Homologs in group_3696

Help

3 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
PMI_RS02015 PMI_RS02015 23.2 Proteus mirabilis HI4320 - TonB-dependent hemoglobin/transferrin/lactoferrin family receptor
PMI_RS06895 PMI_RS06895 38.3 Proteus mirabilis HI4320 - TonB-dependent receptor
PMI_RS07535 PMI_RS07535 20.9 Proteus mirabilis HI4320 - TonB-dependent receptor

Distribution of the homologs in the orthogroup group_3696

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3696

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56989 0.0 759 55 5 648 3 hmuR Hemin receptor Yersinia pestis
P31499 0.0 751 54 6 682 2 hemR Hemin receptor Yersinia enterocolitica
P44600 2.46e-48 184 26 20 687 1 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45357 1.29e-46 179 25 17 692 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae
Q4QNS6 4.35e-46 177 26 17 677 3 hxuC Heme/hemopexin utilization protein C Haemophilus influenzae (strain 86-028NP)
P44523 1.12e-37 153 23 23 741 3 tdhA TonB-dependent heme receptor A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QP67 2.33e-36 149 23 23 740 3 tdhA TonB-dependent heme receptor A Haemophilus influenzae (strain 86-028NP)
Q7VNU1 6.8e-34 142 23 24 709 2 tdhA TonB-dependent heme receptor A Haemophilus ducreyi (strain 35000HP / ATCC 700724)
D0C8V9 1.66e-15 84 24 25 574 1 pirA Probable TonB-dependent siderophore receptor PirA Acinetobacter baumannii (strain ATCC 19606 / DSM 30007 / JCM 6841 / CCUG 19606 / CIP 70.34 / NBRC 109757 / NCIMB 12457 / NCTC 12156 / 81)
Q8DD41 3.03e-12 73 36 4 122 3 btuB Vitamin B12 transporter BtuB Vibrio vulnificus (strain CMCP6)
Q9ZA21 3e-11 70 28 6 220 1 hgpA Hemoglobin and hemoglobin-haptoglobin-binding protein A Haemophilus influenzae
Q9ZA21 2.25e-07 58 30 7 173 1 hgpA Hemoglobin and hemoglobin-haptoglobin-binding protein A Haemophilus influenzae
Q2YJB2 3.2e-11 70 24 19 497 1 bhuA Heme transporter BhuA Brucella abortus (strain 2308)
Q8FUN0 4.72e-11 69 24 19 497 3 bhuA Heme transporter BhuA Brucella suis biovar 1 (strain 1330)
Q47952 5.07e-11 70 26 7 226 1 hgbA Hemoglobin and hemoglobin-haptoglobin-binding protein Haemophilus ducreyi (strain 35000HP / ATCC 700724)
E1W8M5 5.1e-11 69 23 16 442 3 foxA Ferrioxamine B receptor Salmonella typhimurium (strain SL1344)
Q48153 5.22e-11 70 28 5 202 3 hhuA Hemoglobin-haptoglobin-binding protein A Haemophilus influenzae
Q48153 1.41e-05 52 27 8 173 3 hhuA Hemoglobin-haptoglobin-binding protein A Haemophilus influenzae
P0C6R0 6.96e-11 69 31 4 161 3 irgA Iron-regulated outer membrane virulence protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F9G0 8.06e-11 68 31 4 161 3 irgA Iron-regulated outer membrane virulence protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8YDS0 9.93e-11 68 24 19 497 3 bhuA Heme transporter BhuA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P0CL48 9.99e-11 68 23 16 442 3 foxA Ferrioxamine B receptor Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q576D7 1.03e-10 68 24 19 497 3 bhuA Heme transporter BhuA Brucella abortus biovar 1 (strain 9-941)
Q7MQ42 1.28e-10 68 33 3 127 3 btuB Vitamin B12 transporter BtuB Vibrio vulnificus (strain YJ016)
A5VW32 3.72e-10 67 24 19 497 3 bhuA Heme transporter BhuA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P44970 5.65e-10 66 24 6 229 3 tbpA Transferrin-binding protein A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A4WG45 9.88e-10 65 22 26 634 3 btuB Vitamin B12 transporter BtuB Enterobacter sp. (strain 638)
P05825 1.63e-09 65 32 5 132 1 fepA Ferrienterobactin receptor Escherichia coli (strain K12)
O52903 1.65e-09 64 27 9 232 3 btuB Vitamin B12 transporter BtuB Citrobacter freundii
Q93SE0 2.49e-09 64 25 24 479 3 btuB Vitamin B12 transporter BtuB Escherichia coli
