Homologs in group_1655

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10995 FBDBKF_10995 61.8 Morganella morganii S1 psiE phosphate-starvation-inducible protein PsiE
EHELCC_05230 EHELCC_05230 61.8 Morganella morganii S2 psiE phosphate-starvation-inducible protein PsiE
NLDBIP_05550 NLDBIP_05550 61.8 Morganella morganii S4 psiE phosphate-starvation-inducible protein PsiE
LHKJJB_02430 LHKJJB_02430 61.8 Morganella morganii S3 psiE phosphate-starvation-inducible protein PsiE
HKOGLL_15810 HKOGLL_15810 61.8 Morganella morganii S5 psiE phosphate-starvation-inducible protein PsiE
F4V73_RS08230 F4V73_RS08230 58.8 Morganella psychrotolerans psiE phosphate-starvation-inducible protein PsiE

Distribution of the homologs in the orthogroup group_1655

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1655

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C5B6Z4 3.16e-55 172 64 0 134 3 psiE Protein PsiE homolog Edwardsiella ictaluri (strain 93-146)
A1JRV7 4e-53 166 64 1 137 3 psiE Protein PsiE homolog Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JJM9 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q664X0 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNS3 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pestis bv. Antiqua (strain Nepal516)
A9R535 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAS3 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pestis
B2K4Y4 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CC26 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pestis bv. Antiqua (strain Antiqua)
A7FDG9 1.35e-52 165 63 1 137 3 psiE Protein PsiE homolog Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TH40 2.33e-52 164 63 1 137 3 psiE Protein PsiE homolog Yersinia pestis (strain Pestoides F)
C6DBD8 3.38e-52 164 66 0 124 3 psiE Protein PsiE homolog Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D2A1 3.57e-52 164 66 0 124 3 psiE Protein PsiE homolog Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GKC9 9.34e-49 155 64 1 137 3 psiE Protein PsiE homolog Serratia proteamaculans (strain 568)
A4W5E5 1.09e-48 155 61 2 138 3 psiE Protein PsiE homolog Enterobacter sp. (strain 638)
Q72Y02 1.02e-45 148 59 1 125 3 psiE Protein PsiE homolog Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HBH8 1.24e-45 147 59 1 125 3 psiE Protein PsiE homolog Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81XB6 1.24e-45 147 59 1 125 3 psiE Protein PsiE homolog Bacillus anthracis
A6TGU1 1.39e-43 142 56 1 137 3 psiE Protein PsiE homolog Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q0SXP7 1.07e-42 140 62 2 138 3 psiE Protein PsiE Shigella flexneri serotype 5b (strain 8401)
B7NFX5 1.76e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3YUV5 1.84e-41 137 62 2 138 3 psiE Protein PsiE Shigella sonnei (strain Ss046)
P0A7D0 1.84e-41 137 62 2 138 3 psiE Protein PsiE Shigella flexneri
Q328Y4 1.84e-41 137 62 2 138 3 psiE Protein PsiE Shigella dysenteriae serotype 1 (strain Sd197)
B7LL03 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LPJ6 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain SMS-3-5 / SECEC)
B6I5P4 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain SE11)
P0A7C8 1.84e-41 137 62 2 138 1 psiE Protein PsiE Escherichia coli (strain K12)
B1IUM1 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A7C9 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA30 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A7D0 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O9:H4 (strain HS)
B1XC29 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain K12 / DH10B)
C5A0W8 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7U2 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O8 (strain IAI1)
B7N2N9 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O81 (strain ED1a)
B7NRZ5 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LAX3 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain 55989 / EAEC)
B7UPJ2 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZUQ1 1.84e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R3Q5 2.41e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli (strain UTI89 / UPEC)
A1AIK9 2.41e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O1:K1 / APEC
B7MJ22 2.41e-41 137 62 2 138 3 psiE Protein PsiE Escherichia coli O45:K1 (strain S88 / ExPEC)
B5Z171 3.57e-41 136 61 2 138 3 psiE Protein PsiE Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5X8 3.57e-41 136 61 2 138 3 psiE Protein PsiE Escherichia coli O157:H7
A9MHA2 3.99e-41 136 62 1 137 3 psiE Protein PsiE Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TQP3 4.45e-41 136 62 1 137 3 psiE Protein PsiE Salmonella schwarzengrund (strain CVM19633)
B5BJU9 4.45e-41 136 61 1 137 3 psiE Protein PsiE Salmonella paratyphi A (strain AKU_12601)
Q5PL02 4.45e-41 136 61 1 137 3 psiE Protein PsiE Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QYI9 4.45e-41 136 62 1 137 3 psiE Protein PsiE Salmonella enteritidis PT4 (strain P125109)
B5F1P5 4.45e-41 136 62 1 137 3 psiE Protein PsiE Salmonella agona (strain SL483)
P0A279 4.91e-41 136 63 2 138 2 psiE Protein PsiE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A280 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella typhi
C0Q4D1 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella paratyphi C (strain RKS4594)
A9N1K2 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T1S0 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella newport (strain SL254)
B4TDK9 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella heidelberg (strain SL476)
B5FQQ0 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella dublin (strain CT_02021853)
Q57H01 4.91e-41 136 63 2 138 3 psiE Protein PsiE Salmonella choleraesuis (strain SC-B67)
B5R7S5 1.43e-40 135 61 1 137 3 psiE Protein PsiE Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5XY00 1.82e-40 134 58 1 136 3 psiE Protein PsiE homolog Klebsiella pneumoniae (strain 342)
Q813A6 1.03e-35 122 51 1 123 3 psiE Protein PsiE homolog Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0AGW6 8.76e-35 120 55 0 134 3 psiE Protein PsiE homolog Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8Y8Q9 8.76e-35 120 55 0 134 3 psiE Protein PsiE homolog Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q721Y1 8.76e-35 120 55 0 134 3 psiE Protein PsiE homolog Listeria monocytogenes serotype 4b (strain F2365)
C1L1A5 8.76e-35 120 55 0 134 3 psiE Protein PsiE homolog Listeria monocytogenes serotype 4b (strain CLIP80459)
B8DGC6 2.19e-34 119 55 0 134 3 psiE Protein PsiE homolog Listeria monocytogenes serotype 4a (strain HCC23)
Q92DI5 2.19e-34 119 55 0 134 3 psiE Protein PsiE homolog Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4QMJ5 6.17e-33 115 50 2 132 3 psiE Protein PsiE homolog Haemophilus influenzae (strain 86-028NP)
A7Z6Z1 1.1e-31 112 46 2 135 3 psiE Protein PsiE homolog Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P54445 9.38e-28 102 45 2 135 3 psiE Protein PsiE homolog Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07860
Feature type CDS
Gene psiE
Product phosphate-starvation-inducible protein PsiE
Location 1720723 - 1721136 (strand: -1)
Length 414 (nucleotides) / 137 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1655
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06146 Phosphate-starvation-inducible E family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3223 General function prediction only (R) R Phosphate starvation-inducible membrane PsiE (function unknown)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13256 protein PsiE - -

