Homologs in group_4294
0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product |
|---|
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| B4EUD3 | 0.0 | 543 | 100 | 0 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Proteus mirabilis (strain HI4320) |
| Q7N869 | 1.19e-141 | 401 | 70 | 0 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01) |
| B5F833 | 1.44e-140 | 398 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella agona (strain SL483) |
| C0Q5P4 | 3.24e-140 | 397 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella paratyphi C (strain RKS4594) |
| Q57T73 | 3.24e-140 | 397 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella choleraesuis (strain SC-B67) |
| Q6D1X6 | 9.83e-140 | 396 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672) |
| Q8ZRR0 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) |
| B5BL65 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella paratyphi A (strain AKU_12601) |
| Q5PIN3 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella paratyphi A (strain ATCC 9150 / SARB42) |
| B4SUA8 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella newport (strain SL254) |
| B4TK05 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella heidelberg (strain SL476) |
| B5RHC1 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella gallinarum (strain 287/91 / NCTC 13346) |
| B5R3E6 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella enteritidis PT4 (strain P125109) |
| B5FIX8 | 2.25e-139 | 395 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella dublin (strain CT_02021853) |
| A9MPM1 | 5.35e-139 | 394 | 70 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980) |
| A8ALE9 | 9.36e-139 | 394 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696) |
| P31057 | 2.63e-138 | 392 | 71 | 1 | 264 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain K12) |
| B1IQK6 | 2.63e-138 | 392 | 71 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks) |
| B1XCA9 | 2.63e-138 | 392 | 71 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain K12 / DH10B) |
| C4ZRM7 | 2.63e-138 | 392 | 71 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain K12 / MC4100 / BW2952) |
| B7M175 | 4.26e-138 | 392 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O8 (strain IAI1) |
| B6HZA9 | 7.2e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain SE11) |
| A7ZW83 | 7.2e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O9:H4 (strain HS) |
| B7LGJ6 | 7.2e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain 55989 / EAEC) |
| A7ZHM4 | 7.2e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O139:H28 (strain E24377A / ETEC) |
| Q83ME5 | 9.16e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella flexneri |
| Q0T867 | 9.16e-138 | 391 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella flexneri serotype 5b (strain 8401) |
| A6T4T0 | 1.58e-137 | 390 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578) |
| B5Y1P5 | 1.8e-137 | 390 | 71 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Klebsiella pneumoniae (strain 342) |
| Q8Z9D2 | 2.43e-137 | 390 | 71 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salmonella typhi |
| C6DC47 | 2.52e-137 | 390 | 70 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pectobacterium carotovorum subsp. carotovorum (strain PC1) |
| B7LW41 | 3.12e-137 | 390 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73) |
| A7MGP6 | 3.3e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cronobacter sakazakii (strain ATCC BAA-894) |
| B5YZH1 | 5.9e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O157:H7 (strain EC4115 / EHEC) |
| Q8X929 | 5.9e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O157:H7 |
| Q326A3 | 6.51e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella boydii serotype 4 (strain Sb227) |
| B2U2Y1 | 6.51e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella boydii serotype 18 (strain CDC 3083-94 / BS512) |
| B7N804 | 7.5e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC) |
| Q3Z5M6 | 8.65e-137 | 389 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella sonnei (strain Ss046) |
| Q0TLJ8 | 3.52e-136 | 387 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O6:K15:H31 (strain 536 / UPEC) |
| B7MNZ6 | 3.52e-136 | 387 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O81 (strain ED1a) |
| B7UII2 | 3.8e-136 | 387 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O127:H6 (strain E2348/69 / EPEC) |
| Q32JW9 | 4.57e-136 | 387 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shigella dysenteriae serotype 1 (strain Sd197) |
| Q5E2T2 | 5.27e-136 | 387 | 66 | 1 | 264 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Aliivibrio fischeri (strain ATCC 700601 / ES114) |
| B1LGT6 | 6.15e-136 | 386 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain SMS-3-5 / SECEC) |
| B7NI94 | 6.15e-136 | 386 | 70 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O7:K1 (strain IAI39 / ExPEC) |
| A4W6N8 | 1.25e-135 | 385 | 70 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Enterobacter sp. (strain 638) |
| Q1RG56 | 2.31e-135 | 385 | 69 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli (strain UTI89 / UPEC) |
| Q8FL30 | 2.31e-135 | 385 | 69 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC) |
| A1A7I0 | 2.31e-135 | 385 | 69 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O1:K1 / APEC |
| B7MBB7 | 2.31e-135 | 385 | 69 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Escherichia coli O45:K1 (strain S88 / ExPEC) |
| C5B9K6 | 2.5e-135 | 385 | 69 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Edwardsiella ictaluri (strain 93-146) |
| B5FB05 | 9.19e-135 | 383 | 65 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aliivibrio fischeri (strain MJ11) |
| B7VK03 | 9.4e-135 | 383 | 68 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio atlanticus (strain LGP32) |
| B1JK35 | 3.28e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pseudotuberculosis serotype O:3 (strain YPIII) |
| Q66EG3 | 3.28e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pseudotuberculosis serotype I (strain IP32953) |
| B2K534 | 3.28e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pseudotuberculosis serotype IB (strain PB1/+) |
| A4TPV5 | 5.03e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pestis (strain Pestoides F) |
| Q1CLW0 | 5.03e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pestis bv. Antiqua (strain Nepal516) |
| A9R1G2 | 5.03e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pestis bv. Antiqua (strain Angola) |
| Q8ZBK8 | 5.03e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pestis |
| Q1C3V8 | 5.03e-134 | 382 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pestis bv. Antiqua (strain Antiqua) |
| A1JJN8 | 7.07e-134 | 381 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081) |
| A7FM22 | 1.52e-133 | 380 | 69 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Yersinia pseudotuberculosis serotype O:1b (strain IP 31758) |
| B6ELE1 | 6.78e-132 | 376 | 64 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aliivibrio salmonicida (strain LFI1238) |