Q57408 2.75e-09 64 26 7 204 3 HI_1565/HI_1567 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 4 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JWA2 4.79e-09 63 29 4 151 3 hpuB Hemoglobin-haptoglobin utilization protein B Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P96949 5.4e-09 63 29 4 151 3 hpuB Hemoglobin-haptoglobin utilization protein B Neisseria meningitidis serogroup C
P44809 6.26e-09 63 25 6 204 1 HI_0661 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44809 4.41e-06 53 29 9 221 1 HI_0661 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MYE3 7.49e-09 62 23 20 468 3 btuB Vitamin B12 transporter BtuB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C3LPZ6 8.74e-09 62 36 4 121 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain M66-2)
Q9KVI9 8.74e-09 62 36 4 121 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4P6 8.74e-09 62 36 4 121 3 btuB Vitamin B12 transporter BtuB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8Z314 1.35e-08 61 28 5 159 3 btuB Vitamin B12 transporter BtuB Salmonella typhi
O87296 1.54e-08 62 24 6 220 3 hgpB Hemoglobin and hemoglobin-haptoglobin-binding protein B Haemophilus influenzae
O87296 6.91e-07 56 29 9 221 3 hgpB Hemoglobin and hemoglobin-haptoglobin-binding protein B Haemophilus influenzae
P17315 2.1e-08 61 31 6 158 1 cirA Colicin I receptor Escherichia coli (strain K12)
Q8X714 2.25e-08 61 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O157:H7
A7ZUI6 2.89e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YV10 2.94e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Shigella sonnei (strain Ss046)
P06129 2.94e-08 60 26 10 235 1 btuB Vitamin B12 transporter BtuB Escherichia coli (strain K12)
A8A774 2.94e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O9:H4 (strain HS)
Q0SY25 2.96e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Shigella flexneri serotype 5b (strain 8401)
Q83IS4 3.04e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Shigella flexneri
Q1R3U1 3.09e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli (strain UTI89 / UPEC)
Q8CVJ0 3.09e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AIE8 3.09e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O1:K1 / APEC
Q0TA90 3.2e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P37409 3.55e-08 60 28 6 161 3 btuB Vitamin B12 transporter BtuB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PK67 3.64e-08 60 28 6 161 3 btuB Vitamin B12 transporter BtuB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57H87 3.64e-08 60 28 6 161 3 btuB Vitamin B12 transporter BtuB Salmonella choleraesuis (strain SC-B67)
Q06379 4e-08 60 28 7 231 2 lbpA Lactoferrin-binding protein A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q32AE6 4.88e-08 60 26 10 235 3 btuB Vitamin B12 transporter BtuB Shigella dysenteriae serotype 1 (strain Sd197)
Q9I527 5.36e-08 60 36 3 108 1 pirA Ferric enterobactin receptor PirA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A7ML93 8.65e-08 59 33 3 118 3 btuB Vitamin B12 transporter BtuB Cronobacter sakazakii (strain ATCC BAA-894)
Q66G57 8.79e-08 59 34 4 116 3 btuB Vitamin B12 transporter BtuB Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FD14 8.79e-08 59 34 4 116 3 btuB Vitamin B12 transporter BtuB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TRG0 1.05e-07 58 36 2 84 3 btuB Vitamin B12 transporter BtuB Yersinia pestis (strain Pestoides F)
Q1CNP0 1.05e-07 58 36 2 84 3 btuB Vitamin B12 transporter BtuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAA1 1.05e-07 58 36 2 84 3 btuB Vitamin B12 transporter BtuB Yersinia pestis
Q1CBU1 1.05e-07 58 36 2 84 3 btuB Vitamin B12 transporter BtuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q9JTK4 1.25e-07 58 29 6 197 3 lbpA Lactoferrin-binding protein A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6CZB5 1.62e-07 58 35 2 102 3 btuB Vitamin B12 transporter BtuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q01674 1.86e-07 58 30 5 138 3 foxA Ferrioxamine receptor Yersinia enterocolitica
