Homologs in group_1363

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08000 FBDBKF_08000 50.2 Morganella morganii S1 panC pantoate--beta-alanine ligase
EHELCC_13830 EHELCC_13830 50.2 Morganella morganii S2 panC pantoate--beta-alanine ligase
NLDBIP_14275 NLDBIP_14275 50.2 Morganella morganii S4 panC pantoate--beta-alanine ligase
LHKJJB_08575 LHKJJB_08575 50.2 Morganella morganii S3 panC pantoate--beta-alanine ligase
HKOGLL_08125 HKOGLL_08125 50.2 Morganella morganii S5 panC pantoate--beta-alanine ligase
F4V73_RS12985 F4V73_RS12985 47.7 Morganella psychrotolerans panC pantoate--beta-alanine ligase

Distribution of the homologs in the orthogroup group_1363

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1363

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUD2 0.0 582 100 0 283 3 panC Pantothenate synthetase Proteus mirabilis (strain HI4320)
Q7N870 3.57e-133 381 63 0 283 3 panC Pantothenate synthetase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D1X5 3.37e-132 379 64 0 283 3 panC Pantothenate synthetase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DC48 3.58e-131 376 63 0 283 3 panC Pantothenate synthetase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5Y1P6 1.14e-130 375 62 0 282 3 panC Pantothenate synthetase Klebsiella pneumoniae (strain 342)
B7MBB6 2.17e-130 374 62 0 282 3 panC Pantothenate synthetase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N803 4.63e-130 373 62 0 283 3 panC Pantothenate synthetase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A1JJN7 6.44e-130 373 63 0 282 3 panC Pantothenate synthetase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q83SM0 7.32e-130 372 62 0 282 3 panC Pantothenate synthetase Shigella flexneri
Q0T868 7.32e-130 372 62 0 282 3 panC Pantothenate synthetase Shigella flexneri serotype 5b (strain 8401)
Q8FL31 8.08e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B5YZH0 8.63e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X930 8.63e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O157:H7
B6HZA8 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli (strain SE11)
P31663 9.12e-130 372 62 0 282 1 panC Pantothenate synthetase Escherichia coli (strain K12)
A7ZW82 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O9:H4 (strain HS)
B1XCA8 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli (strain K12 / DH10B)
C4ZRM6 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M174 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O8 (strain IAI1)
B7LGJ5 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli (strain 55989 / EAEC)
A7ZHM3 9.12e-130 372 62 0 282 3 panC Pantothenate synthetase Escherichia coli O139:H28 (strain E24377A / ETEC)
A6T4S9 1.14e-129 372 62 0 282 3 panC Pantothenate synthetase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4SUA7 1.56e-129 372 62 0 282 3 panC Pantothenate synthetase Salmonella newport (strain SL254)
B7LW40 1.98e-129 371 61 0 282 3 panC Pantothenate synthetase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NI93 1.98e-129 371 61 0 282 3 panC Pantothenate synthetase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B4TK04 2.05e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella heidelberg (strain SL476)
B1IQK7 2.26e-129 371 62 0 282 3 panC Pantothenate synthetase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8ZRR1 2.27e-129 371 62 0 282 1 panC Pantothenate synthetase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q5P3 2.34e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella paratyphi C (strain RKS4594)
B5RHC0 2.34e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R3E5 2.34e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella enteritidis PT4 (strain P125109)
B5FIX7 2.34e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella dublin (strain CT_02021853)
Q57T74 2.34e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella choleraesuis (strain SC-B67)
Q3Z5M7 2.41e-129 371 62 0 282 3 panC Pantothenate synthetase Shigella sonnei (strain Ss046)
Q326A4 2.41e-129 371 62 0 282 3 panC Pantothenate synthetase Shigella boydii serotype 4 (strain Sb227)
B2U2Y0 2.41e-129 371 62 0 282 3 panC Pantothenate synthetase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q0TLJ9 3.28e-129 371 61 0 282 3 panC Pantothenate synthetase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MNZ5 3.28e-129 371 61 0 282 3 panC Pantothenate synthetase Escherichia coli O81 (strain ED1a)
B2VD18 3.43e-129 371 62 0 282 3 panC Pantothenate synthetase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5BL64 3.83e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella paratyphi A (strain AKU_12601)
Q5PDB8 3.83e-129 371 62 0 282 3 panC Pantothenate synthetase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1RG57 4.04e-129 370 61 0 282 3 panC Pantothenate synthetase Escherichia coli (strain UTI89 / UPEC)
A1A7H9 4.04e-129 370 61 0 282 3 panC Pantothenate synthetase Escherichia coli O1:K1 / APEC
B7UII1 4.04e-129 370 61 0 282 3 panC Pantothenate synthetase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LGT5 4.55e-129 370 61 0 282 3 panC Pantothenate synthetase Escherichia coli (strain SMS-3-5 / SECEC)
Q32JW8 9.48e-129 370 62 0 282 3 panC Pantothenate synthetase Shigella dysenteriae serotype 1 (strain Sd197)
B5F832 2.51e-128 369 61 0 282 3 panC Pantothenate synthetase Salmonella agona (strain SL483)
Q8Z9D3 2.81e-128 369 61 0 282 3 panC Pantothenate synthetase Salmonella typhi
B4TXN3 1.03e-127 367 61 0 282 3 panC Pantothenate synthetase Salmonella schwarzengrund (strain CVM19633)
A9MZT0 1.03e-127 367 61 0 282 3 panC Pantothenate synthetase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B1JK36 5.81e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EG4 5.81e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K533 5.81e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FM23 5.81e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPV4 9.1e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pestis (strain Pestoides F)
Q1CLW1 9.1e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1G3 9.1e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBK7 9.1e-127 365 61 0 282 1 panC Pantothenate synthetase Yersinia pestis
Q1C3V7 9.1e-127 365 61 0 282 3 panC Pantothenate synthetase Yersinia pestis bv. Antiqua (strain Antiqua)
C5B9K5 1.48e-126 364 60 0 282 3 panC Pantothenate synthetase Edwardsiella ictaluri (strain 93-146)
A9MPM2 6.58e-126 362 60 0 282 3 panC Pantothenate synthetase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MGP7 1.8e-125 362 61 0 283 3 panC Pantothenate synthetase Cronobacter sakazakii (strain ATCC BAA-894)
A4W6N7 1.57e-124 359 61 0 282 3 panC Pantothenate synthetase Enterobacter sp. (strain 638)
A8GIZ7 3.06e-124 358 60 0 283 3 panC Pantothenate synthetase Serratia proteamaculans (strain 568)
