Homologs in group_364

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13105 FBDBKF_13105 99.4 Morganella morganii S1 - ClpP-like prohead protease/major capsid protein fusion protein
EHELCC_19450 EHELCC_19450 99.4 Morganella morganii S2 - ClpP-like prohead protease/major capsid protein fusion protein
NLDBIP_19880 NLDBIP_19880 99.4 Morganella morganii S4 - ClpP-like prohead protease/major capsid protein fusion protein
LHKJJB_19780 LHKJJB_19780 100.0 Morganella morganii S3 - ClpP-like prohead protease/major capsid protein fusion protein
LHKJJB_19845 LHKJJB_19845 99.4 Morganella morganii S3 - ClpP-like prohead protease/major capsid protein fusion protein
HKOGLL_05965 HKOGLL_05965 99.4 Morganella morganii S5 - ClpP-like prohead protease/major capsid protein fusion protein
F4V73_RS02100 F4V73_RS02100 84.1 Morganella psychrotolerans - Clp protease ClpP

Distribution of the homologs in the orthogroup group_364

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_364

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q982V6 1.21e-15 79 35 1 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q28NI7 5.12e-15 77 33 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Jannaschia sp. (strain CCS1)
Q6ME32 8.7e-15 77 31 7 194 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Protochlamydia amoebophila (strain UWE25)
Q0AQ07 1.64e-14 76 31 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Maricaulis maris (strain MCS10)
C4Z1T6 2.17e-14 75 33 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q5SKM8 3.44e-14 75 33 2 133 1 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72L15 3.44e-14 75 33 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A9IR54 4.39e-14 75 32 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q27539 4.43e-14 75 32 2 131 1 clpp-1 ATP-dependent Clp protease proteolytic subunit 1, mitochondrial Caenorhabditis elegans
B8GX16 4.76e-14 75 32 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAU1 4.76e-14 75 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2RZ59 8.06e-14 75 32 1 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Salinibacter ruber (strain DSM 13855 / M31)
Q98M38 8.13e-14 74 29 2 134 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8UFY6 9.1e-14 74 32 1 138 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7VXI7 9.12e-14 74 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8X2 9.12e-14 74 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK83 9.12e-14 74 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A8WPG6 9.56e-14 74 32 2 131 3 clpp-1 ATP-dependent Clp protease proteolytic subunit 1, mitochondrial Caenorhabditis briggsae
Q2L256 9.93e-14 73 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella avium (strain 197N)
Q1MIM7 9.93e-14 73 33 1 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B0SZQ2 1.13e-13 73 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter sp. (strain K31)
Q73M38 1.53e-13 73 31 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P58278 1.61e-13 73 31 2 141 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium meliloti (strain 1021)
Q165F9 2.42e-13 72 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9RSZ7 2.46e-13 72 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q11J60 2.85e-13 72 31 1 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chelativorans sp. (strain BNC1)
Q2K9U7 3.97e-13 72 32 1 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A6SY74 4.29e-13 72 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Janthinobacterium sp. (strain Marseille)
Q8G0I4 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis biovar 1 (strain 1330)
B0CGR1 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M5C2 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9L7X6 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus biovar 1 (strain 9-941)
Q2YPX1 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain 2308)
B2S5W1 4.33e-13 72 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain S19)
Q3AJN8 4.77e-13 71 32 2 140 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9605)
Q3AY04 8.29e-13 71 32 2 140 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9902)
C4ZGF4 1.01e-12 70 35 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q9K888 1.05e-12 70 30 2 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2G3T3 1.09e-12 71 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q9X6W8 1.2e-12 70 33 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Azospirillum brasilense
B9KJU9 1.43e-12 70 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J1G6 1.43e-12 70 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PKS1 1.43e-12 70 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8RC25 1.71e-12 70 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q07NN6 2.41e-12 70 31 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisA53)
C5BTJ0 2.48e-12 70 33 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q8YHC8 2.51e-12 70 31 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJ81 2.51e-12 70 31 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 2 (strain ATCC 23457)
Q13UT1 2.64e-12 70 29 2 140 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Paraburkholderia xenovorans (strain LB400)
A8LJA8 2.92e-12 69 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A3DJ10 3.08e-12 69 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q83G48 3.23e-12 68 32 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Tropheryma whipplei (strain Twist)
Q83I19 3.23e-12 68 32 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Tropheryma whipplei (strain TW08/27)
Q9PJW1 3.32e-12 69 33 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia muridarum (strain MoPn / Nigg)
