Homologs in group_1954

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14660 FBDBKF_14660 74.6 Morganella morganii S1 nagZ beta-N-acetylhexosaminidase
EHELCC_15465 EHELCC_15465 74.6 Morganella morganii S2 nagZ beta-N-acetylhexosaminidase
NLDBIP_15995 NLDBIP_15995 74.6 Morganella morganii S4 nagZ beta-N-acetylhexosaminidase
LHKJJB_15845 LHKJJB_15845 74.6 Morganella morganii S3 nagZ beta-N-acetylhexosaminidase
HKOGLL_14965 HKOGLL_14965 74.6 Morganella morganii S5 nagZ beta-N-acetylhexosaminidase
F4V73_RS07455 F4V73_RS07455 74.6 Morganella psychrotolerans nagZ beta-N-acetylhexosaminidase

Distribution of the homologs in the orthogroup group_1954

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1954

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EVE7 0.0 701 100 0 339 3 nagZ Beta-hexosaminidase Proteus mirabilis (strain HI4320)
Q7N397 0.0 534 75 0 339 3 nagZ Beta-hexosaminidase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DKR8 0.0 521 74 1 336 3 nagZ Beta-hexosaminidase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D674 0.0 517 73 1 336 3 nagZ Beta-hexosaminidase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JI47 0.0 514 74 1 335 3 nagZ Beta-hexosaminidase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FH41 0.0 514 74 1 335 3 nagZ Beta-hexosaminidase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8ZFS3 0.0 511 74 1 335 3 nagZ Beta-hexosaminidase Yersinia pestis
Q669N5 0.0 511 74 1 335 3 nagZ Beta-hexosaminidase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K731 0.0 511 74 1 335 3 nagZ Beta-hexosaminidase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A1JME4 0.0 510 74 1 335 3 nagZ Beta-hexosaminidase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P75949 0.0 510 72 1 337 1 nagZ Beta-hexosaminidase Escherichia coli (strain K12)
B1XA17 0.0 510 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain K12 / DH10B)
C4ZS47 0.0 510 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain K12 / MC4100 / BW2952)
B5XXG4 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Klebsiella pneumoniae (strain 342)
Q8ZQ06 0.0 508 73 1 337 1 nagZ Beta-hexosaminidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TTH9 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella schwarzengrund (strain CVM19633)
A9N5J6 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T3P6 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella newport (strain SL254)
B4TFI4 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella heidelberg (strain SL476)
B5RB93 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXC7 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella enteritidis PT4 (strain P125109)
B5FK98 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella dublin (strain CT_02021853)
Q57QE6 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella choleraesuis (strain SC-B67)
B5F8E5 0.0 508 73 1 337 3 nagZ Beta-hexosaminidase Salmonella agona (strain SL483)
B1LI37 0.0 508 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain SMS-3-5 / SECEC)
B7NAY5 0.0 508 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NKH2 0.0 508 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8Z7I6 0.0 507 73 1 337 3 nagZ Beta-hexosaminidase Salmonella typhi
Q5PGT0 0.0 507 73 1 337 3 nagZ Beta-hexosaminidase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A7ZKL1 0.0 507 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7UCW4 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Shigella flexneri
Q1RD47 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain UTI89 / UPEC)
B6I9I5 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain SE11)
B7LX41 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O8 (strain IAI1)
B7LG40 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain 55989 / EAEC)
B7MJ94 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1IUF8 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZ65 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O9:H4 (strain HS)
B7MTN7 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O81 (strain ED1a)
B7UPC3 0.0 506 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32EW7 7.09e-180 504 72 1 337 3 nagZ Beta-hexosaminidase Shigella dysenteriae serotype 1 (strain Sd197)
B5YVX6 1.06e-179 503 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58067 1.06e-179 503 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O157:H7
A7MFT1 1.4e-179 503 72 1 336 3 nagZ Beta-hexosaminidase Cronobacter sakazakii (strain ATCC BAA-894)
B7LT32 2.1e-179 503 72 1 337 3 nagZ Beta-hexosaminidase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1AA01 2.5e-179 503 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O1:K1 / APEC
Q8FIN2 3.62e-179 502 72 1 337 3 nagZ Beta-hexosaminidase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q31ZG4 3.83e-179 502 72 1 337 3 nagZ Beta-hexosaminidase Shigella boydii serotype 4 (strain Sb227)