Q7MHV3 5.07e-114 333 58 0 274 3 panC Pantothenate synthetase Vibrio vulnificus (strain YJ016)
Q5E2T1 8.09e-114 332 57 0 282 3 panC Pantothenate synthetase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FB06 8.36e-114 332 57 0 282 3 panC Pantothenate synthetase Aliivibrio fischeri (strain MJ11)
Q2NVR3 9.04e-114 332 57 0 283 3 panC Pantothenate synthetase Sodalis glossinidius (strain morsitans)
Q8DC12 1.43e-113 332 58 0 274 3 panC Pantothenate synthetase Vibrio vulnificus (strain CMCP6)
A4SJ60 1.71e-112 328 56 0 282 3 panC Pantothenate synthetase Aeromonas salmonicida (strain A449)
A7MYX3 2.27e-112 329 56 0 274 3 panC Pantothenate synthetase Vibrio campbellii (strain ATCC BAA-1116)
C3LS81 3.97e-112 328 56 0 282 3 panC Pantothenate synthetase Vibrio cholerae serotype O1 (strain M66-2)
Q9KUD1 3.97e-112 328 56 0 282 3 panC Pantothenate synthetase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F974 3.97e-112 328 56 0 282 3 panC Pantothenate synthetase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q87LV1 1.97e-111 327 56 0 274 3 panC Pantothenate synthetase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B6ELE2 2.08e-111 326 55 0 282 3 panC Pantothenate synthetase Aliivibrio salmonicida (strain LFI1238)
C4L930 8.13e-111 324 58 1 283 3 panC Pantothenate synthetase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LMJ5 1.69e-109 321 55 0 274 3 panC Pantothenate synthetase Photobacterium profundum (strain SS9)
A0KP08 6.33e-109 320 55 0 282 3 panC Pantothenate synthetase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1SSG8 8.57e-107 314 55 0 282 3 panC Pantothenate synthetase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B7VK04 1.93e-106 313 53 0 274 3 panC Pantothenate synthetase Vibrio atlanticus (strain LGP32)
Q09673 6.36e-105 309 51 0 282 3 pan6 Pantoate--beta-alanine ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8D7A0 3.08e-102 303 50 1 283 3 panC Pantothenate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57292 9.16e-102 301 50 1 283 3 panC Pantothenate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8Z5 9.16e-102 301 50 1 283 3 panC Pantothenate synthetase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q1LTN0 1.36e-100 298 52 0 282 3 panC Pantothenate synthetase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q48N87 4.13e-100 297 53 0 277 3 panC Pantothenate synthetase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZY87 4.65e-100 297 54 0 277 3 panC Pantothenate synthetase Pseudomonas syringae pv. syringae (strain B728a)
Q888Q6 6.38e-98 291 53 0 277 3 panC Pantothenate synthetase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3K6Q5 6.89e-97 289 52 0 282 3 panC Pantothenate synthetase Pseudomonas fluorescens (strain Pf0-1)
Q3ILL1 8.19e-97 289 53 0 271 3 panC Pantothenate synthetase Pseudoalteromonas translucida (strain TAC 125)
C1DFJ9 1.38e-95 286 50 0 283 3 panC Pantothenate synthetase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B1J2C1 1.29e-94 283 52 0 282 3 panC Pantothenate synthetase Pseudomonas putida (strain W619)
Q4K5Y3 4.68e-94 282 51 0 282 3 panC Pantothenate synthetase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B4RYN9 5.88e-94 281 47 0 281 3 panC1 Pantothenate synthetase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q47W59 7.73e-94 281 50 1 278 3 panC Pantothenate synthetase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A4VPM7 5.68e-93 279 50 0 282 3 panC Pantothenate synthetase Stutzerimonas stutzeri (strain A1501)
Q1QSZ8 1.27e-92 278 50 1 282 3 panC Pantothenate synthetase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1I4P1 1.75e-92 278 51 0 277 3 panC Pantothenate synthetase Pseudomonas entomophila (strain L48)
Q88DW8 4.66e-92 277 51 0 277 3 panC Pantothenate synthetase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KHW5 8.67e-92 276 50 0 282 3 panC Pantothenate synthetase Pseudomonas putida (strain GB-1)
B7V1E2 1.13e-91 276 49 0 282 3 panC Pantothenate synthetase Pseudomonas aeruginosa (strain LESB58)
A5W975 1.37e-91 276 50 0 277 3 panC Pantothenate synthetase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9HV69 3.14e-91 275 49 0 282 3 panC Pantothenate synthetase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FU2 3.14e-91 275 49 0 282 3 panC Pantothenate synthetase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9ZEP7 5.13e-91 274 50 0 282 3 panC Pantothenate synthetase Pseudomonas fluorescens (strain SBW25)
A6VCI6 5.35e-91 274 49 0 282 3 panC Pantothenate synthetase Pseudomonas aeruginosa (strain PA7)
Q15NV6 1.54e-90 273 48 0 282 3 panC Pantothenate synthetase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0TTI1 6.22e-90 271 48 1 282 3 panC Pantothenate synthetase Shewanella halifaxensis (strain HAW-EB4)
A1TYE5 7.48e-90 271 49 0 272 3 panC Pantothenate synthetase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8K9U7 1.04e-89 271 49 1 259 3 panC Pantothenate synthetase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q0AB68 7.06e-89 269 47 0 282 3 panC Pantothenate synthetase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A4XYC5 1e-88 268 50 0 283 3 panC Pantothenate synthetase Pseudomonas mendocina (strain ymp)
Q3JCP8 1.86e-88 268 48 0 282 3 panC Pantothenate synthetase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B8CTC7 2.91e-88 267 47 1 282 3 panC Pantothenate synthetase Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KEP7 2.41e-87 265 51 2 269 3 panC Pantothenate synthetase Shewanella woodyi (strain ATCC 51908 / MS32)
A8G085 3.13e-87 264 48 1 268 3 panC Pantothenate synthetase Shewanella sediminis (strain HAW-EB3)
Q31FF6 6.49e-87 263 45 1 283 3 panC Pantothenate synthetase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A3D8A9 4.32e-86 261 51 1 268 3 panC Pantothenate synthetase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L2H4 1.04e-85 260 51 1 268 3 panC Pantothenate synthetase Shewanella baltica (strain OS195)
A6WJK9 1.15e-85 260 51 1 268 3 panC Pantothenate synthetase Shewanella baltica (strain OS185)
B8EDX3 1.51e-85 260 51 1 268 3 panC Pantothenate synthetase Shewanella baltica (strain OS223)
A8H0D3 2.6e-85 259 45 1 282 3 panC Pantothenate synthetase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q2S8W2 3.1e-85 259 47 0 282 3 panC Pantothenate synthetase Hahella chejuensis (strain KCTC 2396)
Q12JC5 6.15e-85 258 47 1 268 3 panC Pantothenate synthetase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q5F9F8 1.31e-84 258 50 2 282 3 panC Pantothenate synthetase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A6W2I4 1.44e-84 258 46 0 282 3 panC Pantothenate synthetase Marinomonas sp. (strain MWYL1)
Q07XZ7 1.99e-84 257 46 1 281 3 panC Pantothenate synthetase Shewanella frigidimarina (strain NCIMB 400)