Q3A3X5 3.33e-12 69 32 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P38002 4.3e-12 68 33 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLR9 4.3e-12 68 33 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q89KG1 4.34e-12 69 30 1 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B1MXG9 4.48e-12 68 34 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Leuconostoc citreum (strain KM20)
Q5L6P3 5e-12 68 32 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia abortus (strain DSM 27085 / S26/3)
B0B803 5.05e-12 68 33 3 131 1 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A4WSH8 5.06e-12 69 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q1GGF6 5.2e-12 68 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria sp. (strain TM1040)
B1LW28 5.41e-12 68 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A9W5F5 5.73e-12 68 31 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain PA1)
B7KNT0 5.73e-12 68 31 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B1Z9C7 6.93e-12 68 31 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q2IWZ4 7.38e-12 68 31 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain HaA2)
Q2W3H9 7.7e-12 68 29 5 164 3 clpP ATP-dependent Clp protease proteolytic subunit Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q215J2 7.75e-12 68 30 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB18)
Q7VRH1 8.21e-12 68 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Blochmanniella floridana
A7ILC6 8.59e-12 68 30 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
O30612 8.8e-12 68 30 2 139 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus (strain DK1622)
Q1MK43 8.88e-12 68 30 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2S2L8 1.02e-11 68 29 2 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Salinibacter ruber (strain DSM 13855 / M31)
B4EU53 1.07e-11 68 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Proteus mirabilis (strain HI4320)
Q3SRD2 1.16e-11 68 31 4 156 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q5LUQ0 1.26e-11 67 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5PBD0 1.34e-11 68 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain St. Maries)
B9KHZ4 1.34e-11 68 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain Florida)
Q1QL76 1.35e-11 67 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q6G178 1.38e-11 67 32 2 130 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella quintana (strain Toulouse)
Q7UK66 1.42e-11 67 29 2 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A6TM61 1.43e-11 67 28 4 163 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus metalliredigens (strain QYMF)
O83520 1.5e-11 67 28 2 129 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema pallidum (strain Nichols)
Q6AFZ8 1.53e-11 67 31 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Leifsonia xyli subsp. xyli (strain CTCB07)
Q135W7 1.84e-11 67 30 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB5)
Q4L4J5 2.13e-11 67 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus haemolyticus (strain JCSC1435)
B1Y6H3 2.28e-11 67 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
P58277 2.34e-11 67 29 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium meliloti (strain 1021)
A9ISA4 2.37e-11 67 32 2 130 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q5HBX5 2.46e-11 67 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Welgevonden)
Q5FFG7 2.53e-11 67 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Gardel)
B6JGU7 2.53e-11 67 29 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q253I5 2.65e-11 66 32 3 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia felis (strain Fe/C-56)
Q8M9Y9 2.73e-11 66 34 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Chaetosphaeridium globosum
Q13Z15 2.89e-11 67 32 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Paraburkholderia xenovorans (strain LB400)
B3Q7P5 3.2e-11 67 29 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain TIE-1)
Q6N5L3 3.2e-11 67 29 2 155 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B9DJL4 3.37e-11 66 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus carnosus (strain TM300)
A4JF05 3.46e-11 67 32 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q6G3Z3 3.77e-11 66 31 2 130 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q49VZ2 3.77e-11 66 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5L8L6 3.82e-11 66 29 3 151 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q09MF2 3.88e-11 66 33 3 130 3 clpP ATP-dependent Clp protease proteolytic subunit Citrus sinensis
P54416 4.56e-11 66 32 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q472D3 4.6e-11 66 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0ZIZ4 4.7e-11 65 34 3 130 3 clpP ATP-dependent Clp protease proteolytic subunit Vitis vinifera
Q9MUV8 4.72e-11 66 28 2 142 3 clpP ATP-dependent Clp protease proteolytic subunit Mesostigma viride
A8ZXB7 4.76e-11 66 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q21KA9 4.81e-11 66 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q64NW2 4.97e-11 66 29 3 151 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides fragilis (strain YCH46)
Q59993 5.13e-11 66 31 4 135 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A8HYF2 5.15e-11 66 30 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q47MU2 5.29e-11 65 30 3 150 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Thermobifida fusca (strain YX)
A3CPK8 5.79e-11 65 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus sanguinis (strain SK36)
B9EAG5 5.9e-11 65 31 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Macrococcus caseolyticus (strain JCSC5402)
A7Z939 5.95e-11 65 32 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A4W2X9 6.07e-11 65 35 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus suis (strain 98HAH33)