B2U513 3.83e-179 502 72 1 337 3 nagZ Beta-hexosaminidase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z310 5.66e-178 499 72 1 337 3 nagZ Beta-hexosaminidase Shigella sonnei (strain Ss046)
B2VDM3 4.68e-175 492 70 1 335 3 nagZ Beta-hexosaminidase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BFM6 6.97e-164 463 67 1 337 3 nagZ Beta-hexosaminidase Edwardsiella ictaluri (strain 93-146)
Q9CPH0 4.88e-137 395 55 3 343 3 nagZ Beta-hexosaminidase Pasteurella multocida (strain Pm70)
P96157 1.12e-134 389 57 3 331 1 nagZ Beta-hexosaminidase Vibrio furnissii
B8F5N0 2.29e-134 389 57 4 338 3 nagZ Beta-hexosaminidase Glaesserella parasuis serovar 5 (strain SH0165)
B0BQ51 1.64e-131 381 55 4 340 3 nagZ Beta-hexosaminidase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXZ7 2.62e-131 381 55 4 340 3 nagZ Beta-hexosaminidase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1B7 2.62e-131 381 55 4 340 3 nagZ Beta-hexosaminidase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C3LSU7 1.45e-130 379 54 3 337 3 nagZ Beta-hexosaminidase Vibrio cholerae serotype O1 (strain M66-2)
Q9KU37 1.45e-130 379 54 3 337 1 nagZ Beta-hexosaminidase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F8Y1 3.44e-130 377 54 3 335 3 nagZ Beta-hexosaminidase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C4LEY6 7.21e-130 377 55 4 337 3 nagZ Beta-hexosaminidase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LJ30 2.32e-129 375 53 4 339 3 nagZ Beta-hexosaminidase Photobacterium profundum (strain SS9)
A6VKU4 7.42e-129 375 53 3 345 3 nagZ Beta-hexosaminidase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0UTC6 2.39e-124 363 52 3 344 3 nagZ Beta-hexosaminidase Histophilus somni (strain 2336)
P44955 2.45e-124 363 52 2 343 3 nagZ Beta-hexosaminidase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I414 4.67e-124 363 52 3 344 3 nagZ Beta-hexosaminidase Histophilus somni (strain 129Pt)
A1SW90 6.59e-124 362 52 2 338 3 nagZ Beta-hexosaminidase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q4QLU8 1.36e-123 362 53 2 343 3 nagZ Beta-hexosaminidase Haemophilus influenzae (strain 86-028NP)
A5UDA9 1.86e-122 358 53 2 343 3 nagZ Beta-hexosaminidase Haemophilus influenzae (strain PittEE)
Q65VK7 2.47e-122 358 52 3 344 3 nagZ Beta-hexosaminidase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q7VNI8 2.53e-119 350 52 3 338 3 nagZ Beta-hexosaminidase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5QUZ5 1.22e-110 328 50 3 332 3 nagZ Beta-hexosaminidase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A0KXK3 3.08e-108 322 50 3 342 3 nagZ Beta-hexosaminidase Shewanella sp. (strain ANA-3)
Q0HJG7 5.08e-108 322 50 3 342 3 nagZ Beta-hexosaminidase Shewanella sp. (strain MR-4)
B8GSD2 1.59e-107 320 50 6 341 3 nagZ Beta-hexosaminidase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q8EEW2 1.23e-104 313 49 3 342 3 nagZ Beta-hexosaminidase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3J953 1.42e-104 313 48 5 339 3 nagZ Beta-hexosaminidase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0HVQ8 2.15e-104 312 49 3 342 3 nagZ Beta-hexosaminidase Shewanella sp. (strain MR-7)
Q080R9 2.94e-99 299 47 3 328 3 nagZ Beta-hexosaminidase Shewanella frigidimarina (strain NCIMB 400)
Q2KXM7 1.06e-96 293 46 5 336 3 nagZ Beta-hexosaminidase Bordetella avium (strain 197N)
Q0A911 2.45e-96 292 45 5 340 3 nagZ Beta-hexosaminidase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1H075 4.69e-96 291 47 6 322 3 nagZ Beta-hexosaminidase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q3SKU2 2.32e-95 290 46 6 345 3 nagZ Beta-hexosaminidase Thiobacillus denitrificans (strain ATCC 25259)
Q82SJ8 6.95e-95 288 44 5 339 3 nagZ Beta-hexosaminidase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9HZK0 7.42e-95 288 49 5 333 1 nagZ Beta-hexosaminidase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PG9 7.42e-95 288 49 5 333 3 nagZ Beta-hexosaminidase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYS5 7.42e-95 288 49 5 333 3 nagZ Beta-hexosaminidase Pseudomonas aeruginosa (strain LESB58)
Q0AF74 2.15e-94 287 43 6 340 3 nagZ Beta-hexosaminidase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q606N2 1.69e-92 282 46 6 338 3 nagZ Beta-hexosaminidase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9JVT3 1.84e-92 283 50 3 283 3 nagZ Beta-hexosaminidase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7NWB7 1.91e-92 282 49 3 295 3 nagZ Beta-hexosaminidase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2Y863 4.25e-92 281 46 4 313 3 nagZ Beta-hexosaminidase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5P081 4.55e-92 281 51 4 294 3 nagZ Beta-hexosaminidase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7W9J5 8.95e-92 281 46 5 338 3 nagZ Beta-hexosaminidase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH65 8.95e-92 281 46 5 338 3 nagZ Beta-hexosaminidase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B4RQ67 1.57e-91 280 49 3 283 3 nagZ Beta-hexosaminidase Neisseria gonorrhoeae (strain NCCP11945)
