyltransferase UbiX Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q57566 4.24e-53 171 45 2 184 1 ubiX Flavin prenyltransferase UbiX Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9RR91 3.98e-51 166 42 2 188 3 ubiX Flavin prenyltransferase UbiX Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9HJ72 6.66e-48 157 45 2 184 3 ubiX Flavin prenyltransferase UbiX Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
O58742 5.94e-46 152 45 3 184 3 ubiX Flavin prenyltransferase UbiX Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P94300 4.43e-45 150 43 6 196 3 ubiX Flavin prenyltransferase UbiX Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q9V030 6.16e-44 147 41 3 187 3 ubiX Flavin prenyltransferase UbiX Pyrococcus abyssi (strain GE5 / Orsay)
O26250 1.2e-43 147 42 2 188 3 ubiX Flavin prenyltransferase UbiX Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9KCC2 1.16e-40 139 41 5 191 3 ubiX Flavin prenyltransferase UbiX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P72743 2.9e-40 139 40 6 204 3 ubiX Flavin prenyltransferase UbiX Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9HX08 4.67e-38 133 38 4 199 1 ubiX Flavin prenyltransferase UbiX Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KP38 5.91e-37 130 37 5 208 3 ubiX Flavin prenyltransferase UbiX Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9Y8K8 3.43e-36 128 38 4 190 3 ubiX Flavin prenyltransferase UbiX Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O66811 8.81e-36 126 35 5 192 1 ubiX Flavin prenyltransferase UbiX Aquifex aeolicus (strain VF5)
Q9Z8S4 5.11e-35 125 34 5 201 3 ubiX Flavin prenyltransferase UbiX Chlamydia pneumoniae
Q9PKH2 2.62e-31 115 38 4 193 3 ubiX Flavin prenyltransferase UbiX Chlamydia muridarum (strain MoPn / Nigg)
Q9ZJE3 3.84e-29 109 33 4 189 3 ubiX Flavin prenyltransferase UbiX Helicobacter pylori (strain J99 / ATCC 700824)
O26011 9.28e-29 108 33 4 189 3 ubiX Flavin prenyltransferase UbiX Helicobacter pylori (strain ATCC 700392 / 26695)
O84222 6.83e-28 106 33 4 196 1 ubiX Flavin prenyltransferase UbiX Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9PPF1 1.86e-27 105 32 4 190 3 ubiX Flavin prenyltransferase UbiX Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9KYP1 8.99e-26 101 33 3 209 3 ubiX Flavin prenyltransferase UbiX Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9YBF0 1.86e-25 100 31 4 189 3 ubiX Flavin prenyltransferase UbiX Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08740
Feature type CDS
Gene -
Product UbiX family flavin prenyltransferase
Location 1912127 - 1912708 (strand: -1)
Length 582 (nucleotides) / 193 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1909
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02441 Flavoprotein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0163 Coenzyme transport and metabolism (H) H Flavin prenyltransferase UbiX

Kegg Ortholog Annotation(s)

Protein Sequence

MKKLIVGLTGASGAIYGIRLLEILKSVPTVETHLVISQAARRTISLETDYSLKDIHALADIIYDDRDIGATISSGSFRVNGMVILPCSIKSLSGIVHSYTDTLVTRAADVVLKEGRKLVLCVRETPLHLGHLRLMTQAAELGAIIMPPVPAFYFQPKTIDDIVNQTVNRVLDQFDIDLPDDLFQRWQGDKPAR

Flanking regions ( +/- flanking 50bp)

AGGGTTAATCATCATAATGATTAACAAAGATATATATTCTGAGGATTATAATGAAAAAGCTGATTGTCGGGCTAACAGGTGCCAGTGGCGCAATTTATGGTATTCGTTTATTAGAAATACTTAAATCCGTGCCAACCGTAGAAACTCACTTGGTGATCAGTCAAGCGGCGCGTCGTACCATTTCATTAGAAACGGATTATTCTCTCAAAGATATTCATGCTTTAGCTGATATTATTTATGACGATCGAGATATAGGGGCGACTATCTCTTCAGGCTCGTTTCGGGTCAATGGTATGGTTATTTTACCTTGTTCGATTAAAAGCCTCTCCGGTATTGTACATAGCTATACTGATACGTTAGTGACACGTGCCGCTGATGTCGTGTTAAAAGAAGGACGTAAATTAGTGCTATGTGTACGCGAAACACCGTTACATTTAGGGCACTTACGTTTAATGACTCAAGCTGCTGAGCTTGGTGCCATCATTATGCCACCAGTACCTGCATTTTATTTTCAGCCTAAAACGATCGATGACATTGTTAATCAGACAGTAAATCGAGTGCTTGATCAATTTGACATTGACTTGCCGGATGATCTTTTTCAGCGTTGGCAAGGGGATAAACCTGCCCGTTGATCCCCTGTGTGACGAGTGACTATTTTTTATGGCGAATAATATCTTCTAAA