Q7V1W0 6.07e-11 65 31 2 137 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B3R4W1 6.16e-11 66 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0KBK4 6.16e-11 66 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P80244 6.24e-11 65 32 4 136 1 clpP ATP-dependent Clp protease proteolytic subunit Bacillus subtilis (strain 168)
A8MIS8 6.49e-11 65 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus oremlandii (strain OhILAs)
Q2KAB9 6.84e-11 65 29 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1WTA8 7.07e-11 65 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Ligilactobacillus salivarius (strain UCC118)
Q9TL09 7.69e-11 65 29 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Nephroselmis olivacea
Q7V7R2 7.84e-11 65 30 2 139 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain MIT 9313)
Q7U6N7 7.99e-11 65 30 2 139 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Parasynechococcus marenigrum (strain WH8102)
A1BI15 8.19e-11 65 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q1LM62 8.34e-11 65 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P56317 9.11e-11 65 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorella vulgaris
Q824C7 9.32e-11 65 32 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q5FUR3 9.36e-11 65 28 4 163 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gluconobacter oxydans (strain 621H)
B5YI38 9.49e-11 65 29 2 136 3 clpP ATP-dependent Clp protease proteolytic subunit Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q21Y67 9.72e-11 65 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q20F17 1.03e-10 65 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Oltmannsiellopsis viridis
Q8UEX6 1.05e-10 65 29 1 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3B5V8 1.06e-10 65 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A6YG63 1.13e-10 64 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Pleurastrum terricola
Q1BH85 1.2e-10 65 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia orbicola (strain AU 1054)
Q0BEF6 1.2e-10 65 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K847 1.2e-10 65 31 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia cenocepacia (strain HI2424)
Q7VC22 1.21e-10 64 30 2 139 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4QLL9 1.23e-10 64 30 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Lobularia maritima
A4QKL7 1.23e-10 64 30 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Capsella bursa-pastoris
Q8D346 1.25e-10 64 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Wigglesworthia glossinidia brevipalpis
Q8CTE0 1.28e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW0 1.28e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q31BD5 1.29e-10 64 31 2 138 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain MIT 9312)
Q9X5N0 1.37e-10 64 29 2 134 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus
Q9XJ36 1.37e-10 66 25 3 156 1 CLPR2 ATP-dependent Clp protease proteolytic subunit-related protein 2, chloroplastic Arabidopsis thaliana
Q1DAT0 1.4e-10 64 29 2 134 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Myxococcus xanthus (strain DK1622)
B5EI27 1.44e-10 64 30 1 131 3 clpP ATP-dependent Clp protease proteolytic subunit Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q3YSQ3 1.55e-10 64 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia canis (strain Jake)
A8FHN9 1.55e-10 64 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus pumilus (strain SAFR-032)
Q7MX09 1.56e-10 65 27 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q9CJM2 1.57e-10 64 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Pasteurella multocida (strain Pm70)
A5EKA8 1.63e-10 64 29 1 133 3 clpP ATP-dependent Clp protease proteolytic subunit Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q9X7R9 1.64e-10 64 28 4 162 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8I8F5 1.68e-10 64 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
P63786 1.7e-10 64 31 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MW2)
A8Z045 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB62 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MSSA476)
Q6GIM3 1.7e-10 64 31 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MRSA252)
P99089 1.7e-10 64 31 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain N315)
P63785 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF76 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Newman)
Q5HHQ0 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain COL)
Q2YSF8 1.7e-10 64 31 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQX2 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH9)
Q2G036 1.7e-10 64 31 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIM5 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300)
A6TZP7 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH1)
A7WZR9 1.7e-10 64 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu3 / ATCC 700698)
C6E2T0 1.74e-10 64 30 1 131 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter sp. (strain M21)
Q1GPH5 1.77e-10 64 29 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
B8IN26 1.78e-10 64 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q3JRC9 1.82e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1710b)
Q62JK7 1.82e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain ATCC 23344)
Q2GFT8 1.82e-10 64 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A2SFB5 1.84e-10 64 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1L1D7 1.85e-10 64 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Loch Maree / Type A3)
Q63V41 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain K96243)
A3NAI5 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 668)
A3NWA6 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1106a)
A1V4X1 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain SAVP1)
A2SBG3 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10229)
A3MKJ8 1.98e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10247)