Q5QVR4 3.15e-84 256 48 1 269 3 panC Pantothenate synthetase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B3PCR5 3.67e-84 256 46 0 273 3 panC Pantothenate synthetase Cellvibrio japonicus (strain Ueda107)
A0L0R3 4.27e-84 256 50 1 268 3 panC Pantothenate synthetase Shewanella sp. (strain ANA-3)
Q605G9 6.31e-84 256 47 0 282 3 panC Pantothenate synthetase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1RG66 7.29e-84 256 50 1 268 3 panC Pantothenate synthetase Shewanella sp. (strain W3-18-1)
A4YA62 7.29e-84 256 50 1 268 3 panC Pantothenate synthetase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q8EIH0 7.37e-84 256 48 1 268 3 panC Pantothenate synthetase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q21LV6 9.14e-84 256 46 0 274 3 panC Pantothenate synthetase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VSR4 1.63e-83 255 46 1 274 3 panC Pantothenate synthetase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P57036 3.21e-83 254 47 2 282 3 panC Pantothenate synthetase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A3QHQ2 4.25e-83 254 48 1 277 3 panC Pantothenate synthetase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1KTB2 4.35e-83 254 48 2 282 3 panC Pantothenate synthetase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q1IHA8 6.18e-83 254 46 2 278 3 panC Pantothenate synthetase Koribacter versatilis (strain Ellin345)
Q2RM60 4.22e-82 251 48 2 278 3 panC Pantothenate synthetase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q0HMB2 8.02e-82 251 48 1 268 3 panC Pantothenate synthetase Shewanella sp. (strain MR-4)
A1S3M6 1.46e-81 250 48 1 268 3 panC Pantothenate synthetase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0HRH5 1.96e-81 249 48 1 268 3 panC Pantothenate synthetase Shewanella sp. (strain MR-7)
P57035 5.76e-81 248 47 2 282 3 panC Pantothenate synthetase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q3A3I7 4.11e-80 246 47 2 264 3 panC Pantothenate synthetase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8D2A6 8.21e-80 246 43 1 264 3 panC Pantothenate synthetase Wigglesworthia glossinidia brevipalpis
A5WHC9 1.58e-79 245 49 4 266 3 panC Pantothenate synthetase Psychrobacter sp. (strain PRwf-1)
C1D7E9 2.16e-79 244 47 1 268 3 panC Pantothenate synthetase Laribacter hongkongensis (strain HLHK9)
A1WUU4 5.58e-79 243 48 4 275 3 panC Pantothenate synthetase Halorhodospira halophila (strain DSM 244 / SL1)
C5BN51 3.21e-78 241 46 0 274 3 panC Pantothenate synthetase Teredinibacter turnerae (strain ATCC 39867 / T7901)
B3E5L0 6.25e-78 241 47 2 269 3 panC Pantothenate synthetase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A1AUV7 8.46e-78 240 46 2 264 3 panC Pantothenate synthetase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A4XMZ3 1.16e-77 240 43 2 278 3 panC Pantothenate synthetase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A6UB63 2.21e-77 239 45 4 286 3 panC Pantothenate synthetase Sinorhizobium medicae (strain WSM419)
B7IE21 2.69e-77 239 43 1 277 3 panC Pantothenate synthetase Thermosipho africanus (strain TCF52B)
Q6F855 2.93e-77 239 49 4 262 3 panC Pantothenate synthetase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q92NN0 3.06e-77 239 45 4 286 3 panC Pantothenate synthetase Rhizobium meliloti (strain 1021)
C1F8U3 4.37e-77 239 47 4 270 3 panC Pantothenate synthetase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q9X0G6 8.6e-77 238 45 4 279 1 panC Pantothenate synthetase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5EKW3 9.15e-77 238 45 3 269 3 panC Pantothenate synthetase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B0TBP5 9.27e-77 238 47 2 265 3 panC Pantothenate synthetase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B0V5P7 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain AYE)
A3M294 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VKK3 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain SDF)
B2HTG5 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain ACICU)
B7I683 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain AB0057)
B7H010 1.13e-76 238 49 4 262 3 panC Pantothenate synthetase Acinetobacter baumannii (strain AB307-0294)
B8GNA8 1.25e-76 238 47 0 282 3 panC Pantothenate synthetase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A5IN99 1.43e-76 237 45 4 279 3 panC Pantothenate synthetase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B1L843 1.48e-76 237 45 4 279 3 panC Pantothenate synthetase Thermotoga sp. (strain RQ2)
Q4FVG7 4.9e-76 236 49 2 263 3 panC Pantothenate synthetase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B9JXS2 6.7e-76 236 42 2 283 3 panC Pantothenate synthetase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q82Y17 6.73e-76 235 46 2 267 3 panC Pantothenate synthetase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q1QEJ3 8.26e-76 235 46 3 271 3 panC Pantothenate synthetase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2JZU1 1.06e-75 235 43 2 273 3 panC Pantothenate synthetase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8PLL0 1.29e-75 234 46 1 268 3 panC Pantothenate synthetase Xanthomonas axonopodis pv. citri (strain 306)
O67891 1.55e-75 234 46 3 273 3 panC Pantothenate synthetase Aquifex aeolicus (strain VF5)
Q0B0P5 3.57e-75 234 45 3 279 3 panC Pantothenate synthetase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q7NXJ0 4.09e-75 233 45 2 280 3 panC Pantothenate synthetase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8G2J0 4.18e-75 234 43 3 283 3 panC Pantothenate synthetase Brucella suis biovar 1 (strain 1330)
A9M8B2 4.18e-75 234 43 3 283 3 panC Pantothenate synthetase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q1DAN8 5.79e-75 233 45 3 282 3 panC Pantothenate synthetase Myxococcus xanthus (strain DK1622)
B0CJW0 7.34e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VNS0 7.34e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YFC9 7.34e-75 233 43 3 283 1 panC Pantothenate synthetase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RH45 7.34e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella melitensis biotype 2 (strain ATCC 23457)
Q57F30 8.19e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella abortus biovar 1 (strain 9-941)
Q2YPI2 8.19e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella abortus (strain 2308)
B2S9H8 8.19e-75 233 43 3 283 3 panC Pantothenate synthetase Brucella abortus (strain S19)
B2V652 9.82e-75 233 43 2 263 3 panC Pantothenate synthetase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q3BUL5 1.33e-74 232 46 1 268 3 panC Pantothenate synthetase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
O86953 1.57e-74 232 45 4 279 3 panC Pantothenate synthetase Thermotoga neapolitana
