Homologs in group_1722

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11720 FBDBKF_11720 61.9 Morganella morganii S1 fTR1 High-affinity Fe2+/Pb2+ permease
EHELCC_17640 EHELCC_17640 61.9 Morganella morganii S2 fTR1 High-affinity Fe2+/Pb2+ permease
NLDBIP_19310 NLDBIP_19310 61.9 Morganella morganii S4 fTR1 High-affinity Fe2+/Pb2+ permease
LHKJJB_18080 LHKJJB_18080 61.9 Morganella morganii S3 fTR1 High-affinity Fe2+/Pb2+ permease
HKOGLL_19000 HKOGLL_19000 61.9 Morganella morganii S5 fTR1 High-affinity Fe2+/Pb2+ permease
F4V73_RS07975 F4V73_RS07975 61.5 Morganella psychrotolerans - FTR1 family protein

Distribution of the homologs in the orthogroup group_1722

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1722

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q1CHD3 1e-13 72 25 4 266 3 efeU Ferrous iron permease EfeU Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WFU0 1e-13 72 25 4 266 3 efeU Ferrous iron permease EfeU Yersinia pestis
Q1C8M3 1e-13 72 25 4 266 3 efeU Ferrous iron permease EfeU Yersinia pestis bv. Antiqua (strain Antiqua)
Q66BP6 1.06e-13 72 25 4 266 3 efeU Ferrous iron permease EfeU Yersinia pseudotuberculosis serotype I (strain IP32953)
P72855 2.25e-11 66 24 9 290 3 slr0964 Uncharacterized protein slr0964 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P75901 1.11e-10 64 25 5 246 5 efeU Putative inactive ferrous iron permease EfeU Escherichia coli (strain K12)
O30083 1.19e-10 63 28 9 253 3 AF_0154 Uncharacterized protein AF_0154 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1RDK0 1.93e-10 63 25 4 244 3 efeU Ferrous iron permease EfeU Escherichia coli (strain UTI89 / UPEC)
Q0TJ50 1.93e-10 63 25 4 244 3 efeU Ferrous iron permease EfeU Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z398 2.41e-10 63 25 4 244 3 efeU Ferrous iron permease EfeU Shigella sonnei (strain Ss046)
Q8XAS8 2.41e-10 63 25 4 244 1 efeU Ferrous iron permease EfeU Escherichia coli O157:H7
Q8FJ36 1.06e-09 61 24 4 247 1 efeU Ferrous iron permease EfeU Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0T618 1.62e-08 57 24 3 185 3 efeU Ferrous iron permease EfeU Shigella flexneri serotype 5b (strain 8401)
Q83LK5 1.64e-08 57 24 3 185 3 efeU Ferrous iron permease EfeU Shigella flexneri
E9QT42 1.65e-08 58 24 6 229 2 ftrA High affinity iron permease ftrA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
I1BRD6 4.77e-08 57 21 10 298 1 ftr1 High affinity iron permease 1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P40088 7.49e-08 56 20 4 217 1 FTR1 Plasma membrane iron permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
K7ND00 2.16e-07 55 21 9 316 2 ftrA High affinity iron permease ftrA Epichloe festucae (strain E2368)
P39595 9.43e-05 47 23 6 206 1 efeU Iron permease EfeU Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00845
Feature type CDS
Gene -
Product FTR1 family protein
Location 211703 - 212539 (strand: -1)
Length 837 (nucleotides) / 278 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1722
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03239 Iron permease FTR1 family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0672 Inorganic ion transport and metabolism (P) P High-affinity Fe2+/Pb2+ permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07243 high-affinity iron transporter - -

Protein Sequence

MGQVLFVVWRESFEALLVVGIIYAWIKRSPTPKQGMKYLWGGVIVGILLSILLALSIYGVFSSLEDIWQSLFMVMMEIIACLLIVQMVYWMNKQGKSLKANIENELTQKTQQQSVWGILLIIAIAIAREGSEVVVFLSSHIMALTAQTALSFLIEVFIGLLIAGLTLWLFLLTSKMISWRKFFVITGFLLLFLAVSLLLKAVEEIANLLIEMDIELPDFLIYPLWDLSHILDDSSIFGNFLVSFFAYRSQPIGLSVVTFIVFWLVVALLFKQGDRHAK

Flanking regions ( +/- flanking 50bp)

CTGTCTCACCCTCAAGGTGAAATCGTTGCGACTGAAAAGGCTGAATAAATATGGGACAAGTTCTATTTGTTGTTTGGCGAGAAAGTTTTGAAGCTCTGCTGGTGGTAGGGATCATTTATGCATGGATAAAACGCTCTCCTACCCCTAAACAAGGTATGAAATATCTCTGGGGAGGAGTAATAGTAGGAATACTACTCTCTATTCTTTTAGCTCTTAGCATTTATGGGGTATTTAGCTCCTTAGAAGATATCTGGCAATCTCTGTTTATGGTTATGATGGAAATCATTGCCTGCCTATTAATTGTTCAGATGGTCTATTGGATGAACAAACAAGGTAAATCACTAAAAGCCAATATCGAAAACGAATTGACACAAAAAACGCAACAACAAAGTGTCTGGGGGATTTTACTGATCATCGCCATTGCCATTGCGAGAGAAGGCAGCGAAGTGGTTGTTTTCCTATCAAGCCATATTATGGCTCTCACAGCACAAACCGCGTTGTCTTTCTTGATTGAAGTATTCATTGGCCTATTGATAGCGGGACTAACTCTATGGTTATTTTTGCTAACATCAAAAATGATTTCTTGGCGTAAATTCTTTGTTATTACCGGATTTTTACTGCTTTTCCTCGCCGTTTCCTTGCTATTAAAAGCAGTAGAAGAGATAGCTAATCTACTTATTGAAATGGATATTGAATTACCTGACTTTTTGATTTATCCACTATGGGATCTTAGCCATATTTTGGATGATTCAAGCATTTTTGGTAATTTCTTAGTTTCATTCTTTGCTTATCGCTCACAACCCATCGGTTTAAGTGTTGTTACTTTTATTGTGTTTTGGTTGGTGGTCGCACTGTTATTTAAACAAGGGGATCGTCATGCCAAATAGCGCCCTATTGAAAGGTGATCATATTGTCATCTTGCTATTGATATCGCTAT