A8AYP9 1.99e-10 64 34 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B0K533 2.01e-10 64 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Thermoanaerobacter sp. (strain X514)
B0KBA4 2.01e-10 64 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A0LDT4 2.06e-10 64 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A4QLD1 2.11e-10 63 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Lepidium virginicum
Q1IWD9 2.12e-10 64 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A4QJV6 2.13e-10 63 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Olimarabidopsis pumila
A4QKV6 2.13e-10 63 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Crucihimalaya wallichii
A4QKD0 2.13e-10 63 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Barbarea verna
C1C691 2.15e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain 70585)
Q2SWQ6 2.2e-10 64 31 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2RU45 2.25e-10 64 30 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A1WR17 2.35e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Verminephrobacter eiseniae (strain EF01-2)
C1CQK8 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain Taiwan19F-14)
C1CD96 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain JJA)
P63788 2.38e-10 63 32 2 132 1 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2INC9 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain CGSP14)
P63787 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZN39 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IAS4 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain Hungary19A-6)
Q04LF4 2.38e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A5UHJ6 2.39e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain PittGG)
A5UE11 2.39e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain PittEE)
B2UX13 2.4e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Alaska E43 / Type E3)
B2A158 2.55e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q2GJB4 2.62e-10 63 29 3 148 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma phagocytophilum (strain HZ)
A1USA7 2.62e-10 64 32 2 130 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B2TPB9 2.64e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Eklund 17B / Type B)
Q1LTJ9 2.67e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Baumannia cicadellinicola subsp. Homalodisca coagulata
C0QGT0 3.17e-10 63 28 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
B3H252 3.33e-10 63 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q4FM94 3.33e-10 63 29 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Pelagibacter ubique (strain HTCC1062)
B9M0Y1 3.54e-10 63 30 1 130 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q67QZ4 3.57e-10 63 30 3 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8S8W2 3.66e-10 63 30 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Atropa belladonna
B0BQL3 3.66e-10 63 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N1T0 3.66e-10 63 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q39FE8 3.76e-10 63 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C1CJJ5 3.8e-10 63 32 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pneumoniae (strain P1031)
A5N2K8 3.8e-10 63 27 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E685 3.8e-10 63 27 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain NBRC 12016)
A4XHW0 3.84e-10 63 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A7GIH2 4.1e-10 63 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IND7 4.1e-10 63 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Okra / Type B1)
C1FLA6 4.1e-10 63 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Kyoto / Type A2)
A5I6W1 4.1e-10 63 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYI2 4.1e-10 63 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain ATCC 19397 / Type A)
Q8RHJ8 4.15e-10 63 31 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P30063 4.26e-10 63 32 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Epifagus virginiana
Q7VP78 4.42e-10 63 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q3ATL3 4.6e-10 63 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium chlorochromatii (strain CaD3)
A8F754 4.62e-10 63 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q3ZX82 4.79e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain CBDB1)
A5FRE5 4.79e-10 63 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q8ENM5 5.06e-10 62 27 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7V9L6 5.1e-10 63 30 2 135 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A4QJM4 5.66e-10 62 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Aethionema grandiflorum
A4QJE0 5.66e-10 62 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Aethionema cordifolium
Q8DLI2 5.73e-10 63 33 2 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7N0L3 6e-10 63 28 2 131 1 clpP ATP-dependent Clp protease proteolytic subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4GYT6 6.28e-10 62 32 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Populus trichocarpa
Q14FD2 6.28e-10 62 32 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Populus alba
Q3ZJ12 6.45e-10 62 27 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Tupiella akineta
Q8F352 6.51e-10 62 34 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SG6 6.51e-10 62 34 2 129 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
P43867 6.54e-10 62 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMK5 6.54e-10 62 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain 86-028NP)
Q837R0 6.64e-10 62 30 4 142 3 clpP ATP-dependent Clp protease proteolytic subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q0SGJ7 6.78e-10 62 30 2 148 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Rhodococcus jostii (strain RHA1)