| Q87LV2 | 9.42e-132 | 376 | 65 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) |
| A7MYX2 | 2.64e-131 | 375 | 66 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio campbellii (strain ATCC BAA-1116) |
| C3LS82 | 9.85e-129 | 368 | 65 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio cholerae serotype O1 (strain M66-2) |
| Q9KUD0 | 9.85e-129 | 368 | 65 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) |
| A5F975 | 9.85e-129 | 368 | 65 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395) |
| Q7MHV4 | 3.75e-128 | 367 | 67 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio vulnificus (strain YJ016) |
| Q8DC11 | 3.75e-128 | 367 | 67 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vibrio vulnificus (strain CMCP6) |
| Q2NVR2 | 5.37e-126 | 361 | 65 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sodalis glossinidius (strain morsitans) |
| A8H0D4 | 7.1e-126 | 361 | 63 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella pealeana (strain ATCC 700345 / ANG-SQ1) |
| Q6LMJ6 | 9.75e-126 | 360 | 63 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Photobacterium profundum (strain SS9) |
| B1KEP6 | 1.09e-125 | 360 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella woodyi (strain ATCC 51908 / MS32) |
| B0TTI2 | 1.61e-125 | 360 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella halifaxensis (strain HAW-EB4) |
| A8G084 | 5.32e-125 | 358 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella sediminis (strain HAW-EB3) |
| Q8EIG9 | 6.69e-125 | 358 | 64 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1) |
| B8CTC6 | 1.07e-124 | 358 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella piezotolerans (strain WP3 / JCM 13877) |
| A3QHQ1 | 2.72e-124 | 357 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella loihica (strain ATCC BAA-1088 / PV-4) |
| A0L0R2 | 5.47e-124 | 356 | 63 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella sp. (strain ANA-3) |
| Q07XZ8 | 1.27e-123 | 355 | 63 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella frigidimarina (strain NCIMB 400) |
| Q0HRH6 | 1.67e-123 | 355 | 63 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella sp. (strain MR-7) |
| Q0HMB1 | 3.22e-123 | 354 | 63 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella sp. (strain MR-4) |
| Q5DZU8 | 1.07e-122 | 353 | 60 | 1 | 263 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Aliivibrio fischeri (strain ATCC 700601 / ES114) |
| A1RG67 | 1.23e-122 | 353 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella sp. (strain W3-18-1) |
| A4YA61 | 1.23e-122 | 353 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella putrefaciens (strain CN-32 / ATCC BAA-453) |
| Q09672 | 6.16e-122 | 351 | 63 | 2 | 264 | 3 | SPAC5H10.09c | Probable 3-methyl-2-oxobutanoate hydroxymethyltransferase | Schizosaccharomyces pombe (strain 972 / ATCC 24843) |
| Q12JC6 | 8.79e-122 | 350 | 62 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013) |
| A1S3M7 | 6.3e-121 | 348 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shewanella amazonensis (strain ATCC BAA-1098 / SB2B) |
| Q3ILK1 | 1.38e-119 | 345 | 61 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudoalteromonas translucida (strain TAC 125) |
| Q47W60 | 1.57e-119 | 345 | 62 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Colwellia psychrerythraea (strain 34H / ATCC BAA-681) |
| A1SSG9 | 2.54e-119 | 344 | 63 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37) |
| Q1LTN1 | 9.7e-117 | 338 | 60 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Baumannia cicadellinicola subsp. Homalodisca coagulata |
| B4RYN8 | 2.45e-116 | 337 | 61 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype) |
| Q15NV5 | 3.02e-116 | 337 | 60 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087) |
| B2VD19 | 8.13e-115 | 333 | 68 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99) |
| B8D7A1 | 5.27e-114 | 331 | 57 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7) |
| A4SJ61 | 5.76e-114 | 331 | 60 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aeromonas salmonicida (strain A449) |
| B8D8Z6 | 2.69e-113 | 329 | 56 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A) |
| P57293 | 2.78e-113 | 329 | 56 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS) |
| Q5QVR5 | 2.79e-113 | 329 | 59 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR) |
| A0KP07 | 4.52e-110 | 321 | 57 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049) |
| Q8K9U6 | 9.59e-110 | 320 | 55 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Buchnera aphidicola subsp. Schizaphis graminum (strain Sg) |
| C4L929 | 1.41e-109 | 320 | 57 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4) |
| A1TYE6 | 9.24e-109 | 317 | 57 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8) |
| A4XYC4 | 6.77e-108 | 315 | 56 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas mendocina (strain ymp) |
| A6W2I3 | 3.23e-107 | 314 | 56 | 1 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Marinomonas sp. (strain MWYL1) |
| Q88DW9 | 7.67e-107 | 313 | 55 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440) |
| A5W974 | 7.67e-107 | 313 | 55 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1) |
| B1J2C2 | 1.68e-106 | 312 | 54 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas putida (strain W619) |
| A4VPM6 | 5.86e-106 | 310 | 54 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Stutzerimonas stutzeri (strain A1501) |
| Q2S8W3 | 3.75e-105 | 308 | 57 | 1 | 261 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Hahella chejuensis (strain KCTC 2396) |
| Q4K5Y4 | 2.29e-103 | 304 | 53 | 1 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5) |
| Q8D2A5 | 3.03e-103 | 303 | 51 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Wigglesworthia glossinidia brevipalpis |
| Q9ZEP8 | 1.4e-102 | 302 | 53 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas fluorescens (strain SBW25) |
| Q1I4P2 | 1.95e-102 | 301 | 53 | 1 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Pseudomonas entomophila (strain L48) |
| Q3K6Q6 | 2.02e-101 | 299 | 52 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas fluorescens (strain Pf0-1) |
| Q4ZY86 | 3.26e-101 | 298 | 52 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas syringae pv. syringae (strain B728a) |
| Q48N86 | 6.08e-101 | 298 | 52 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6) |
| Q21F95 | 2.61e-100 | 296 | 53 | 0 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024) |
| Q02FU3 | 9.96e-100 | 295 | 53 | 1 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Pseudomonas aeruginosa (strain UCBPP-PA14) |
| Q9HV70 | 2.63e-99 | 293 | 53 | 1 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| Q888Q5 | 5.3e-99 | 293 | 52 | 1 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000) |
| Q0BI15 | 2e-95 | 284 | 53 | 1 | 260 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD) |
| A5WHD0 | 2.74e-95 | 283 | 52 | 2 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Psychrobacter sp. (strain PRwf-1) |
| Q4FVG8 | 2.89e-95 | 283 | 53 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4) |