Q9K0U9 2.27e-07 58 25 5 226 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q01996 2.27e-07 58 25 6 264 3 tbpA Transferrin-binding protein A Neisseria gonorrhoeae
Q9X442 4e-07 57 27 3 157 3 hgpC Hemoglobin and hemoglobin-haptoglobin-binding protein C Haemophilus influenzae
Q9X442 0.000214 48 38 1 67 3 hgpC Hemoglobin and hemoglobin-haptoglobin-binding protein C Haemophilus influenzae
Q9KIV1 4.36e-07 57 27 4 170 3 hgbB Hemoglobin and hemoglobin-haptoglobin-binding protein B Haemophilus influenzae
Q9KIV1 2.62e-05 51 30 4 130 3 hgbB Hemoglobin and hemoglobin-haptoglobin-binding protein B Haemophilus influenzae
P44836 4.42e-07 57 28 4 160 1 HI_0712 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 3 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44836 6.23e-05 50 40 1 67 1 HI_0712 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 3 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q06987 5.11e-07 57 27 6 190 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B
Q09056 5.25e-07 57 25 5 228 1 tbp1 Transferrin-binding protein A Neisseria meningitidis serogroup B
Q05098 5.36e-07 56 27 5 172 1 pfeA Ferric enterobactin receptor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q05098 3.93e-05 50 24 19 353 1 pfeA Ferric enterobactin receptor Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44795 7.53e-07 56 27 4 170 1 HI_0635 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44795 1.02e-05 52 31 5 160 1 HI_0635 Probable hemoglobin and hemoglobin-haptoglobin-binding protein 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KIV0 8.77e-07 56 26 7 223 3 hgbC Hemoglobin-binding protein C Haemophilus influenzae
Q9KIV0 0.000633 47 25 6 189 3 hgbC Hemoglobin-binding protein C Haemophilus influenzae
Q8YZR0 1.06e-06 55 27 18 305 1 schT Schizokinen transporter SchT Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6U607 3.2e-06 54 23 13 312 1 iutA Ferric aerobactin receptor Klebsiella pneumoniae
Q9KIV2 6.79e-06 53 27 9 234 3 hgbA Hemoglobin-binding protein A Haemophilus influenzae
Q9KIV2 4.33e-05 50 26 7 205 3 hgbA Hemoglobin-binding protein A Haemophilus influenzae
D0CAH3 1.56e-05 52 25 5 159 1 piuA Probable TonB-dependent siderophore receptor PiuA Acinetobacter baumannii (strain ATCC 19606 / DSM 30007 / JCM 6841 / CCUG 19606 / CIP 70.34 / NBRC 109757 / NCIMB 12457 / NCTC 12156 / 81)
P14542 1.82e-05 52 22 13 312 1 iutA Ferric aerobactin receptor Escherichia coli
A7MXY8 9.39e-05 49 32 4 121 3 btuB Vitamin B12 transporter BtuB Vibrio campbellii (strain ATCC BAA-1116)
Q87KN9 0.000124 48 24 22 470 3 btuB Vitamin B12 transporter BtuB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P46359 0.000184 48 30 5 130 1 fyuA Pesticin receptor Yersinia pestis
P06971 0.00022 48 26 5 119 1 fhuA Ferrichrome outer membrane transporter/phage receptor Escherichia coli (strain K12)
P0C2M9 0.000246 48 30 5 130 2 fyuA Pesticin receptor Yersinia enterocolitica
A1JTG3 0.000256 48 30 5 130 3 fyuA Pesticin receptor Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P75780 0.000715 46 33 3 102 1 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain K12)
Q8X7W7 0.000715 46 33 3 102 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O157:H7
Q1REC0 0.000752 46 33 3 102 3 fiu Catecholate siderophore receptor Fiu Escherichia coli (strain UTI89 / UPEC)
Q8CW90 0.000759 46 33 3 102 3 fiu Catecholate siderophore receptor Fiu Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06900
Feature type CDS
Gene -
Product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor
Location 1509649 - 1511691 (strand: 1)
Length 2043 (nucleotides) / 680 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3696
Orthogroup size 4
N. genomes 1