Q6EW27 6.91e-10 62 34 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Nymphaea alba
A1XFY0 6.91e-10 62 34 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Nuphar advena
Q2JIP1 7.27e-10 62 30 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q03SM3 7.29e-10 62 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P56772 7.52e-10 62 30 7 184 1 clpP1 Chloroplastic ATP-dependent Clp protease proteolytic subunit 1 Arabidopsis thaliana
Q2JV68 8.38e-10 62 30 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-3-3Ab)
Q493F8 8.41e-10 62 27 3 146 3 clpP ATP-dependent Clp protease proteolytic subunit Blochmanniella pennsylvanica (strain BPEN)
Q8XYP7 8.61e-10 62 29 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3Z8J8 9.04e-10 62 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q73XM8 9.14e-10 62 29 3 141 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q11I48 9.42e-10 62 28 2 132 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chelativorans sp. (strain BNC1)
A6Q1C1 9.44e-10 62 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratiruptor sp. (strain SB155-2)
A4QLV8 9.81e-10 62 29 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Nasturtium officinale
Q9FN42 1.04e-09 63 30 2 133 1 CLPP2 ATP-dependent Clp protease proteolytic subunit 2, mitochondrial Arabidopsis thaliana
Q32RU0 1.06e-09 62 32 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Staurastrum punctulatum
A6Q675 1.07e-09 62 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Sulfurovum sp. (strain NBC37-1)
B2GAL4 1.08e-09 62 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A4QL44 1.09e-09 62 29 7 187 3 clpP ATP-dependent Clp protease proteolytic subunit Draba nemorosa
B1HVR0 1.17e-09 62 31 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Lysinibacillus sphaericus (strain C3-41)
Q31GF1 1.19e-09 62 30 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q48V25 1.26e-09 62 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q2KHU4 1.28e-09 63 32 3 137 2 CLPP ATP-dependent Clp protease proteolytic subunit, mitochondrial Bos taurus
Q72XW9 1.35e-09 61 29 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q0SGZ0 1.38e-09 61 28 3 142 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhodococcus jostii (strain RHA1)
B5XJZ8 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M49 (strain NZ131)
P0DA35 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RG72 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J887 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JID4 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JN83 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDA9 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M12 (strain MGAS2096)
P69886 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDM4 1.41e-09 61 32 2 134 1 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DA34 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P69884 1.41e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus pyogenes serotype M1
P9WPC5 1.41e-09 61 30 3 141 1 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPC4 1.41e-09 61 30 3 141 2 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A527 1.41e-09 61 30 3 141 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B1L812 1.43e-09 62 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga sp. (strain RQ2)
A5IJ91 1.43e-09 62 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZF9 1.43e-09 62 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q09WZ2 1.45e-09 61 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Morus indica
Q3BAL3 1.55e-09 61 34 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Phalaenopsis aphrodite subsp. formosana
Q8G5Q9 1.57e-09 61 30 1 130 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bifidobacterium longum (strain NCC 2705)
Q46L44 1.59e-09 61 30 1 130 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain NATL2A)
Q891J7 1.59e-09 61 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium tetani (strain Massachusetts / E88)
P24064 1.62e-09 62 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Triticum aestivum
A0A360 1.67e-09 61 29 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Coffea arabica
Q928C4 1.73e-09 61 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5NNY8 1.76e-09 61 30 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q05FR8 1.79e-09 61 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Carsonella ruddii (strain PV)
Q0P3P4 1.79e-09 61 29 6 184 3 clpP ATP-dependent Clp protease proteolytic subunit Ostreococcus tauri
A4QK43 1.8e-09 61 30 7 184 3 clpP ATP-dependent Clp protease proteolytic subunit Arabis hirsuta
B2FQR2 1.81e-09 61 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Stenotrophomonas maltophilia (strain K279a)
C0MGT5 1.82e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus equi subsp. zooepidemicus (strain H70)
C0M7M8 1.82e-09 61 32 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus equi subsp. equi (strain 4047)
Q39UH2 1.84e-09 61 30 1 130 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8DJZ9 1.85e-09 61 29 2 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5Z063 1.85e-09 61 30 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Nocardia farcinica (strain IFM 10152)
Q9RQI6 1.88e-09 61 32 2 131 1 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WV9 1.88e-09 61 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serotype 4b (strain F2365)
Q0ST53 2.06e-09 61 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain SM101 / Type A)
Q8XKK1 2.06e-09 61 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain 13 / Type A)
Q0TQK2 2.06e-09 61 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B3CLB1 2.08e-09 61 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A2T358 2.11e-09 61 32 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Angiopteris evecta