B2UND0 2.17e-74 231 45 4 281 3 panC Pantothenate synthetase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
A3DDV6 3.04e-74 231 44 3 284 3 panC Pantothenate synthetase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B9ML77 3.57e-74 231 41 2 278 3 panC Pantothenate synthetase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B3R684 4.02e-74 231 48 5 266 3 panC Pantothenate synthetase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A6LNF3 4.75e-74 231 42 2 273 3 panC Pantothenate synthetase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5G3A1 5e-74 231 44 2 278 3 panC Pantothenate synthetase Geotalea uraniireducens (strain Rf4)
Q8UA92 6.04e-74 231 44 5 284 3 panC Pantothenate synthetase Agrobacterium fabrum (strain C58 / ATCC 33970)
B3QSB4 7.13e-74 230 43 3 286 3 panC Pantothenate synthetase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q6N528 8.31e-74 230 43 4 281 3 panC Pantothenate synthetase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7HND1 8.62e-74 230 44 2 269 3 panC Pantothenate synthetase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
Q1H3S1 8.74e-74 230 47 3 268 3 panC Pantothenate synthetase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2P378 9.41e-74 230 46 1 268 3 panC Pantothenate synthetase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4SRY4 9.73e-74 230 47 2 268 3 panC Pantothenate synthetase Stenotrophomonas maltophilia (strain R551-3)
Q3SH82 1.24e-73 229 45 4 283 3 panC Pantothenate synthetase Thiobacillus denitrificans (strain ATCC 25259)
Q5NL15 1.26e-73 230 44 3 283 3 panC Pantothenate synthetase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B0KC91 1.34e-73 229 44 2 278 3 panC Pantothenate synthetase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K364 1.72e-73 229 44 2 278 3 panC Pantothenate synthetase Thermoanaerobacter sp. (strain X514)
Q5H0A4 2.1e-73 229 46 1 268 3 panC Pantothenate synthetase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SJL9 2.1e-73 229 46 1 268 3 panC Pantothenate synthetase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2LSQ5 2.13e-73 229 44 2 263 3 panC Pantothenate synthetase Syntrophus aciditrophicus (strain SB)
Q2YAP0 3.01e-73 229 46 1 258 3 panC Pantothenate synthetase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5SHF5 5.04e-73 228 45 2 264 1 panC Pantothenate synthetase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72HS0 5.04e-73 228 45 2 264 3 panC Pantothenate synthetase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q1M4A1 7.1e-73 228 43 2 273 3 panC Pantothenate synthetase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A9IRN9 8e-73 228 43 3 278 3 panC Pantothenate synthetase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q74CG7 8.39e-73 228 43 2 278 3 panC Pantothenate synthetase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5FVZ7 9.33e-73 227 45 3 281 3 panC Pantothenate synthetase Acidiphilium cryptum (strain JF-5)
B5Y863 1.02e-72 228 43 3 281 3 panC Pantothenate synthetase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q0BCS8 1.17e-72 227 46 3 262 3 panC Pantothenate synthetase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B5E845 1.79e-72 226 44 3 278 3 panC Pantothenate synthetase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q3A9L1 1.79e-72 227 44 3 270 3 panC Pantothenate synthetase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q47B65 2.16e-72 226 45 2 264 3 panC Pantothenate synthetase Dechloromonas aromatica (strain RCB)
A4JGX1 2.79e-72 226 46 3 262 3 panC Pantothenate synthetase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B1YUT9 5.71e-72 225 45 3 262 3 panC Pantothenate synthetase Burkholderia ambifaria (strain MC40-6)
Q2N659 6.29e-72 225 45 5 289 3 panC Pantothenate synthetase Erythrobacter litoralis (strain HTCC2594)
Q0ADS3 9.54e-72 224 47 2 262 3 panC Pantothenate synthetase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B2FL68 1.08e-71 224 47 2 268 3 panC Pantothenate synthetase Stenotrophomonas maltophilia (strain K279a)
Q9AMR9 1.17e-71 224 44 4 285 3 panC1 Pantothenate synthetase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
C6E3N5 1.27e-71 224 46 2 255 3 panC Pantothenate synthetase Geobacter sp. (strain M21)
Q1GNR4 1.47e-71 224 46 3 282 3 panC Pantothenate synthetase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A1US39 2.28e-71 224 44 4 279 3 panC Pantothenate synthetase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q6G079 2.66e-71 224 43 4 277 3 panC Pantothenate synthetase Bartonella quintana (strain Toulouse)
Q07L39 2.68e-71 224 42 3 280 3 panC Pantothenate synthetase Rhodopseudomonas palustris (strain BisA53)
A9AHJ3 3.5e-71 223 46 4 263 3 panC Pantothenate synthetase Burkholderia multivorans (strain ATCC 17616 / 249)
A4G3S0 5.11e-71 223 46 3 263 3 panC Pantothenate synthetase Herminiimonas arsenicoxydans
Q251P2 7.04e-71 223 44 2 279 3 panC Pantothenate synthetase Desulfitobacterium hafniense (strain Y51)
B8FZE0 7.04e-71 223 44 2 279 3 panC Pantothenate synthetase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q0K7I6 8.56e-71 223 47 5 266 3 panC Pantothenate synthetase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8DG73 9.26e-71 229 47 2 256 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5NXQ2 9.96e-71 222 44 1 258 3 panC Pantothenate synthetase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A6SWZ8 1.12e-70 222 46 3 263 3 panC Pantothenate synthetase Janthinobacterium sp. (strain Marseille)
Q474Y3 1.27e-70 222 45 5 266 3 panC Pantothenate synthetase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LJM9 1.46e-70 222 45 4 264 3 panC Pantothenate synthetase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9PGR8 2.48e-70 221 45 3 273 3 panC Pantothenate synthetase Xylella fastidiosa (strain 9a5c)
Q8P9S9 2.5e-70 221 46 4 278 3 panC Pantothenate synthetase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RTU0 2.5e-70 221 46 4 278 3 panC Pantothenate synthetase Xanthomonas campestris pv. campestris (strain B100)
Q4UTV6 2.5e-70 221 46 4 278 3 panC Pantothenate synthetase Xanthomonas campestris pv. campestris (strain 8004)
B1JWS8 2.63e-70 221 45 3 262 3 panC Pantothenate synthetase Burkholderia orbicola (strain MC0-3)
Q1BUH1 2.97e-70 221 45 3 262 3 panC Pantothenate synthetase Burkholderia orbicola (strain AU 1054)
A0K9L5 2.97e-70 221 45 3 262 3 panC Pantothenate synthetase Burkholderia cenocepacia (strain HI2424)
B9JH26 3.13e-70 221 45 5 284 3 panC Pantothenate synthetase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B4E8E5 4.2e-70 221 45 3 262 3 panC Pantothenate synthetase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B0U1Q3 6.96e-70 220 45 3 273 3 panC Pantothenate synthetase Xylella fastidiosa (strain M12)