| A9AGB5 | 3.06e-95 | 283 | 54 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia multivorans (strain ATCC 17616 / 249) |
| Q3SH83 | 4e-95 | 283 | 58 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thiobacillus denitrificans (strain ATCC 25259) |
| Q8XW45 | 1.44e-94 | 282 | 50 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000) |
| Q1BYX0 | 2.66e-94 | 281 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia orbicola (strain AU 1054) |
| A0K4T1 | 2.66e-94 | 281 | 53 | 1 | 260 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Burkholderia cenocepacia (strain HI2424) |
| Q1QSZ9 | 2.92e-94 | 281 | 52 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11) |
| A4JBS4 | 3.53e-94 | 281 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia vietnamiensis (strain G4 / LMG 22486) |
| Q1QEJ4 | 4.11e-94 | 280 | 53 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5) |
| Q7NXJ1 | 9.3e-93 | 277 | 50 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK) |
| B2JGD9 | 1.05e-92 | 277 | 51 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815) |
| Q3BUL6 | 1.29e-92 | 277 | 53 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10) |
| Q2SYZ1 | 1.51e-92 | 276 | 53 | 1 | 260 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264) |
| Q8PLL1 | 1.94e-92 | 276 | 53 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas axonopodis pv. citri (strain 306) |
| Q39JC5 | 2.55e-92 | 276 | 51 | 1 | 260 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383) |
| Q63R49 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia pseudomallei (strain K96243) |
| A3ND64 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia pseudomallei (strain 668) |
| Q3JP15 | 2.57e-92 | 276 | 53 | 1 | 260 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia pseudomallei (strain 1710b) |
| A3NYX3 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia pseudomallei (strain 1106a) |
| A1V0V0 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia mallei (strain SAVP1) |
| Q62HD8 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia mallei (strain ATCC 23344) |
| A2S561 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia mallei (strain NCTC 10229) |
| A3MN95 | 2.57e-92 | 276 | 53 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Burkholderia mallei (strain NCTC 10247) |
| Q1LJ86 | 1.52e-91 | 274 | 49 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34) |
| A6T221 | 1.66e-91 | 274 | 50 | 1 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Janthinobacterium sp. (strain Marseille) |
| B0VKK4 | 3.65e-91 | 273 | 50 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baumannii (strain SDF) |
| B0V5M5 | 5.58e-91 | 273 | 51 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baumannii (strain AYE) |
| B2HTG4 | 5.58e-91 | 273 | 51 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baumannii (strain ACICU) |
| B7I682 | 5.58e-91 | 273 | 51 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baumannii (strain AB0057) |
| B7H011 | 5.58e-91 | 273 | 51 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baumannii (strain AB307-0294) |
| Q46XJ2 | 5.96e-91 | 273 | 49 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197) |
| Q3JCP9 | 8.34e-91 | 272 | 49 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107) |
| Q2P377 | 1.09e-90 | 272 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas oryzae pv. oryzae (strain MAFF 311018) |
| Q5NXQ3 | 1.51e-90 | 271 | 50 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1) |
| Q5H0A3 | 1.63e-90 | 271 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85) |
| B2SJL8 | 1.63e-90 | 271 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas oryzae pv. oryzae (strain PXO99A) |
| B2UBN8 | 2.14e-90 | 271 | 51 | 1 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ralstonia pickettii (strain 12J) |
| Q47B66 | 1.73e-89 | 269 | 50 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Dechloromonas aromatica (strain RCB) |
| Q0VSR3 | 2.13e-89 | 268 | 48 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2) |
| Q8P9T0 | 2.62e-89 | 268 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25) |
| Q4UTV5 | 2.62e-89 | 268 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas campestris pv. campestris (strain 8004) |
| Q2YAN9 | 6.48e-89 | 267 | 50 | 2 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71) |
| B0RTU1 | 1.28e-88 | 266 | 51 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthomonas campestris pv. campestris (strain B100) |
| Q6F854 | 1.42e-88 | 266 | 49 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1) |
| A1KAA5 | 4.01e-88 | 265 | 54 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Azoarcus sp. (strain BH72) |
| Q0AB69 | 5.94e-88 | 265 | 53 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1) |
| B2V1L8 | 1.52e-87 | 264 | 48 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain Alaska E43 / Type E3) |
| Q1H3S0 | 4.32e-87 | 262 | 52 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT) |
| B4SRY3 | 5.13e-86 | 260 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Stenotrophomonas maltophilia (strain R551-3) |
| B2FL67 | 1.16e-85 | 259 | 52 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Stenotrophomonas maltophilia (strain K279a) |
| Q0ADS2 | 3e-85 | 258 | 47 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57) |
| B1Y4K8 | 5.98e-85 | 258 | 50 | 6 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6) |
| A1AW70 | 8.56e-85 | 256 | 48 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ruthia magnifica subsp. Calyptogena magnifica |
| Q145E8 | 1.15e-84 | 256 | 50 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Paraburkholderia xenovorans (strain LB400) |
| A6LWN6 | 1.93e-84 | 256 | 47 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052) |
| B2SXC3 | 1.04e-83 | 254 | 49 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN) |
| Q9JUY0 | 1.46e-83 | 253 | 50 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491) |
| A1AUV8 | 3.12e-83 | 253 | 48 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1) |
| A1KTB1 | 4.88e-83 | 252 | 50 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18) |
| Q605H0 | 2.24e-82 | 251 | 47 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath) |
| Q87EW0 | 3.46e-82 | 250 | 49 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xylella fastidiosa (strain Temecula1 / ATCC 700964) |
| B2I720 | 3.46e-82 | 250 | 49 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xylella fastidiosa (strain M23) |
| B4RKE5 | 4.66e-82 | 249 | 49 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Neisseria gonorrhoeae (strain NCCP11945) |
| Q5F9F9 | 4.66e-82 | 249 | 49 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090) |
| Q1DAN9 | 7.2e-82 | 251 | 50 | 3 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Myxococcus xanthus (strain DK1622) |
| Q9PGR9 | 7.5e-82 | 249 | 49 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xylella fastidiosa (strain 9a5c) |
| Q9JZW6 | 2.31e-81 | 248 | 50 | 3 | 261 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58) |
| B0U1Q2 | 2.62e-81 | 248 | 48 | 1 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xylella fastidiosa (strain M12) |