Q5WDK0 2.18e-09 61 27 2 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Shouchella clausii (strain KSM-K16)
P58276 2.18e-09 61 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q60107 2.23e-09 61 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia enterocolitica
A1JNN2 2.23e-09 61 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q19VC3 2.29e-09 61 28 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorokybus atmophyticus
B9MG14 2.32e-09 61 31 5 135 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax ebreus (strain TPSY)
Q9K709 2.38e-09 60 26 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P0C314 2.41e-09 61 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa subsp. japonica
P0C313 2.41e-09 61 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa subsp. indica
P0C312 2.41e-09 61 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza sativa
Q6ENE9 2.41e-09 61 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Oryza nivara
P48883 2.53e-09 61 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Hordeum vulgare
Q9SXJ6 2.61e-09 62 33 4 135 1 CLPP3 ATP-dependent Clp protease proteolytic subunit 3, chloroplastic Arabidopsis thaliana
A4SDA4 2.66e-09 61 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeovibrioides (strain DSM 265 / 1930)
A5GFA0 2.87e-09 60 29 1 130 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea uraniireducens (strain Rf4)
Q6HBD8 2.93e-09 60 28 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q631K2 2.93e-09 60 28 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ZK / E33L)
Q815J6 2.93e-09 60 28 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B2G613 3e-09 60 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VII4 3e-09 60 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri (strain DSM 20016)
Q88YH9 3.21e-09 60 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A0Q2L1 3.27e-09 60 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium novyi (strain NT)
Q3MFR5 3.31e-09 60 31 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q65EI5 3.32e-09 60 28 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q06GX2 3.39e-09 60 33 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Drimys granadensis
Q7VIN7 3.39e-09 60 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B9DTU8 3.49e-09 60 31 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q0AWF0 3.57e-09 60 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q68RY2 3.63e-09 60 30 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Panax ginseng
Q3M726 3.67e-09 60 30 2 131 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A6MMN2 3.97e-09 60 31 3 138 3 clpP ATP-dependent Clp protease proteolytic subunit Dioscorea elephantipes
Q16740 4.01e-09 61 32 3 137 1 CLPP ATP-dependent Clp protease proteolytic subunit, mitochondrial Homo sapiens
A1TM62 4.02e-09 60 30 5 136 3 clpP ATP-dependent Clp protease proteolytic subunit Paracidovorax citrulli (strain AAC00-1)
O88696 4.02e-09 61 32 3 137 1 Clpp ATP-dependent Clp protease proteolytic subunit, mitochondrial Mus musculus
B8IYM2 4.05e-09 60 29 2 140 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8YQX8 4.08e-09 61 30 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8A129 4.1e-09 60 27 3 151 3 clpP ATP-dependent Clp protease proteolytic subunit Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6MH11 4.17e-09 60 29 3 140 3 clpP ATP-dependent Clp protease proteolytic subunit Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q46ID4 4.2e-09 60 28 2 132 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain NATL2A)
A0LEF1 4.46e-09 60 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q74C82 4.7e-09 60 29 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8YXH5 4.74e-09 60 31 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5D447 4.93e-09 60 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A1W5B6 4.94e-09 60 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax sp. (strain JS42)
O67357 5e-09 60 28 2 133 1 clpP ATP-dependent Clp protease proteolytic subunit Aquifex aeolicus (strain VF5)
Q7YJV2 5.04e-09 60 32 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Calycanthus floridus var. glaucus
Q09G21 5.18e-09 60 32 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Platanus occidentalis
C1D539 5.18e-09 60 28 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Laribacter hongkongensis (strain HLHK9)
Q7M7M3 5.21e-09 60 29 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A1XGR3 5.24e-09 60 28 6 182 3 clpP ATP-dependent Clp protease proteolytic subunit Ranunculus macranthus
A1EA33 5.36e-09 60 28 2 145 3 clpP ATP-dependent Clp protease proteolytic subunit Agrostis stolonifera
Q5WLZ7 5.38e-09 60 31 5 164 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Shouchella clausii (strain KSM-K16)
Q9CBY3 5.72e-09 60 29 3 141 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mycobacterium leprae (strain TN)
Q81X63 5.86e-09 59 28 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus anthracis
Q2L926 5.88e-09 59 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Gossypium hirsutum
Q1MQ79 6.26e-09 60 28 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Lawsonia intracellularis (strain PHE/MN1-00)
Q06GN5 6.32e-09 60 33 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Piper cenocladum
Q73I59 6.34e-09 60 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis wMel
Q03GX1 6.57e-09 59 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A8EYM5 6.64e-09 59 28 2 142 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia canadensis (strain McKiel)
Q4ULF0 6.7e-09 59 28 2 138 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8UD57 6.77e-09 59 25 4 170 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q85BZ1 6.91e-09 59 33 2 127 2 clpP ATP-dependent Clp protease proteolytic subunit Anthoceros angustus