A6WW03 7.39e-70 220 41 3 285 3 panC Pantothenate synthetase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q39DU9 9.68e-70 219 45 3 262 3 panC Pantothenate synthetase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C0QHN3 9.71e-70 220 43 2 279 3 panC Pantothenate synthetase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A8LKA2 1.11e-69 219 44 4 266 3 panC Pantothenate synthetase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q8XWT3 1.96e-69 219 45 4 267 3 panC Pantothenate synthetase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q39V50 2.31e-69 219 43 2 278 3 panC Pantothenate synthetase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8I2Z3 3.04e-69 218 44 3 265 3 panC Pantothenate synthetase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q6G456 3.3e-69 218 41 3 278 1 panC Pantothenate synthetase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A5D5T5 4.12e-69 218 42 2 278 3 panC Pantothenate synthetase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A0LF67 4.34e-69 218 43 2 278 3 panC Pantothenate synthetase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q135F0 6.55e-69 218 41 3 280 3 panC Pantothenate synthetase Rhodopseudomonas palustris (strain BisB5)
Q211R2 7.46e-69 218 41 3 280 3 panC Pantothenate synthetase Rhodopseudomonas palustris (strain BisB18)
A4QAA5 7.68e-69 217 46 6 264 3 panC Pantothenate synthetase Corynebacterium glutamicum (strain R)
Q87EV9 8.25e-69 217 43 3 273 3 panC Pantothenate synthetase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I721 8.25e-69 217 43 3 273 3 panC Pantothenate synthetase Xylella fastidiosa (strain M23)
A7NG78 9.15e-69 217 44 2 255 3 panC Pantothenate synthetase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q1QKN4 1.21e-68 217 42 3 276 3 panC Pantothenate synthetase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q47KV5 1.62e-68 217 43 4 280 3 panC Pantothenate synthetase Thermobifida fusca (strain YX)
Q9X713 1.7e-68 216 46 6 264 1 panC Pantothenate synthetase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1KUY6 1.94e-68 216 42 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain Loch Maree / Type A3)
Q63W97 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia pseudomallei (strain K96243)
A3N6X2 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia pseudomallei (strain 668)
Q3JUY8 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia pseudomallei (strain 1710b)
A3NSK8 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia pseudomallei (strain 1106a)
A1V5W8 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia mallei (strain SAVP1)
Q62LE7 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia mallei (strain ATCC 23344)
A2SAF0 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia mallei (strain NCTC 10229)
A3MLN2 2.15e-68 216 46 4 263 3 panC Pantothenate synthetase Burkholderia mallei (strain NCTC 10247)
B5ES06 2.4e-68 216 45 2 259 3 panC Pantothenate synthetase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JBM7 2.4e-68 216 45 2 259 3 panC Pantothenate synthetase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A7FR59 3.03e-68 216 41 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain ATCC 19397 / Type A)
B2JEQ7 3.68e-68 216 45 4 261 3 panC Pantothenate synthetase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A1KAA6 3.77e-68 215 46 1 254 3 panC Pantothenate synthetase Azoarcus sp. (strain BH72)
C3MEL7 4.43e-68 216 42 3 283 3 panC Pantothenate synthetase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2G319 4.58e-68 216 45 4 279 3 panC Pantothenate synthetase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q7UTQ8 5.08e-68 215 43 2 272 3 panC Pantothenate synthetase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C3L034 5.81e-68 215 41 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain 657 / Type Ba4)
Q2IFU3 6.03e-68 215 47 3 270 3 panC Pantothenate synthetase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q11F81 6.94e-68 215 42 3 280 3 panC Pantothenate synthetase Chelativorans sp. (strain BNC1)
Q2T095 9.3e-68 214 45 4 263 1 panC Pantothenate synthetase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A4SWJ8 9.95e-68 214 47 5 267 3 panC Pantothenate synthetase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A7GAI5 2.38e-67 214 41 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A8F7T6 2.99e-67 213 41 5 279 3 panC Pantothenate synthetase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A5URA7 3e-67 213 42 4 278 3 panC Pantothenate synthetase Roseiflexus sp. (strain RS-1)
Q8KBY5 3.57e-67 213 40 4 281 3 panC Pantothenate synthetase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8FJ17 3.91e-67 213 41 2 279 3 panC Pantothenate synthetase Desulfatibacillum aliphaticivorans
B1HU20 4.2e-67 213 43 4 279 3 panC Pantothenate synthetase Lysinibacillus sphaericus (strain C3-41)
A8FEH6 4.48e-67 213 42 1 268 3 panC Pantothenate synthetase Bacillus pumilus (strain SAFR-032)
B1XVH8 4.69e-67 213 44 4 267 3 panC Pantothenate synthetase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B4SDX5 5.17e-67 213 42 4 272 3 panC Pantothenate synthetase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
P52998 5.84e-67 213 42 2 268 3 panC Pantothenate synthetase Bacillus subtilis (strain 168)
A5VA26 5.96e-67 213 43 3 281 3 panC Pantothenate synthetase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B9M2A2 6.09e-67 213 43 3 269 3 panC Pantothenate synthetase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A5CX21 6.36e-67 213 44 5 260 3 panC Pantothenate synthetase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q3SRX8 7.55e-67 212 43 3 258 3 panC Pantothenate synthetase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q16DW6 9.87e-67 212 42 3 279 3 panC Pantothenate synthetase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5Z2U3 1.06e-66 213 46 3 274 3 panC Pantothenate synthetase Nocardia farcinica (strain IFM 10152)
B1IEL5 1.08e-66 212 40 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain Okra / Type B1)
B1GZJ9 1.24e-66 212 41 3 278 3 panC Pantothenate synthetase Endomicrobium trichonymphae
Q18C33 1.25e-66 212 43 4 279 3 panC Pantothenate synthetase Clostridioides difficile (strain 630)
B9KLD3 1.32e-66 212 44 3 276 3 panC Pantothenate synthetase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q0C347 1.38e-66 212 44 4 285 3 panC Pantothenate synthetase Hyphomonas neptunium (strain ATCC 15444)
Q3APW7 1.52e-66 212 42 3 266 3 panC Pantothenate synthetase Chlorobium chlorochromatii (strain CaD3)
Q833S6 1.84e-66 211 40 2 278 3 panC Pantothenate synthetase Enterococcus faecalis (strain ATCC 700802 / V583)
Q9A6C8 1.93e-66 211 44 5 286 3 panC Pantothenate synthetase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A9B3W0 2.32e-66 211 40 3 267 3 panC Pantothenate synthetase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q8FUA6 3.6e-66 211 44 7 290 3 panC Pantothenate synthetase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