| Q82Y18 | 1.44e-80 | 246 | 45 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298) |
| B0K365 | 8.54e-80 | 244 | 46 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermoanaerobacter sp. (strain X514) |
| B0KC90 | 8.54e-80 | 244 | 46 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E) |
| Q31FF5 | 1.18e-79 | 243 | 50 | 3 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2) |
| A1WDW4 | 3.03e-79 | 244 | 49 | 4 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Verminephrobacter eiseniae (strain EF01-2) |
| B9ML78 | 3.47e-79 | 242 | 45 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320) |
| A1WBI7 | 8.6e-79 | 243 | 48 | 5 | 270 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acidovorax sp. (strain JS42) |
| A0L3M6 | 1.02e-78 | 241 | 47 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1) |
| B3R6G5 | 1.24e-78 | 241 | 50 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1) |
| Q0K762 | 1.26e-78 | 241 | 50 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337) |
| A4IQ61 | 1.49e-78 | 241 | 47 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geobacillus thermodenitrificans (strain NG80-2) |
| B0TC10 | 1.72e-78 | 241 | 46 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Heliobacterium modesticaldum (strain ATCC 51547 / Ice1) |
| A6LMK5 | 2.74e-78 | 240 | 46 | 2 | 249 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429) |
| Q2LTJ5 | 5.24e-78 | 239 | 46 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Syntrophus aciditrophicus (strain SB) |
| Q65I56 | 8.89e-78 | 239 | 46 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46) |
| C5D3B3 | 1e-77 | 239 | 46 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geobacillus sp. (strain WCH70) |
| Q3A9L0 | 1.14e-77 | 239 | 48 | 5 | 267 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901) |
| A4XMZ4 | 2.2e-77 | 238 | 45 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331) |
| B8J7G7 | 2.3e-77 | 239 | 45 | 3 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258) |
| A2SEX8 | 3.53e-77 | 238 | 53 | 4 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1) |
| B4UDZ3 | 3.55e-77 | 239 | 45 | 3 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaeromyxobacter sp. (strain K) |
| A0PXQ3 | 5.42e-77 | 237 | 44 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium novyi (strain NT) |
| Q9KC87 | 5.95e-77 | 237 | 45 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125) |
| Q5WGA3 | 7.16e-77 | 237 | 45 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Shouchella clausii (strain KSM-K16) |
| A7Z5Z4 | 8.27e-77 | 237 | 44 | 2 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42) |
| P52996 | 9.53e-77 | 237 | 44 | 2 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus subtilis (strain 168) |
| A1TTV9 | 1.9e-76 | 236 | 48 | 4 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Paracidovorax citrulli (strain AAC00-1) |
| Q18C32 | 2.18e-76 | 236 | 45 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridioides difficile (strain 630) |
| B1LAU5 | 6.44e-76 | 234 | 49 | 2 | 243 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermotoga sp. (strain RQ2) |
| Q9X251 | 7.34e-76 | 234 | 49 | 2 | 243 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8) |
| B7IDK8 | 1e-75 | 234 | 45 | 2 | 251 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermosipho africanus (strain TCF52B) |
| Q5KXX2 | 1.32e-75 | 234 | 48 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geobacillus kaustophilus (strain HTA426) |
| A8F498 | 1.46e-75 | 233 | 48 | 4 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO) |
| Q3A3I6 | 1.74e-75 | 233 | 46 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1) |
| Q12F40 | 2.71e-75 | 234 | 48 | 4 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Polaromonas sp. (strain JS666 / ATCC BAA-500) |
| B3E5K9 | 2.87e-75 | 233 | 46 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ) |
| Q6AJ44 | 4.47e-75 | 233 | 45 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Desulfotalea psychrophila (strain LSv54 / DSM 12343) |
| B5E846 | 6.01e-75 | 232 | 46 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem) |
| B7HL53 | 6.84e-75 | 232 | 45 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain AH187) |
| A7GN76 | 6.9e-75 | 232 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98) |
| A9B2U4 | 7.43e-75 | 232 | 45 | 3 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95) |
| Q39V51 | 1.02e-74 | 231 | 44 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15) |
| B9M2A3 | 1.15e-74 | 231 | 46 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32) |
| B7IPB7 | 1.53e-74 | 231 | 44 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain G9842) |
| Q74CG8 | 1.53e-74 | 231 | 43 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA) |
| B7HHU3 | 2.24e-74 | 231 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain B4264) |
| Q81FN7 | 2.44e-74 | 231 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711) |
| B9K819 | 4.29e-74 | 229 | 48 | 2 | 243 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E) |
| B1GZJ8 | 4.5e-74 | 229 | 45 | 3 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Endomicrobium trichonymphae |
| Q6MHI3 | 6e-74 | 229 | 45 | 2 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100) |
| Q6HL16 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus thuringiensis subsp. konkukian (strain 97-27) |
| Q63DJ3 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain ZK / E33L) |
| C1EN36 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain 03BB102) |
| B7JHQ6 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain AH820) |
| Q81ST3 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus anthracis |
| A0RBZ2 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus thuringiensis (strain Al Hakam) |
| C3L8Q0 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus anthracis (strain CDC 684 / NRRL 3495) |
| C3P5Q9 | 6.14e-74 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus anthracis (strain A0248) |
| Q73AV4 | 6.85e-74 | 229 | 45 | 5 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus cereus (strain ATCC 10987 / NRS 248) |
| Q8EZ98 | 7.2e-74 | 229 | 46 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601) |
| Q72MN0 | 7.2e-74 | 229 | 46 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130) |
| Q47R98 | 8.13e-74 | 229 | 46 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermobifida fusca (strain YX) |
| A5CX20 | 8.8e-74 | 228 | 43 | 1 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA) |
| C4L6Q0 | 1.35e-73 | 229 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b) |
| B0STK1 | 1.44e-73 | 228 | 46 | 4 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris) |
| B0SAC5 | 1.44e-73 | 228 | 46 | 4 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames) |
| Q04XX5 | 1.81e-73 | 228 | 45 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira borgpetersenii serovar Hardjo-bovis (strain L550) |
| A9VME9 | 2.32e-73 | 228 | 44 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus mycoides (strain KBAB4) |