A1KSD9 1.21e-90 278 49 3 283 3 nagZ Beta-hexosaminidase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9K0Q4 1.79e-90 278 49 3 283 3 nagZ Beta-hexosaminidase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5FA94 8.51e-90 276 49 3 283 1 nagZ Beta-hexosaminidase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7VWV8 2.15e-89 275 45 6 338 3 nagZ Beta-hexosaminidase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9M1Z4 7.36e-89 273 49 3 283 3 nagZ Beta-hexosaminidase Neisseria meningitidis serogroup C (strain 053442)
Q31G32 8.19e-87 268 42 6 330 3 nagZ Beta-hexosaminidase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B2FPW9 1.64e-78 246 46 2 279 3 nagZ Beta-hexosaminidase Stenotrophomonas maltophilia (strain K279a)
B4SRK3 3.13e-78 245 45 2 279 3 nagZ Beta-hexosaminidase Stenotrophomonas maltophilia (strain R551-3)
Q9PAZ0 4.51e-70 224 41 4 314 3 nagZ Beta-hexosaminidase Xylella fastidiosa (strain 9a5c)
Q5H1Q0 6.35e-69 221 41 4 314 3 nagZ Beta-hexosaminidase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q87BR5 1.15e-68 221 41 4 314 3 nagZ Beta-hexosaminidase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6G9 1.15e-68 221 41 4 314 3 nagZ Beta-hexosaminidase Xylella fastidiosa (strain M23)
Q2P4L0 1.41e-68 221 41 4 314 3 nagZ Beta-hexosaminidase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PB42 1.89e-68 220 43 2 279 3 nagZ Beta-hexosaminidase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RX17 1.89e-68 220 43 2 279 3 nagZ Beta-hexosaminidase Xanthomonas campestris pv. campestris (strain B100)
Q4USG7 1.89e-68 220 43 2 279 3 nagZ Beta-hexosaminidase Xanthomonas campestris pv. campestris (strain 8004)
Q8PMU1 2.01e-68 220 43 2 279 3 nagZ Beta-hexosaminidase Xanthomonas axonopodis pv. citri (strain 306)
Q3BVU6 5.85e-68 219 43 2 279 3 nagZ Beta-hexosaminidase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0U3L0 5.66e-67 216 40 4 314 3 nagZ Beta-hexosaminidase Xylella fastidiosa (strain M12)
P48823 7.16e-34 134 30 5 286 1 cht60 Beta-hexosaminidase A Pseudoalteromonas piscicida
P40406 1.24e-27 117 28 6 283 1 nagZ Beta-hexosaminidase Bacillus subtilis (strain 168)
D4AQ52 3.22e-24 104 28 11 328 1 ARB_06359 Uncharacterized secreted glycosyl hydrolase ARB_06359 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
L7N6B0 4.29e-20 93 33 13 251 1 lpqI Beta-hexosaminidase LpqI Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H3M1P5 1.22e-19 92 33 13 251 3 lpqI Beta-hexosaminidase LpqI Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7WUL3 1.52e-10 65 23 6 238 1 nag3 Beta-N-acetylglucosaminidase/beta-glucosidase Cellulomonas fimi
Q2UFP8 2.39e-08 58 26 8 230 3 bglC Probable beta-glucosidase C Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B8NGU6 3.89e-08 58 26 8 230 3 bglC Probable beta-glucosidase C Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
T2KMH0 1.77e-07 56 25 7 227 1 BN863_22130 Beta-xylosidase Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P27034 3.33e-07 55 25 5 157 3 cbg-1 Beta-glucosidase Rhizobium radiobacter
Q5BA18 2.34e-05 49 26 7 214 2 bglK Probable beta-glucosidase K Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P07337 4.83e-05 48 27 5 187 3 None Beta-glucosidase Kluyveromyces marxianus
D5EY15 0.000113 47 27 4 129 1 xyl3A Xylan 1,4-beta-xylosidase Xylanibacter ruminicola (strain ATCC 19189 / DSM 19721 / CIP 105475 / JCM 8958 / 23)
Q56078 0.000153 47 25 7 176 3 bglX Periplasmic beta-glucosidase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5BCC6 0.00016 47 24 8 245 1 bglC Beta-glucosidase C Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BFG8 0.00016 47 26 9 199 1 bglB Beta-glucosidase B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4WA69 0.000196 47 26 5 188 3 bglK Probable beta-glucosidase K Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A7LXU3 0.000254 46 25 12 258 1 BACOVA_02659 Beta-glucosidase BoGH3B Bacteroides ovatus (strain ATCC 8483 / DSM 1896 / JCM 5824 / BCRC 10623 / CCUG 4943 / NCTC 11153)
P14002 0.00033 46 24 6 201 1 bglB Thermostable beta-glucosidase B Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5AV15 0.000435 45 24 7 214 3 bglJ Probable beta-glucosidase J Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04285
Feature type CDS
Gene nagZ
Product beta-N-acetylhexosaminidase
Location 960509 - 961528 (strand: 1)
Length 1020 (nucleotides) / 339 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1954
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00933 Glycosyl hydrolase family 3 N terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1472 Carbohydrate transport and metabolism (G) G Periplasmic beta-glucosidase and related glycosidases