C1FS96 3.61e-66 211 41 2 278 3 panC Pantothenate synthetase Clostridium botulinum (strain Kyoto / Type A2)
Q89JV7 3.75e-66 211 42 3 280 3 panC2 Pantothenate synthetase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q0BU46 3.88e-66 211 40 3 279 3 panC Pantothenate synthetase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B5YJ91 4.03e-66 210 42 2 278 3 panC Pantothenate synthetase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q21U08 5.32e-66 210 42 6 290 3 panC Pantothenate synthetase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B9LIH9 5.45e-66 210 43 3 267 3 panC Pantothenate synthetase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WFR6 5.45e-66 210 43 3 267 3 panC Pantothenate synthetase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q5LWR2 5.95e-66 210 43 3 273 3 panC Pantothenate synthetase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q89ZR8 6.46e-66 210 41 5 284 3 panC Pantothenate synthetase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A1AW71 6.96e-66 210 44 4 258 3 panC Pantothenate synthetase Ruthia magnifica subsp. Calyptogena magnifica
Q311U9 7.54e-66 210 43 2 279 3 panC Pantothenate synthetase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q6ALV3 9.66e-66 209 41 3 274 3 panC Pantothenate synthetase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A0PXQ4 1.86e-65 209 42 2 269 3 panC Pantothenate synthetase Clostridium novyi (strain NT)
B2UA33 1.88e-65 209 43 4 267 3 panC Pantothenate synthetase Ralstonia pickettii (strain 12J)
Q2VZ00 2.07e-65 209 43 3 279 3 panC Pantothenate synthetase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A2SEX7 2.65e-65 208 44 6 276 3 panC Pantothenate synthetase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q97F38 3.12e-65 208 41 2 278 3 panC Pantothenate synthetase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A0L3M5 4.56e-65 208 43 2 263 3 panC Pantothenate synthetase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A1B2L1 4.69e-65 207 41 4 274 3 panC Pantothenate synthetase Paracoccus denitrificans (strain Pd 1222)
C6C1U6 5.34e-65 207 44 3 264 3 panC Pantothenate synthetase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q7VSV1 5.73e-65 207 45 4 260 3 panC Pantothenate synthetase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W3R4 5.73e-65 207 45 4 260 3 panC Pantothenate synthetase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WF42 5.73e-65 207 45 4 260 3 panC Pantothenate synthetase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2IXG7 6e-65 207 43 3 258 3 panC Pantothenate synthetase Rhodopseudomonas palustris (strain HaA2)
A5FR69 6.43e-65 207 43 4 276 3 panC Pantothenate synthetase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q2RP31 6.78e-65 207 43 4 273 3 panC Pantothenate synthetase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2JRH9 1.14e-64 214 43 4 281 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechococcus sp. (strain JA-3-3Ab)
Q1AT82 1.72e-64 207 43 3 270 3 panC Pantothenate synthetase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A9I1G8 2.01e-64 206 45 4 260 3 panC Pantothenate synthetase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q3Z8B3 2.33e-64 206 44 2 255 3 panC Pantothenate synthetase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A4SG25 2.7e-64 206 40 3 257 3 panC Pantothenate synthetase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q143J2 2.8e-64 206 44 3 261 3 panC Pantothenate synthetase Paraburkholderia xenovorans (strain LB400)
Q1B2L8 3.3e-64 206 45 5 269 3 panC Pantothenate synthetase Mycobacterium sp. (strain MCS)
A1UMI0 3.3e-64 206 45 5 269 3 panC Pantothenate synthetase Mycobacterium sp. (strain KMS)
A1SDW7 3.99e-64 207 45 6 266 3 panC Pantothenate synthetase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0PV50 4.12e-64 206 44 7 273 3 panC Pantothenate synthetase Mycobacterium ulcerans (strain Agy99)
Q8CR21 7.91e-64 205 41 2 276 3 panC Pantothenate synthetase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL36 7.91e-64 205 41 2 276 3 panC Pantothenate synthetase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3PGQ3 8.06e-64 204 43 3 276 3 panC Pantothenate synthetase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q1GLQ5 9.36e-64 204 43 6 283 3 panC Pantothenate synthetase Ruegeria sp. (strain TM1040)
A1TG35 9.49e-64 205 45 5 269 3 panC Pantothenate synthetase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q3ZXF9 9.53e-64 204 43 3 264 3 panC Pantothenate synthetase Dehalococcoides mccartyi (strain CBDB1)
A3Q6Y5 1.05e-63 205 45 5 269 3 panC Pantothenate synthetase Mycobacterium sp. (strain JLS)
A1R163 1.11e-63 204 43 6 294 3 panC Pantothenate synthetase Paenarthrobacter aurescens (strain TC1)
Q3J5N0 1.19e-63 204 43 3 276 3 panC Pantothenate synthetase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
C4XPZ7 1.31e-63 204 41 2 280 3 panC Pantothenate synthetase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B2T172 1.45e-63 204 44 3 261 3 panC Pantothenate synthetase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A6L8I6 1.46e-63 204 39 4 280 3 panC Pantothenate synthetase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q6ACQ8 1.51e-63 204 44 5 263 3 panC Pantothenate synthetase Leifsonia xyli subsp. xyli (strain CTCB07)
B8G643 1.91e-63 203 43 3 256 3 panC Pantothenate synthetase Chloroflexus aggregans (strain MD-66 / DSM 9485)
A0R580 2.25e-63 204 45 5 264 1 panC Pantothenate synthetase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4JXL9 2.37e-63 204 44 4 269 3 panC Pantothenate synthetase Corynebacterium jeikeium (strain K411)
Q5N530 3.22e-63 210 46 2 256 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31P38 3.22e-63 210 46 2 256 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4S5G6 3.43e-63 203 40 3 268 3 panC Pantothenate synthetase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A0JR91 4.18e-63 203 41 7 308 3 panC Pantothenate synthetase Arthrobacter sp. (strain FB24)
Q8YSZ3 4.23e-63 210 45 3 260 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3QM10 4.74e-63 202 40 4 280 3 panC Pantothenate synthetase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
C5D3B2 5.04e-63 202 39 2 271 3 panC Pantothenate synthetase Geobacillus sp. (strain WCH70)
Q3MEJ8 7.99e-63 209 45 3 260 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q0S8D5 8.84e-63 203 43 3 274 3 panC Pantothenate synthetase Rhodococcus jostii (strain RHA1)
B8DSC4 1.04e-62 202 40 2 279 3 panC Pantothenate synthetase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B1Y4K7 1.13e-62 202 41 4 284 3 panC Pantothenate synthetase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A4IQ60 1.34e-62 202 39 2 278 3 panC Pantothenate synthetase Geobacillus thermodenitrificans (strain NG80-2)