| Q72LM0 | 4.35e-73 | 227 | 44 | 3 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27) |
| A5N5W0 | 5.39e-73 | 227 | 44 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680) |
| C3L035 | 6.53e-73 | 227 | 45 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain 657 / Type Ba4) |
| Q2IFU2 | 6.6e-73 | 228 | 46 | 3 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaeromyxobacter dehalogenans (strain 2CP-C) |
| B1KUY7 | 9.25e-73 | 226 | 45 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain Loch Maree / Type A3) |
| A7GAI6 | 9.87e-73 | 226 | 45 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain Langeland / NCTC 10281 / Type F) |
| B1IEL6 | 9.87e-73 | 226 | 45 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain Okra / Type B1) |
| C1FS97 | 9.87e-73 | 226 | 45 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain Kyoto / Type A2) |
| Q5SL86 | 1.15e-72 | 226 | 44 | 3 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8) |
| Q3ZXG0 | 1.5e-72 | 226 | 46 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Dehalococcoides mccartyi (strain CBDB1) |
| A7FR60 | 1.58e-72 | 226 | 45 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium botulinum (strain ATCC 19397 / Type A) |
| A7HGZ2 | 1.85e-72 | 227 | 44 | 3 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaeromyxobacter sp. (strain Fw109-5) |
| Q833S5 | 1.92e-72 | 226 | 43 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Enterococcus faecalis (strain ATCC 700802 / V583) |
| B5ES07 | 3.67e-72 | 224 | 46 | 2 | 252 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31) |
| B7JBM8 | 3.67e-72 | 224 | 46 | 2 | 252 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455) |
| Q3Z8B4 | 3.72e-72 | 225 | 47 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195) |
| A9BV02 | 4.78e-72 | 225 | 45 | 5 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Delftia acidovorans (strain DSM 14801 / SPH-1) |
| Q04VK1 | 7.4e-72 | 224 | 44 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197) |
| Q97F39 | 8.57e-72 | 224 | 44 | 3 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W) |
| A1WUU5 | 1.09e-71 | 224 | 49 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Halorhodospira halophila (strain DSM 244 / SL1) |
| A8FEH7 | 2.47e-71 | 223 | 44 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacillus pumilus (strain SAFR-032) |
| A5FR68 | 2.61e-71 | 223 | 46 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1) |
| B8G644 | 3.21e-71 | 223 | 44 | 3 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chloroflexus aggregans (strain MD-66 / DSM 9485) |
| A1VKS3 | 8.63e-71 | 222 | 45 | 4 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Polaromonas naphthalenivorans (strain CJ2) |
| B8FFR9 | 1.2e-70 | 221 | 44 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Desulfatibacillum aliphaticivorans |
| Q9PIK1 | 1.24e-70 | 221 | 42 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168) |
| A8FK87 | 1.24e-70 | 221 | 42 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828) |
| A1VBJ4 | 1.43e-70 | 222 | 43 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitratidesulfovibrio vulgaris (strain DP4) |
| Q729A6 | 1.43e-70 | 222 | 43 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough) |
| Q5NL34 | 1.83e-70 | 221 | 45 | 6 | 270 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4) |
| Q21U09 | 2.11e-70 | 221 | 45 | 5 | 269 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118) |
| A5IAR5 | 2.11e-70 | 220 | 46 | 3 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Legionella pneumophila (strain Corby) |
| Q2JRY1 | 2.14e-70 | 220 | 45 | 3 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Synechococcus sp. (strain JA-3-3Ab) |
| A5G3A0 | 2.47e-70 | 220 | 44 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Geotalea uraniireducens (strain Rf4) |
| Q5HWH3 | 2.87e-70 | 220 | 43 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter jejuni (strain RM1221) |
| A9H9N2 | 5.2e-70 | 219 | 45 | 3 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5) |
| Q7M878 | 9.26e-70 | 218 | 42 | 4 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W) |
| B2HHM7 | 1.44e-69 | 219 | 44 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium marinum (strain ATCC BAA-535 / M) |
| A0PNG6 | 2.02e-69 | 219 | 44 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium ulcerans (strain Agy99) |
| Q5X1M8 | 5.33e-69 | 216 | 46 | 3 | 253 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Legionella pneumophila (strain Paris) |
| Q29W37 | 7.08e-69 | 216 | 42 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176) |
| B1YHQ9 | 8.07e-69 | 216 | 44 | 2 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15) |
| Q2S1H6 | 9.64e-69 | 216 | 40 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Salinibacter ruber (strain DSM 13855 / M31) |
| A5URA8 | 2.1e-68 | 215 | 47 | 2 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Roseiflexus sp. (strain RS-1) |
| A4IWW6 | 2.2e-68 | 215 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. tularensis (strain WY96-3418) |
| B2SFS9 | 2.2e-68 | 215 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. mediasiatica (strain FSC147) |
| A7H574 | 2.87e-68 | 215 | 41 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97) |
| Q2JNI1 | 2.91e-68 | 214 | 44 | 3 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Synechococcus sp. (strain JA-2-3B'a(2-13)) |
| Q0BMQ5 | 3.63e-68 | 214 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. holarctica (strain OSU18) |
| Q2A4C6 | 3.63e-68 | 214 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. holarctica (strain LVS) |
| A7NB32 | 3.63e-68 | 214 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA) |
| A0Q7L2 | 4.36e-68 | 214 | 40 | 2 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. novicida (strain U112) |
| A8MAX6 | 4.97e-68 | 214 | 44 | 1 | 246 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Caldivirga maquilingensis (strain ATCC 700844 / DSM 13496 / JCM 10307 / IC-167) |
| Q5NF58 | 6.39e-68 | 214 | 41 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4) |
| Q14GL1 | 6.39e-68 | 214 | 41 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Francisella tularensis subsp. tularensis (strain FSC 198) |
| Q2RM79 | 8.04e-68 | 214 | 44 | 3 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Moorella thermoacetica (strain ATCC 39073 / JCM 9320) |
| Q0B0P6 | 1.16e-67 | 213 | 43 | 3 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen) |
| B1YBD4 | 1.17e-67 | 213 | 43 | 1 | 250 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta) |
| Q1B6P5 | 1.66e-67 | 213 | 44 | 4 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium sp. (strain MCS) |
| A1UID0 | 1.66e-67 | 213 | 44 | 4 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium sp. (strain KMS) |
| A3Q1U4 | 1.66e-67 | 213 | 44 | 4 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium sp. (strain JLS) |
| B3EQ18 | 2.04e-67 | 213 | 42 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium phaeobacteroides (strain BS1) |
| C0QFH9 | 2.21e-67 | 212 | 44 | 6 | 267 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2) |