A5CXJ8 6.94e-09 59 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C5CJT4 7.01e-09 59 29 5 135 3 clpP ATP-dependent Clp protease proteolytic subunit Variovorax paradoxus (strain S110)
C0R2W3 7.16e-09 59 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q1ACH6 7.29e-09 60 30 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chara vulgaris
Q3V509 7.42e-09 59 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Acorus calamus
Q9Z832 7.73e-09 59 31 3 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chlamydia pneumoniae
Q49KX3 7.96e-09 59 28 6 183 3 clpP ATP-dependent Clp protease proteolytic subunit Eucalyptus globulus subsp. globulus
P12208 8.53e-09 59 32 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Marchantia polymorpha
Q5FQT4 8.65e-09 60 27 4 151 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Gluconobacter oxydans (strain 621H)
Q7UZK7 8.68e-09 59 29 2 131 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q4FQB9 8.73e-09 60 29 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A0ZZ60 9e-09 59 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Gossypium barbadense
Q24S49 9.22e-09 59 30 3 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Desulfitobacterium hafniense (strain Y51)
Q5QA83 9.57e-09 59 32 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Acorus gramineus
Q8DST7 9.71e-09 59 31 2 134 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q4JWV4 9.85e-09 58 29 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Corynebacterium jeikeium (strain K411)
Q317Y6 1.05e-08 59 29 2 131 3 clpP4 ATP-dependent Clp protease proteolytic subunit 4 Prochlorococcus marinus (strain MIT 9312)
Q7UA36 1.08e-08 59 30 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Parasynechococcus marenigrum (strain WH8102)
Q9ZAB0 1.08e-08 59 30 3 135 2 clpP ATP-dependent Clp protease proteolytic subunit Lactococcus lactis subsp. cremoris (strain MG1363)
A6MME7 1.1e-08 59 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Chloranthus spicatus
Q5KVD9 1.1e-08 58 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus kaustophilus (strain HTA426)
Q0VQ90 1.1e-08 59 29 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1RJH2 1.11e-08 59 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia bellii (strain RML369-C)
Q3ANI8 1.12e-08 59 29 2 133 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9605)
Q32RQ7 1.16e-08 59 31 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Zygnema circumcarinatum
Q5N665 1.24e-08 58 27 1 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P54415 1.24e-08 58 27 1 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06FP3 1.24e-08 59 33 4 129 3 clpP-A ATP-dependent Clp protease proteolytic subunit Pelargonium hortorum
Q030V9 1.26e-08 58 30 3 135 3 clpP ATP-dependent Clp protease proteolytic subunit Lactococcus lactis subsp. cremoris (strain SK11)
Q5GS83 1.26e-08 59 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Brugia malayi (strain TRS)
A1VE85 1.3e-08 58 28 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratidesulfovibrio vulgaris (strain DP4)
Q72CE8 1.3e-08 58 28 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1AN85 1.36e-08 58 29 1 128 3 clpP ATP-dependent Clp protease proteolytic subunit Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A4J7L9 1.37e-08 58 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q6NFU4 1.41e-08 58 27 2 136 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5N1P6 1.49e-08 59 31 3 139 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O34125 1.49e-08 59 31 3 139 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B0UW20 1.52e-08 58 27 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Histophilus somni (strain 2336)
P12210 1.62e-08 58 31 2 129 2 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana tabacum
Q33C07 1.62e-08 58 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana tomentosiformis
Q3C1K4 1.62e-08 58 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Nicotiana sylvestris
Q0A6A7 1.68e-08 58 30 4 133 3 clpP ATP-dependent Clp protease proteolytic subunit Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8NN01 1.72e-08 58 29 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q82NZ4 1.73e-08 58 25 3 166 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q6AK59 1.76e-08 58 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q1Q8J2 1.81e-08 58 28 1 132 3 clpP ATP-dependent Clp protease proteolytic subunit Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P36398 1.83e-08 58 31 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus salivarius
Q0G9J4 1.85e-08 58 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Liriodendron tulipifera
Q2PMR0 1.9e-08 58 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Glycine max
Q92HM5 1.91e-08 58 28 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C5D7M9 1.94e-08 58 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus sp. (strain WCH70)
Q1H1G0 1.94e-08 58 28 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q09FT6 1.96e-08 58 31 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Nandina domestica
Q9HYR9 2.02e-08 58 26 3 149 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3B0U1 2.04e-08 58 28 2 133 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9902)
Q38Y96 2.12e-08 58 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Latilactobacillus sakei subsp. sakei (strain 23K)
A1K783 2.18e-08 58 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Azoarcus sp. (strain BH72)
Q27S24 2.22e-08 58 29 8 200 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum tuberosum
Q2MIG3 2.22e-08 58 29 8 200 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum bulbocastanum
Q8KC73 2.24e-08 58 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q03M78 2.38e-08 58 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5U4 2.38e-08 58 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1A8 2.38e-08 58 30 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Streptococcus thermophilus (strain CNRZ 1066)