Q8F394 1.62e-62 201 38 2 283 3 panC Pantothenate synthetase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SD0 1.81e-62 201 40 2 271 3 panC Pantothenate synthetase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A6L4C3 2.19e-62 201 42 4 280 3 panC Pantothenate synthetase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
C5CWV0 2.57e-62 201 43 3 264 3 panC Pantothenate synthetase Variovorax paradoxus (strain S110)
Q3B2E3 2.99e-62 201 39 4 270 3 panC Pantothenate synthetase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q64XM3 3.17e-62 201 40 4 280 3 panC Pantothenate synthetase Bacteroides fragilis (strain YCH46)
Q5LGS1 3.45e-62 200 40 4 280 3 panC Pantothenate synthetase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B3EH07 4.18e-62 200 39 5 288 3 panC Pantothenate synthetase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
A4F6T0 4.79e-62 201 45 6 271 3 panC Pantothenate synthetase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A0QA93 6.91e-62 201 44 5 264 3 panC Pantothenate synthetase Mycobacterium avium (strain 104)
Q743Y5 6.98e-62 201 44 5 264 3 panC Pantothenate synthetase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q2S2P6 8.32e-62 200 43 4 270 3 panC Pantothenate synthetase Salinibacter ruber (strain DSM 13855 / M31)
O24035 9.76e-62 200 37 2 305 1 PANC Pantoate--beta-alanine ligase Lotus japonicus
A0AK06 1.04e-61 199 38 2 284 3 panC Pantothenate synthetase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92AA7 1.56e-61 199 37 2 284 3 panC Pantothenate synthetase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A9BV01 4.01e-61 197 43 4 265 3 panC Pantothenate synthetase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q5FQ88 4.02e-61 197 42 2 255 3 panC Pantothenate synthetase Gluconobacter oxydans (strain 621H)
C1KWK1 4.07e-61 198 37 2 284 3 panC Pantothenate synthetase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y602 4.3e-61 197 37 2 284 3 panC Pantothenate synthetase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q11NE6 5.67e-61 197 38 4 281 3 panC Pantothenate synthetase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6Q581 5.96e-61 197 42 7 270 3 panC Pantothenate synthetase Nitratiruptor sp. (strain SB155-2)
B8DC25 8.05e-61 197 37 2 284 3 panC Pantothenate synthetase Listeria monocytogenes serotype 4a (strain HCC23)
Q9PIK2 8.12e-61 197 38 3 278 1 panC Pantothenate synthetase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FK86 8.12e-61 197 38 3 278 3 panC Pantothenate synthetase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HWH4 1.04e-60 197 38 3 278 3 panC Pantothenate synthetase Campylobacter jejuni (strain RM1221)
Q4LA34 1.12e-60 196 41 4 277 3 panC Pantothenate synthetase Staphylococcus haemolyticus (strain JCSC1435)
Q9KC86 1.14e-60 196 40 2 278 3 panC Pantothenate synthetase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B0C6S1 1.23e-60 203 43 3 257 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Acaryochloris marina (strain MBIC 11017)
Q71YB4 1.32e-60 196 37 2 284 3 panC Pantothenate synthetase Listeria monocytogenes serotype 4b (strain F2365)
Q5KXX3 1.46e-60 197 39 2 283 3 panC Pantothenate synthetase Geobacillus kaustophilus (strain HTA426)
A9ETA6 1.8e-60 196 42 2 271 3 panC Pantothenate synthetase Sorangium cellulosum (strain So ce56)
Q55074 3.33e-60 202 40 3 267 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B6YS28 4.61e-60 195 38 6 282 3 panC Pantothenate synthetase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q65I57 5.11e-60 195 39 3 280 3 panC Pantothenate synthetase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A1VBJ2 5.98e-60 195 38 2 279 3 panC Pantothenate synthetase Nitratidesulfovibrio vulgaris (strain DP4)
Q729A4 5.98e-60 195 38 2 279 3 panC Pantothenate synthetase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VY17 6.68e-60 194 38 3 278 3 panC Pantothenate synthetase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A5GVR3 6.99e-60 201 41 2 267 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechococcus sp. (strain RCC307)
A7Z5Z3 1.26e-59 194 38 1 265 3 panC Pantothenate synthetase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q1J0L2 1.4e-59 194 42 3 261 3 panC Pantothenate synthetase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2JJ30 1.44e-59 201 41 4 281 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Synechococcus sp. (strain JA-2-3B'a(2-13))
A7H575 2.26e-59 193 38 3 265 3 panC Pantothenate synthetase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A0M787 2.43e-59 193 40 8 291 3 panC Pantothenate synthetase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A1BDY2 2.52e-59 193 38 4 283 3 panC Pantothenate synthetase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q98ND0 2.63e-59 193 40 2 278 3 panC Pantothenate synthetase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B9DKF5 3.02e-59 193 40 4 277 3 panC Pantothenate synthetase Staphylococcus carnosus (strain TM300)
Q2KUK2 5.47e-59 192 49 2 220 3 panC Pantothenate synthetase Bordetella avium (strain 197N)
C1EN37 5.86e-59 192 38 3 279 3 panC Pantothenate synthetase Bacillus cereus (strain 03BB102)
A0RBZ3 5.86e-59 192 38 3 279 3 panC Pantothenate synthetase Bacillus thuringiensis (strain Al Hakam)
Q9RV66 1.34e-58 191 43 4 267 3 panC Pantothenate synthetase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2YWG0 1.48e-58 191 40 4 282 3 panC Pantothenate synthetase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9FKB3 1.73e-58 192 37 1 297 1 At5g48840 Pantoate--beta-alanine ligase Arabidopsis thaliana
Q73AV3 1.96e-58 191 39 4 281 3 panC Pantothenate synthetase Bacillus cereus (strain ATCC 10987 / NRS 248)
A0LRC5 2.11e-58 191 42 3 258 3 panC Pantothenate synthetase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q5WGA4 3.26e-58 191 39 3 276 3 panC Pantothenate synthetase Shouchella clausii (strain KSM-K16)
Q6GDK5 3.74e-58 190 39 4 282 1 panC Pantothenate synthetase Staphylococcus aureus (strain MRSA252)
A1VKS2 4.35e-58 190 41 7 292 3 panC Pantothenate synthetase Polaromonas naphthalenivorans (strain CJ2)
Q81ST2 4.37e-58 190 38 3 279 3 panC Pantothenate synthetase Bacillus anthracis
C3L8P9 4.37e-58 190 38 3 279 3 panC Pantothenate synthetase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P5R0 4.37e-58 190 38 3 279 3 panC Pantothenate synthetase Bacillus anthracis (strain A0248)
B5Z6E3 4.46e-58 190 41 5 282 3 panC Pantothenate synthetase Helicobacter pylori (strain G27)
Q6HL15 5.08e-58 190 38 3 279 3 panC Pantothenate synthetase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JHQ7 5.08e-58 190 38 3 279 3 panC Pantothenate synthetase Bacillus cereus (strain AH820)