| A0AK07 | 3.07e-67 | 213 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8) |
| A1RU92 | 4.89e-67 | 211 | 43 | 1 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3) |
| A7NG79 | 6.35e-67 | 212 | 45 | 2 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Roseiflexus castenholzii (strain DSM 13941 / HLO8) |
| B9LII0 | 1.39e-66 | 211 | 41 | 3 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl) |
| A9WFR7 | 1.39e-66 | 211 | 41 | 3 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl) |
| A4WMD4 | 1.62e-66 | 210 | 45 | 1 | 243 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6) |
| Q0SHJ0 | 1.69e-66 | 211 | 44 | 4 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodococcus jostii (strain RHA1) |
| A3DDV7 | 2.09e-66 | 211 | 39 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372) |
| B8G1S3 | 2.16e-66 | 210 | 44 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Desulfitobacterium hafniense (strain DSM 10664 / DCB-2) |
| A3DPB2 | 2.61e-66 | 210 | 39 | 2 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1) |
| Q92AA6 | 5.33e-66 | 209 | 42 | 4 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262) |
| C3MK79 | 7.54e-66 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain L.S.2.15 / Lassen #1) |
| C3MU48 | 9.9e-66 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain M.14.25 / Kamchatka #1) |
| C4KKA3 | 9.9e-66 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain M.16.4 / Kamchatka #3) |
| C3N136 | 9.9e-66 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain M.16.27) |
| C3N926 | 1.02e-65 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1) |
| C3NMB9 | 1.15e-65 | 208 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2) |
| B8DC24 | 1.49e-65 | 208 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria monocytogenes serotype 4a (strain HCC23) |
| C5CFR2 | 1.61e-65 | 207 | 43 | 2 | 249 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1) |
| Q250S5 | 1.73e-65 | 208 | 43 | 3 | 253 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Desulfitobacterium hafniense (strain Y51) |
| A1BH02 | 1.94e-65 | 208 | 42 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430) |
| A8EVP8 | 2.7e-65 | 207 | 48 | 4 | 244 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aliarcobacter butzleri (strain RM4018) |
| Q8ZT69 | 2.83e-65 | 207 | 44 | 1 | 250 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2) |
| B3QMS8 | 2.93e-65 | 207 | 42 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobaculum parvum (strain DSM 263 / NCIMB 8327) |
| P9WIL7 | 5.68e-65 | 207 | 42 | 3 | 257 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) |
| P9WIL6 | 5.68e-65 | 207 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) |
| A1KKR8 | 5.68e-65 | 207 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium bovis (strain BCG / Pasteur 1173P2) |
| P0C2T4 | 5.68e-65 | 207 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97) |
| A0RN82 | 6.51e-65 | 206 | 40 | 4 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter fetus subsp. fetus (strain 82-40) |
| Q5ZS58 | 7.52e-65 | 206 | 45 | 3 | 246 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513) |
| B6J9H8 | 7.62e-65 | 206 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Coxiella burnetii (strain CbuK_Q154) |
| Q4JWH1 | 8.16e-65 | 206 | 41 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Corynebacterium jeikeium (strain K411) |
| Q83EA2 | 1.38e-64 | 205 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Coxiella burnetii (strain RSA 493 / Nine Mile phase I) |
| A9KEG7 | 1.38e-64 | 205 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Coxiella burnetii (strain Dugway 5J108-111) |
| Q71YB3 | 1.41e-64 | 206 | 41 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria monocytogenes serotype 4b (strain F2365) |
| C1KWK2 | 1.41e-64 | 206 | 41 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria monocytogenes serotype 4b (strain CLIP80459) |
| Q7NMK3 | 1.74e-64 | 205 | 45 | 3 | 251 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Gloeobacter violaceus (strain ATCC 29082 / PCC 7421) |
| B0BYP7 | 1.99e-64 | 204 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Acaryochloris marina (strain MBIC 11017) |
| B6J1Q3 | 2e-64 | 205 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Coxiella burnetii (strain CbuG_Q212) |
| A8A9H3 | 2.25e-64 | 204 | 40 | 1 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125) |
| A2BMY4 | 2.46e-64 | 205 | 42 | 1 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5) |
| Q1IHA5 | 2.66e-64 | 206 | 44 | 3 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Koribacter versatilis (strain Ellin345) |
| A0M360 | 3.22e-64 | 204 | 39 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803) |
| Q8KCS2 | 3.39e-64 | 204 | 41 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS) |
| Q8Y601 | 3.54e-64 | 204 | 40 | 2 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e) |
| Q97W44 | 3.55e-64 | 204 | 39 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2) |
| A0LLW3 | 4.49e-64 | 204 | 45 | 3 | 251 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB) |
| Q3B394 | 4.9e-64 | 204 | 41 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530) |
| B1XQ35 | 5.72e-64 | 204 | 43 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) |
| Q5WTD7 | 8.01e-64 | 203 | 45 | 3 | 246 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Legionella pneumophila (strain Lens) |
| B1HU19 | 9.35e-64 | 204 | 40 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Lysinibacillus sphaericus (strain C3-41) |
| Q3AS53 | 1.13e-63 | 203 | 40 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium chlorochromatii (strain CaD3) |
| A0QEV5 | 1.15e-63 | 204 | 43 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium avium (strain 104) |
| O67783 | 1.23e-63 | 203 | 44 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Aquifex aeolicus (strain VF5) |
| Q73YI6 | 1.76e-63 | 203 | 43 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10) |
| Q0RFD5 | 1.92e-63 | 204 | 42 | 4 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a) |
| Q5N1A6 | 2.19e-63 | 202 | 43 | 4 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) |
| Q31KK8 | 2.19e-63 | 202 | 43 | 4 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805) |
| Q30PX5 | 5.88e-63 | 201 | 41 | 4 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251) |
| Q9L7B2 | 6.21e-63 | 201 | 42 | 4 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1) |
| A4SE31 | 7.13e-63 | 201 | 40 | 3 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium phaeovibrioides (strain DSM 265 / 1930) |
| A9A2T9 | 1.19e-62 | 201 | 41 | 2 | 253 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrosopumilus maritimus (strain SCM1) |
| B4S8V9 | 1.4e-62 | 201 | 43 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Prosthecochloris aestuarii (strain DSM 271 / SK 413) |
| B4SAH9 | 1.4e-62 | 201 | 40 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1) |
| B3EDF1 | 1.66e-62 | 200 | 40 | 4 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330) |
