Homologs in group_4446

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4446

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4446

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05975
Feature type CDS
Gene -
Product pyridoxamine 5'-phosphate oxidase family protein
Location 1311426 - 1312043 (strand: 1)
Length 618 (nucleotides) / 205 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4446
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF01243 Pyridoxamine 5'-phosphate oxidase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3576 General function prediction only (R) R Predicted flavin-nucleotide-binding protein, pyridoxine 5'-phosphate oxidase superfamily

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07006 uncharacterized protein - -

Protein Sequence

MKNTIVKDLKTLEEIYGQPAEPSVLKEVDFIHPLYRPYIEATPFVALATYSADGMDVSPRGDEPGFIHIEDDHTLLLPDRRGNNRIDSMRNLLINPAIALLVLVPGINETLRINGHAEILIDEETLARFKYNNALPRSVLRIHVERVFFQCGRALIRSGLWENKYLADKSTIPAPGQILKSISHQQFDGDKYDAQLPERIMKTLY

Flanking regions ( +/- flanking 50bp)

CGAAATTTGTATATGATGAAGAATGAGCTAAATGATAACAAGGCCACCTTATGAAAAATACCATTGTAAAAGATCTGAAAACACTGGAAGAGATTTATGGTCAACCTGCCGAACCATCGGTCTTAAAAGAAGTGGATTTTATTCACCCCCTTTATCGCCCTTATATTGAAGCTACACCATTTGTTGCATTAGCCACTTATAGTGCTGATGGTATGGATGTTTCTCCTCGTGGCGATGAGCCAGGTTTTATTCATATTGAAGACGATCATACTTTATTATTACCCGATAGACGTGGTAATAACCGCATTGATAGCATGCGCAATTTGTTAATTAATCCCGCGATTGCTTTATTAGTGCTAGTCCCCGGCATTAATGAAACATTACGAATTAATGGTCATGCGGAAATTTTAATAGATGAAGAAACACTCGCACGCTTTAAATATAACAATGCACTACCTCGCTCTGTCTTGCGCATCCATGTTGAGCGCGTATTTTTCCAATGTGGTAGGGCACTTATTCGTTCAGGTTTGTGGGAAAACAAATATTTAGCTGATAAATCAACTATTCCAGCACCGGGACAAATATTGAAATCCATTTCTCATCAACAATTTGATGGTGATAAATATGATGCACAATTGCCTGAACGTATTATGAAAACATTATATTAATCATATAGTTTGCTCTTTTTATATTAACATTTGCTAAAAAGAGCAAGAAA