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01207 beta-N-acetylhexosaminidase [EC:3.2.1.52] Amino sugar and nucleotide sugar metabolism
Glycosaminoglycan degradation
Metabolic pathways
beta-Lactam resistance		 -

Protein Sequence

MGPVMLDVEGYELDNEEREILKHPLVGGLILFTRNFHDAEQLNELVRQIRDASHERLVIAVDQEGGRVQRFRDGFTRLPAAQSYAALNERYQASRLAQEAGWLMASEMIAMDIDISFAPVLDLGHDCIAIGERSFHECPEIAMDMAESFIKGMRSAGMKSTGKHFPGHGAVRADSHKETPRDERSLNDIRQRDMAIFKDFIQRQLLDAIMPAHVIYSQIDERPASGSPYWLKSILREQLGFQGVIFSDDLSMEGAAIMGSYAQRAQRSLDAGCDMLLVCNNRKGAVSVLDNLSFVKAERISALYHHRGRYTLSELQASDRWKKANQMLTQLQEQWQERA

Flanking regions ( +/- flanking 50bp)

CTGATGAATTGAAAAGATTTTATTATTGCAATAACAAAGAGAGGAATGTTATGGGTCCTGTAATGCTTGATGTTGAAGGATATGAGCTCGATAACGAGGAGCGTGAAATTTTAAAGCATCCCCTTGTTGGTGGTTTGATCCTCTTTACCCGCAACTTCCACGACGCTGAGCAGTTAAATGAATTAGTGCGCCAAATCCGTGATGCTTCCCATGAGCGTTTAGTGATTGCCGTTGACCAAGAAGGAGGGCGAGTACAGCGCTTTCGTGATGGTTTTACTCGCTTACCTGCCGCGCAATCTTATGCTGCGCTTAATGAGCGCTATCAAGCTAGTCGCTTAGCACAAGAGGCCGGTTGGTTAATGGCATCAGAAATGATCGCAATGGATATTGATATTAGCTTTGCTCCTGTCCTAGATCTTGGTCATGACTGTATTGCTATCGGTGAGCGCTCTTTCCATGAGTGTCCAGAAATCGCTATGGATATGGCGGAAAGCTTTATTAAAGGAATGCGCTCTGCAGGTATGAAATCAACAGGTAAGCATTTTCCTGGTCATGGTGCAGTCAGAGCCGATTCCCATAAAGAAACGCCACGTGATGAGCGCTCTTTAAACGATATTCGTCAACGTGATATGGCTATCTTTAAAGATTTTATCCAACGTCAATTATTAGATGCCATTATGCCAGCTCATGTTATTTATTCTCAGATTGATGAGCGTCCAGCAAGTGGCTCTCCTTATTGGTTGAAATCAATTTTACGTGAACAACTCGGTTTCCAAGGCGTTATTTTCTCAGATGATTTATCTATGGAGGGTGCCGCTATTATGGGAAGTTATGCGCAGAGAGCACAACGTTCATTAGATGCGGGTTGTGATATGCTTTTAGTGTGTAATAACCGTAAAGGGGCGGTAAGTGTGTTAGATAACCTGTCCTTTGTCAAAGCAGAACGCATTTCGGCGTTGTACCATCACCGAGGTCGTTACACATTAAGTGAACTGCAAGCATCTGATCGTTGGAAAAAAGCGAATCAAATGCTGACCCAATTACAGGAGCAATGGCAGGAGCGCGCATGATTATATATTTACATGGCTTTGATTCCACTAGTCCGGGAAATCATGAGAAG