| Q311U7 | 2.32e-62 | 200 | 44 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20) |
| A5FAQ5 | 2.74e-62 | 199 | 37 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101) |
| B1ZHG6 | 2.81e-62 | 199 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001) |
| Q5YZ95 | 5.43e-62 | 199 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nocardia farcinica (strain IFM 10152) |
| A3MWA6 | 6.29e-62 | 198 | 44 | 1 | 245 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1) |
| A9W3L5 | 8.14e-62 | 198 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylorubrum extorquens (strain PA1) |
| B7KWY8 | 8.14e-62 | 198 | 43 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylorubrum extorquens (strain CM4 / NCIMB 13688) |
| O58665 | 8.84e-62 | 199 | 42 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) |
| Q6NEB7 | 9.96e-62 | 198 | 39 | 3 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis) |
| A7GZP8 | 1.36e-61 | 197 | 40 | 3 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter curvus (strain 525.92) |
| Q6G5H3 | 1.39e-61 | 198 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1) |
| Q4A0U0 | 1.41e-61 | 197 | 43 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41) |
| Q9RKS2 | 1.67e-61 | 198 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145) |
| Q8CR20 | 2.84e-61 | 197 | 43 | 7 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200) |
| Q5HL35 | 2.84e-61 | 197 | 43 | 7 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A) |
| A9IRP2 | 3.74e-61 | 197 | 39 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bartonella tribocorum (strain CIP 105476 / IBS 506) |
| B7JVF9 | 8.55e-61 | 195 | 41 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rippkaea orientalis (strain PCC 8801 / RF-1) |
| Q974Y0 | 1.01e-60 | 195 | 40 | 1 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7) |
| Q82AW2 | 1.1e-60 | 196 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680) |
| Q11Q55 | 1.28e-60 | 195 | 39 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465) |
| B5ZAF6 | 1.37e-60 | 195 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain G27) |
| Q5PBP6 | 1.77e-60 | 195 | 41 | 2 | 252 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaplasma marginale (strain St. Maries) |
| B6YS36 | 2.02e-60 | 195 | 37 | 2 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Azobacteroides pseudotrichonymphae genomovar. CFP2 |
| Q9V0E1 | 2.41e-60 | 195 | 42 | 1 | 249 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrococcus abyssi (strain GE5 / Orsay) |
| Q9ZM56 | 2.84e-60 | 194 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain J99 / ATCC 700824) |
| B6JKW5 | 2.9e-60 | 194 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain P12) |
| B8HWP9 | 2.94e-60 | 194 | 41 | 3 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cyanothece sp. (strain PCC 7425 / ATCC 29141) |
| B9KHN0 | 3.57e-60 | 194 | 41 | 2 | 252 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Anaplasma marginale (strain Florida) |
| Q9HPT6 | 3.64e-60 | 194 | 40 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1) |
| B0R5P8 | 3.64e-60 | 194 | 40 | 2 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1) |
| Q64UB9 | 3.65e-60 | 194 | 38 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacteroides fragilis (strain YCH46) |
| Q5LD96 | 3.65e-60 | 194 | 38 | 2 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2) |
| Q1CUB6 | 4.06e-60 | 194 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain HPAG1) |
| Q9AMS0 | 7.4e-60 | 194 | 41 | 3 | 265 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110) |
| Q6GDK4 | 1.26e-59 | 193 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain MRSA252) |
| P65657 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain MW2) |
| A8Z3J9 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain USA300 / TCH1516) |
| Q6G677 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain MSSA476) |
| P65656 | 1.34e-59 | 192 | 42 | 5 | 261 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain N315) |
| Q2YWF9 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain bovine RF122 / ET3-1) |
| A5IW24 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain JH9) |
| Q2FV21 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain NCTC 8325 / PS 47) |
| Q2FDR0 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain USA300) |
| A6U4X9 | 1.34e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain JH1) |
| Q5HCV3 | 1.4e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain COL) |
| Q931E6 | 1.5e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain Mu50 / ATCC 700699) |
| A7X6X7 | 1.5e-59 | 192 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain Mu3 / ATCC 700698) |
| A4FA49 | 1.62e-59 | 193 | 42 | 4 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338) |
| O25698 | 1.64e-59 | 192 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain ATCC 700392 / 26695) |
| Q10WG3 | 1.95e-59 | 192 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Trichodesmium erythraeum (strain IMS101) |
| Q1GLQ6 | 1.95e-59 | 192 | 43 | 5 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ruegeria sp. (strain TM1040) |
| A4YED8 | 5.71e-59 | 191 | 42 | 3 | 249 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2) |
| Q8U1R2 | 6.71e-59 | 191 | 42 | 1 | 249 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) |
| Q5V3P6 | 6.72e-59 | 191 | 41 | 4 | 250 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809) |
| A6QK86 | 8.18e-59 | 191 | 42 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus aureus (strain Newman) |
| A6L3Y2 | 8.52e-59 | 191 | 37 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154) |
| B2USM4 | 1.08e-58 | 190 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter pylori (strain Shi470) |
| Q5JCY6 | 1.27e-58 | 191 | 43 | 1 | 249 | 1 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1) |
| B1LTL1 | 1.29e-58 | 190 | 41 | 4 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1) |
| P52997 | 1.73e-58 | 189 | 40 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa) |
| Q17WP8 | 1.79e-58 | 190 | 39 | 4 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter acinonychis (strain Sheeba) |
| Q9I3C3 | 1.8e-58 | 190 | 41 | 4 | 247 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) |
| Q02K83 | 1.8e-58 | 190 | 41 | 4 | 247 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Pseudomonas aeruginosa (strain UCBPP-PA14) |
| B9JXS3 | 2.56e-58 | 189 | 40 | 5 | 266 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4) |
| B9JH27 | 2.77e-58 | 189 | 43 | 4 | 250 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhizobium rhizogenes (strain K84 / ATCC BAA-868) |
| A7ZEL6 | 3.01e-58 | 189 | 40 | 4 | 259 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Campylobacter concisus (strain 13826) |
| Q6AFH4 | 3.28e-58 | 189 | 41 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Leifsonia xyli subsp. xyli (strain CTCB07) |
| A7IF97 | 4.12e-58 | 189 | 39 | 2 | 244 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2) |
| B3Q9V6 | 5.76e-58 | 189 | 39 | 3 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain TIE-1) |