Q7NJM6 5.5e-58 196 40 4 281 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A8Z3J8 5.89e-58 189 39 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain USA300 / TCH1516)
A6QK85 5.89e-58 189 39 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain Newman)
Q5HCV4 5.89e-58 189 39 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain COL)
Q2FDR1 5.89e-58 189 39 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain USA300)
Q2FV22 7.71e-58 189 38 4 281 1 panC Pantothenate synthetase Staphylococcus aureus (strain NCTC 8325 / PS 47)
A9VMF0 9e-58 189 38 3 279 3 panC Pantothenate synthetase Bacillus mycoides (strain KBAB4)
Q110U9 9.99e-58 196 38 4 275 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Trichodesmium erythraeum (strain IMS101)
B9L5Y8 1.13e-57 189 41 4 255 3 panC Pantothenate synthetase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q8NUN2 1.2e-57 189 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain MW2)
Q6G678 1.2e-57 189 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain MSSA476)
Q7V9S8 1.66e-57 195 40 5 266 3 panC/cmk Bifunctional pantoate ligase/cytidylate kinase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A6Q719 2.03e-57 188 40 5 276 3 panC Pantothenate synthetase Sulfurovum sp. (strain NBC37-1)
Q1CVE9 2.06e-57 188 41 5 282 3 panC Pantothenate synthetase Helicobacter pylori (strain HPAG1)
Q050C4 2.28e-57 188 37 2 281 3 panC Pantothenate synthetase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04S98 2.28e-57 188 37 2 281 3 panC Pantothenate synthetase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q8CX59 2.73e-57 188 46 1 201 3 panC Pantothenate synthetase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C4L6Q1 3.39e-57 187 42 3 255 3 panC Pantothenate synthetase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q63DJ2 3.39e-57 187 38 3 279 3 panC Pantothenate synthetase Bacillus cereus (strain ZK / E33L)
Q82EC8 3.55e-57 189 48 4 208 3 panC Pantothenate synthetase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q6MHI2 3.9e-57 186 40 5 265 3 panC Pantothenate synthetase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
P65659 5.32e-57 187 38 2 276 1 panC Pantothenate synthetase Staphylococcus aureus (strain N315)
P65658 5.32e-57 187 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IW23 5.32e-57 187 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain JH9)
A6U4X8 5.32e-57 187 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain JH1)
A7X6X6 5.32e-57 187 38 2 276 3 panC Pantothenate synthetase Staphylococcus aureus (strain Mu3 / ATCC 700698)
B6JPA5 5.34e-57 187 40 5 282 3 panC Pantothenate synthetase Helicobacter pylori (strain P12)
A7GN77 5.76e-57 187 37 3 279 3 panC Pantothenate synthetase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O24210 7.63e-57 187 38 4 303 2 PANC Pantoate--beta-alanine ligase Oryza sativa subsp. japonica
Q0ANX4 8.04e-57 187 39 4 277 3 panC Pantothenate synthetase Maricaulis maris (strain MCS10)
Q7MAP3 1.32e-56 186 39 6 268 3 panC Pantothenate synthetase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q5P9T3 1.32e-56 186 39 1 256 3 panC Pantothenate synthetase Anaplasma marginale (strain St. Maries)
P56061 1.41e-56 186 41 5 282 3 panC Pantothenate synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
B7IPB8 1.57e-56 186 38 2 278 3 panC Pantothenate synthetase Bacillus cereus (strain G9842)
B7HHU4 1.75e-56 186 38 2 278 3 panC Pantothenate synthetase Bacillus cereus (strain B4264)
A8M8F3 1.87e-56 186 43 5 261 3 panC Pantothenate synthetase Salinispora arenicola (strain CNS-205)
Q0RC35 2.93e-56 186 37 4 289 3 panC3 Pantothenate synthetase 3 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q81FN6 3.53e-56 185 38 2 278 3 panC Pantothenate synthetase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P9WIL5 6.91e-56 185 49 2 185 1 panC Pantothenate synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIL4 6.91e-56 185 49 2 185 1 panC Pantothenate synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U8S7 6.91e-56 185 49 2 185 3 panC Pantothenate synthetase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KPT7 6.91e-56 185 49 2 185 3 panC Pantothenate synthetase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A5R1 6.91e-56 185 49 2 185 3 panC Pantothenate synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZN52 8.36e-56 184 40 5 282 3 panC Pantothenate synthetase Helicobacter pylori (strain J99 / ATCC 700824)
B9IVR2 1.63e-55 183 37 3 279 3 panC Pantothenate synthetase Bacillus cereus (strain Q1)
B7HL54 1.63e-55 183 37 3 279 3 panC Pantothenate synthetase Bacillus cereus (strain AH187)
B0SS40 1.75e-55 183 37 4 282 3 panC Pantothenate synthetase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S9F1 1.75e-55 183 37 4 282 3 panC Pantothenate synthetase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q17Z21 2.07e-55 183 41 5 282 3 panC Pantothenate synthetase Helicobacter acinonychis (strain Sheeba)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00940
Feature type CDS
Gene panC
Product pantoate--beta-alanine ligase
Location 231493 - 232344 (strand: -1)
Length 852 (nucleotides) / 283 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1363
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02569 Pantoate-beta-alanine ligase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0414 Coenzyme transport and metabolism (H) H Panthothenate synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MLIIETTLILRREIKRLKQEGKRIALVPTMGNLHQGHLKLIEEARIHADVVIASIFVNPMQFDREADLANYPRTLQEDCELLRDKHVDIVFAPSAKEMYPNGMENQTIVEVPVLSSVLEGASRPGHFRGVTTVVSKLFNLVQPDVALFGEKDYQQLQIIKKMVSDLCFDISIIPVPIVRDKTGLAFSSRNRLLSDNEKQQAPVLYQAMQQIAEQLKSGNLDVNQLLQTAKATLEQQGFRADECFICDAQTLAPLSEESRCAVILMAAWLGNTRLIDSQQVSLV

Flanking regions ( +/- flanking 50bp)

TAACTGATTTATCATTTAAATTCATTAAAATAGTTTAAAGGAGTCACGCTATGCTAATTATTGAAACAACGCTTATCTTACGCCGCGAAATTAAGCGACTAAAACAAGAAGGTAAACGCATTGCATTGGTTCCGACCATGGGCAACCTGCATCAAGGTCACCTAAAACTGATAGAAGAAGCGCGTATTCATGCTGATGTGGTTATCGCCTCTATTTTTGTTAATCCAATGCAATTCGATAGAGAAGCCGATTTAGCAAACTATCCACGAACCCTACAAGAAGATTGTGAGTTACTGCGCGATAAACATGTTGATATTGTCTTTGCCCCATCAGCGAAAGAGATGTACCCAAATGGGATGGAAAACCAAACGATTGTTGAGGTTCCAGTACTTTCTTCTGTGTTAGAAGGCGCTAGTCGCCCAGGACATTTCCGCGGTGTAACAACCGTTGTAAGTAAACTATTCAACCTTGTACAGCCTGATGTCGCGCTATTTGGTGAAAAAGATTATCAACAACTGCAGATCATAAAAAAAATGGTCAGTGATTTATGTTTTGATATCAGTATTATTCCAGTCCCTATTGTGCGTGATAAAACAGGATTGGCATTTAGCTCTCGAAATCGTTTGTTATCAGATAATGAAAAACAACAAGCCCCTGTGCTTTATCAAGCTATGCAACAGATAGCCGAGCAATTAAAATCGGGAAACCTTGATGTTAACCAACTATTACAAACTGCCAAAGCAACCCTTGAACAGCAAGGCTTTCGTGCTGATGAATGTTTTATTTGTGATGCACAAACACTAGCACCACTTAGCGAAGAGAGCCGATGTGCCGTTATTTTAATGGCAGCTTGGTTGGGTAACACTCGTTTAATCGATAGCCAACAAGTTAGCTTAGTCTAATGAATAATTAAAAATAGGAAACGCAACAATGCTACGCACCATGTTACAAG