Actions

Genomic region

Domains

PF00593 TonB dependent receptor-like, beta-barrel
PF07715 TonB-dependent Receptor Plug Domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4771 Inorganic ion transport and metabolism (P) P Outer membrane receptor for ferrienterochelin and colicins

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K16087 hemoglobin/transferrin/lactoferrin receptor protein - -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044291 TonB-dependent hemoglobin/transferrin/lactoferrin family receptor VF1253 Nutritional/Metabolic factor

Protein Sequence

MSQSSRCIKVSVLVVATAISSAFAENKNQIYGEKNSGERNTQIITVYATGNERDSFTLPMMSTVIKNNSALTETAGSATELLRHIPGISISGAGRTNGETISMRGYSSNGVLTLVDGIRQGTDTGHIDSIFVDPLLIKQVEVVRGPSALLYGSGALGGVVAYDTVDASDLLAKNEHGGVRVTALGNTAQQSQGFGITAFGQQDNFDGLLALSARDKGTTRYGGGYRAQNDETIINLLSKGRWFIDDSNTLSGQLRYYHNNAQQPKDPQLANNPTPANVATNRTTTQKDAQLTYQYHPSDMSWINLKTQAYYSEVDINAKTQQKGFEGREQKTYGIKIENRTQLATYPFAAHALTYGGEIYKQKQSPSANAESFPKADIRFMSGWLQDEMTLRDVPISFIVGTRFDKYSSQNDRYDDISADKWSSKGAVSITPTDWLMLYTSYAQAFRAPTIGEMYNDAKHFDAPFPGAPTNYWRPNPNLKPETNSTTEYGFGFQFDDLLSNNDNLKIKAAHFNTRAKDYIDTDVAIFQGYTQSTNIPRATIWGWDIEMNYQSKFFSWDLAYNHTKGKDNASNASITSIEPDTLTSRLDIPVPNSDFSVGWVGQFTKKTDFTKHDRFNRPTNRQQAGYGVNDFYLRYEGSASLTGLTTSLVLGNAFDKKYYSSAGIPQEGRNAKVLVSYQW

Flanking regions ( +/- flanking 50bp)