| A2SDV6 | 6.3e-58 | 189 | 37 | 2 | 264 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1) |
| Q7VIU7 | 6.48e-58 | 188 | 39 | 4 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Helicobacter hepaticus (strain ATCC 51449 / 3B1) |
| Q4LA35 | 6.82e-58 | 188 | 39 | 6 | 263 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus haemolyticus (strain JCSC1435) |
| Q3INP4 | 7.78e-58 | 188 | 40 | 2 | 253 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara) |
| O82357 | 1.68e-57 | 190 | 38 | 3 | 267 | 1 | KPHMT1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1, mitochondrial | Arabidopsis thaliana |
| A0RXQ5 | 1.73e-57 | 187 | 40 | 3 | 248 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cenarchaeum symbiosum (strain A) |
| Q9M315 | 2.59e-57 | 189 | 38 | 3 | 267 | 1 | KPHMT2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2, mitochondrial | Arabidopsis thaliana |
| Q2IXB0 | 2.62e-57 | 187 | 38 | 3 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain HaA2) |
| Q6N583 | 3.14e-57 | 187 | 39 | 3 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009) |
| Q3J5N1 | 3.15e-57 | 187 | 44 | 5 | 244 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.) |
| A3PGQ2 | 3.15e-57 | 187 | 44 | 5 | 244 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9) |
| Q135K5 | 3.21e-57 | 187 | 38 | 3 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain BisB5) |
| Q11F82 | 4.11e-57 | 187 | 43 | 5 | 251 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Chelativorans sp. (strain BNC1) |
| Q5NL16 | 4.18e-57 | 186 | 40 | 3 | 255 | 3 | panB2 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 | Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4) |
| Q89MZ4 | 4.36e-57 | 186 | 39 | 3 | 255 | 3 | panB3 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 3 | Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110) |
| Q1GR07 | 4.43e-57 | 187 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256) |
| A9IHJ7 | 5.93e-57 | 186 | 41 | 4 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448) |
| Q9CBT0 | 8.49e-57 | 186 | 42 | 3 | 257 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Mycobacterium leprae (strain TN) |
| Q4JA70 | 1.17e-56 | 185 | 39 | 1 | 246 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770) |
| B9DKF4 | 1.68e-56 | 185 | 40 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Staphylococcus carnosus (strain TM300) |
| Q215V6 | 1.79e-56 | 185 | 37 | 2 | 255 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain BisB18) |
| A7HYW1 | 2.51e-56 | 184 | 39 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966) |
| Q8YWS8 | 2.95e-56 | 184 | 37 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576) |
| A1SIB6 | 4.13e-56 | 184 | 43 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nocardioides sp. (strain ATCC BAA-499 / JS614) |
| A1US40 | 4.21e-56 | 184 | 41 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63) |
| Q3M672 | 6.03e-56 | 183 | 37 | 4 | 258 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Trichormus variabilis (strain ATCC 29413 / PCC 7937) |
| A6Q1X8 | 6.25e-56 | 183 | 42 | 7 | 260 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitratiruptor sp. (strain SB155-2) |
| Q07LA4 | 8.81e-56 | 183 | 39 | 2 | 244 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodopseudomonas palustris (strain BisA53) |
| Q8FUA5 | 9.74e-56 | 182 | 37 | 3 | 264 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395) |
| Q1QMP7 | 1.22e-55 | 182 | 39 | 3 | 254 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14) |
| Q6G078 | 4.37e-55 | 181 | 40 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Bartonella quintana (strain Toulouse) |
| Q5LWP5 | 5.89e-55 | 181 | 43 | 5 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3) |
| Q83HM1 | 9.02e-55 | 180 | 35 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Tropheryma whipplei (strain TW08/27) |
| A6TMH9 | 9.55e-55 | 181 | 38 | 4 | 265 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Alkaliphilus metalliredigens (strain QYMF) |
| Q4K629 | 9.61e-55 | 180 | 41 | 4 | 251 | 3 | panB1 | 3-methyl-2-oxobutanoate hydroxymethyltransferase 1 | Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5) |
| Q83GK7 | 1.03e-54 | 180 | 35 | 3 | 262 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Tropheryma whipplei (strain Twist) |
| Q1J1C0 | 2.35e-54 | 179 | 42 | 3 | 245 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a) |
| Q8ELF4 | 2.56e-54 | 179 | 37 | 5 | 261 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831) |
| Q0BSQ3 | 2.64e-54 | 179 | 39 | 4 | 256 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1) |
| B6IX34 | 3.12e-54 | 179 | 41 | 4 | 253 | 3 | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase | Rhodospirillum centenum (strain ATCC 51521 / SW) |
| Source | Proteus mirabilis HI4320 |
|---|---|
| Locus tag | PMI_RS00945 |
| Feature type | CDS |
| Gene | panB |
| Product | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| Location | 232388 - 233179 (strand: -1) |
| Length | 792 (nucleotides) / 263 (amino acids) |
| Accession | NC_010554 |
|---|---|
| Length | 4063606 nucleotides |
| Topology | circular |
| Plasmid | False |
| Orthogroup | group_4294 | |
|---|---|---|
| Orthogroup size | 1 | |
| N. genomes | 1 |
| PF02548 | Ketopantoate hydroxymethyltransferase |
|---|
| ID | Function(s) descr. | Function(s) cat. | Description |
|---|---|---|---|
| COG0413 | Coenzyme transport and metabolism (H) | H | Ketopantoate hydroxymethyltransferase |
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K00606 | 3-methyl-2-oxobutanoate hydroxymethyltransferase [EC:2.1.2.11] | Pantothenate and CoA biosynthesis Metabolic pathways Biosynthesis of secondary metabolites Biosynthesis of cofactors |
Pantothenate biosynthesis, valine/L-aspartate => pantothenate Pantothenate biosynthesis, 2-oxoisovalerate/spermine => pantothenate Coenzyme A biosynthesis, archaea, 2-oxoisovalerate => 4-phosphopantoate => CoA |
MKPVTLSTLNRYKQEKKKFATITAYDASFARLFANEGIPAMLIGDSLGMTLQGHDSTLPVTVEQIAYHTRCVRAGAPNAFLIADMPFMSYSTPEQACLNAAILMQAGANMVKIEGGSWLIPTVKMLTERAVPVCIHLGLTPQSVNVFGGYKVQGREEAAAEQLKQDAMALEAAGAQLAVLECVPVSVAKTITGSLNIPVIGIGAGNVTDGQILVMHDLLGLTPNAPKFSKNFLQEAGSLPEAVRLYVQQVEQKLFPQEQHSFN
CTGACATAAATAACTCAATTTACACGCAACACACCATGGAGTTTATTATCATGAAGCCGGTTACGCTATCTACGCTCAATCGCTATAAACAAGAAAAGAAAAAGTTTGCCACTATCACGGCTTATGATGCTAGCTTTGCTCGTCTATTTGCCAATGAAGGTATTCCTGCCATGTTAATTGGTGATTCACTCGGTATGACACTACAAGGTCATGACAGCACATTACCTGTCACCGTTGAGCAAATTGCCTATCATACCCGTTGTGTAAGAGCAGGCGCCCCTAACGCTTTCTTAATTGCTGATATGCCTTTTATGTCTTATTCCACTCCAGAGCAAGCCTGTCTTAACGCAGCTATTTTAATGCAAGCGGGAGCGAATATGGTCAAAATTGAAGGAGGAAGCTGGCTTATTCCTACAGTCAAAATGCTCACTGAACGCGCAGTGCCTGTTTGTATTCACTTAGGCTTAACCCCTCAATCTGTTAATGTGTTTGGTGGCTATAAAGTACAAGGTCGAGAAGAAGCTGCTGCAGAGCAACTTAAGCAAGATGCTATGGCGCTTGAAGCCGCAGGAGCACAACTAGCTGTATTAGAATGCGTCCCCGTTTCCGTAGCAAAAACTATTACCGGATCACTCAATATTCCCGTTATCGGCATTGGTGCCGGCAATGTCACTGATGGACAAATTCTTGTGATGCATGATTTATTAGGTCTAACACCTAATGCCCCTAAATTTTCTAAAAATTTCTTACAAGAAGCTGGCTCCTTACCCGAGGCTGTCAGACTGTATGTTCAACAAGTTGAACAAAAACTGTTCCCTCAAGAACAACACTCATTTAACTGATTTATCATTTAAATTCATTAAAATAGTTTAAAGGAGTCACGCTATGCTAA