Protein Sequence

MRKSSEELLKCIATILQWVLNCGLLILAIVLVSFLIKETYVIASLLFNLAAEESSYQLLEGILIYFLYFEFIALIVKYFLSGGHFPLRYFIYIGITAIVRLIIVEHKDSVDTLIQSGAILLLVIALFIANTEKLKRS

Flanking regions ( +/- flanking 50bp)

TTACTATCATTATTTGTTATCAATAAATGATAACCTTAGGTTATAAAGCTATGAGAAAATCAAGCGAAGAATTATTAAAATGTATTGCAACAATATTACAATGGGTGCTGAATTGCGGATTACTTATTCTAGCCATCGTATTAGTCAGTTTTTTGATCAAAGAAACTTATGTTATCGCCTCTTTATTATTTAACTTAGCTGCTGAAGAATCTTCTTATCAGTTATTAGAAGGAATTTTGATCTACTTCCTCTATTTTGAGTTTATCGCATTGATTGTAAAATATTTTTTATCCGGTGGTCATTTCCCTTTAAGGTATTTTATTTATATAGGTATTACAGCTATTGTGCGTCTGATTATTGTTGAACATAAAGACTCGGTAGATACTTTGATTCAGTCCGGTGCCATTTTATTGCTCGTTATCGCGTTATTTATTGCAAATACCGAAAAATTAAAACGAAGCTAACCGAATAACAATATGTCAACAATGCATTGAAATGGTCTCTGTGCATTAAG