AACGGGCTGTTGAGTTTAGCAGCCCATTTTAATAACGGAGATCGACCTGTATGTCTCAATCATCGCGATGCATAAAGGTGAGTGTTTTAGTTGTTGCAACAGCGATTAGCAGTGCATTCGCTGAAAATAAAAATCAAATCTATGGAGAAAAAAATAGCGGGGAGAGAAACACACAAATAATAACGGTTTATGCAACAGGTAACGAGCGAGATAGCTTTACATTACCAATGATGTCGACCGTCATAAAAAATAACAGTGCTTTGACAGAAACGGCTGGAAGTGCCACGGAGTTGTTGCGTCATATACCGGGCATTTCAATATCAGGAGCTGGCCGCACAAACGGTGAAACTATCAGTATGCGTGGCTACAGTAGTAACGGTGTTTTGACACTAGTAGATGGCATACGCCAAGGTACTGATACAGGTCATATTGACAGTATTTTTGTCGATCCTCTACTCATTAAACAAGTTGAAGTGGTTCGTGGCCCTTCAGCACTTTTATATGGAAGCGGTGCCCTCGGTGGGGTTGTGGCATATGATACCGTTGATGCCAGCGACTTGCTTGCAAAAAATGAACATGGTGGTGTGCGTGTTACAGCCCTTGGTAATACGGCACAACAGAGTCAAGGATTTGGCATTACCGCTTTTGGTCAACAAGACAATTTCGATGGATTACTCGCCCTCTCCGCTCGTGATAAAGGTACAACTCGCTATGGAGGCGGTTATCGTGCGCAAAACGATGAAACAATCATTAACTTATTATCTAAAGGACGTTGGTTTATTGATGATAGCAATACGTTAAGTGGCCAATTACGCTATTATCATAACAACGCACAACAGCCTAAGGATCCACAACTCGCCAATAACCCAACACCGGCTAATGTAGCGACAAATCGTACTACAACACAAAAAGATGCACAGTTAACCTATCAATATCATCCTAGTGATATGTCATGGATTAACCTAAAAACACAAGCCTATTACAGCGAGGTAGATATTAATGCGAAAACACAACAAAAAGGATTTGAAGGTAGAGAGCAAAAAACCTATGGCATTAAAATTGAAAATCGCACTCAATTAGCCACCTACCCCTTTGCTGCTCACGCTTTAACTTATGGCGGTGAGATCTATAAGCAAAAGCAATCACCCAGTGCAAATGCCGAAAGCTTCCCTAAAGCAGATATTCGTTTTATGTCAGGCTGGTTACAAGATGAAATGACTTTACGTGATGTACCCATTTCATTCATCGTCGGTACAAGGTTTGATAAATATAGCAGTCAAAATGATCGTTATGATGACATCAGCGCTGATAAATGGTCATCAAAAGGAGCCGTTAGTATTACACCCACAGATTGGTTAATGCTTTATACCTCTTATGCTCAAGCTTTTAGAGCACCAACAATTGGCGAGATGTATAACGATGCTAAACATTTTGATGCCCCATTCCCCGGAGCACCAACCAATTACTGGCGCCCTAACCCTAATTTAAAGCCCGAAACCAATTCAACAACTGAATACGGGTTCGGTTTTCAATTCGACGACTTATTATCTAATAATGATAATCTGAAAATTAAAGCTGCCCATTTCAATACGCGTGCAAAAGATTATATTGATACAGATGTCGCTATTTTTCAGGGATATACACAATCGACGAATATTCCAAGAGCAACTATTTGGGGTTGGGATATCGAGATGAATTATCAATCGAAGTTCTTTAGTTGGGATTTGGCTTATAACCATACAAAAGGAAAAGATAATGCCAGTAATGCCTCTATTACCTCTATTGAGCCAGATACATTAACCAGTCGCCTCGATATTCCCGTACCCAATAGTGATTTTTCCGTAGGTTGGGTGGGACAATTTACTAAAAAAACAGATTTTACAAAACATGATCGCTTTAATCGCCCGACCAATCGCCAACAAGCGGGTTATGGTGTCAATGATTTCTACCTCCGTTATGAAGGTAGTGCTTCATTAACAGGGCTAACAACCTCACTGGTACTGGGTAATGCATTTGATAAAAAATACTACTCTTCTGCGGGTATTCCTCAAGAGGGGCGCAATGCAAAAGTACTGGTGAGTTATCAATGGTAATTAACAATAAAATAAACGAAACAATAGGAGTTTCCGTGACTAAACCTCTT