Q8FN36 2.43e-08 58 28 2 131 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A6H5K6 2.58e-08 58 32 2 126 3 clpP ATP-dependent Clp protease proteolytic subunit Cycas taitungensis
Q93AD7 2.6e-08 58 29 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Rippkaea orientalis (strain PCC 8801 / RF-1)
A1E9U9 2.64e-08 58 28 3 160 3 clpP ATP-dependent Clp protease proteolytic subunit Sorghum bicolor
Q6ENT9 2.64e-08 58 28 3 160 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharum officinarum
Q6L377 2.64e-08 58 28 3 160 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharum hybrid
A8EVH5 2.66e-08 57 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Aliarcobacter butzleri (strain RM4018)
A7M988 2.69e-08 58 32 5 150 3 clpP ATP-dependent Clp protease proteolytic subunit Cuscuta reflexa
C4XH03 2.7e-08 58 28 2 132 3 clpP ATP-dependent Clp protease proteolytic subunit Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q89WR7 2.8e-08 58 27 2 131 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q03AL0 2.8e-08 57 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WCR2 2.8e-08 57 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus casei (strain BL23)
Q66DT4 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPE3 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis (strain Pestoides F)
Q1CL65 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZC65 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis
Q1C4K8 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLC4 2.89e-08 58 26 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6VME1 2.89e-08 57 29 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q2QD64 2.94e-08 57 30 2 127 3 clpP ATP-dependent Clp protease proteolytic subunit Cucumis sativus
Q70XY2 2.97e-08 57 31 2 135 3 clpP ATP-dependent Clp protease proteolytic subunit Amborella trichopoda
A4GGD0 2.97e-08 57 31 1 127 3 clpP ATP-dependent Clp protease proteolytic subunit Phaseolus vulgaris
Q7NEW2 3.1e-08 57 30 4 136 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8YP43 3.22e-08 57 27 2 133 3 clpP3 Probable ATP-dependent Clp protease proteolytic subunit 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A4ISQ2 3.23e-08 57 30 4 135 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus thermodenitrificans (strain NG80-2)
Q2MI76 3.38e-08 57 30 8 200 3 clpP ATP-dependent Clp protease proteolytic subunit Solanum lycopersicum
A6MM61 3.52e-08 57 31 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Buxus microphylla
Q1GB31 3.6e-08 57 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q821M0 3.61e-08 57 28 2 132 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
C3LNM6 3.64e-08 57 27 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain M66-2)
Q9KQS6 3.64e-08 57 27 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6X0 3.64e-08 57 27 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6YXM7 3.76e-08 57 32 3 128 3 clpP ATP-dependent Clp protease proteolytic subunit Physcomitrium patens
Q15R46 3.8e-08 57 28 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B8FA62 3.84e-08 57 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfatibacillum aliphaticivorans
C1F6W4 3.9e-08 57 28 3 134 3 clpP ATP-dependent Clp protease proteolytic subunit Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A4SM42 3.91e-08 57 27 2 129 3 clpP ATP-dependent Clp protease proteolytic subunit Aeromonas salmonicida (strain A449)
Q1KXT4 4.13e-08 57 30 4 136 3 clpP ATP-dependent Clp protease proteolytic subunit Helianthus annuus
Q3AVC3 4.16e-08 57 27 4 139 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Synechococcus sp. (strain CC9902)
Q46JF7 4.16e-08 57 28 4 139 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Prochlorococcus marinus (strain NATL2A)
Q81CH1 4.28e-08 57 29 2 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A8GSH5 4.3e-08 57 27 2 141 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia rickettsii (strain Sheila Smith)
Q04BH7 4.43e-08 57 29 2 131 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q47XL8 4.47e-08 57 27 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q65E10 4.82e-08 57 28 4 178 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6HHU9 4.93e-08 57 29 2 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81PL4 4.93e-08 57 29 2 132 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus anthracis
B2UT37 4.95e-08 57 25 2 133 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain Shi470)
O84712 5.31e-08 57 30 5 135 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KKY8 5.31e-08 57 30 5 135 1 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_19805
Feature type CDS
Gene -
Product ClpP-like prohead protease/major capsid protein fusion protein
Location 136 - 2172 (strand: 1)
Length 2037 (nucleotides) / 678 (amino acids)

Contig

Accession ZDB_560
Length 2982 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_364
Orthogroup size 8
N. genomes 6

Actions

Genomic region

Domains

PF00574 Clp protease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0740 Posttranslational modification, protein turnover, chaperones (O) O ATP-dependent protease ClpP, protease subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01358 ATP-dependent Clp protease, protease subunit [EC:3.4.21.92] Cell cycle - Caulobacter
Longevity regulating pathway - worm
-

Protein Sequence

MPNPGTMTSNPKASAPVKSWFRMKAAADTQSADIYIYDEIGGWGISAKQFSKELLALGDVSQINLHIHSPGGEVFDGIAIYNQLKGHDAKITVYIDGLAASMASVIAMVGDTVIMPENAMMMIHKPWGIAWGDADEMRDYADLLDKLENVLIPAYVAKTGKTAEEIAAMLEEETWMNGDECLSHGFADQLTDPVQAMACITSKRIEDFTAMPQAIKNQVSPKNTAQTTPVSVPNPAPVTQPAATVTQPQPVAQPDNADVQNQIRAQEQARLNGIKDLFAMFGGKHNDLMVDCVTDTQCSLEDARAKLLEKLGAESTPSNKNNAHIYAGNGNFTGDGIRASVMTRAGHEEAQPDNPYNSMTLRELARMSLTERGIGISTLNPMQMVAAAFTHSTSDFGNILMDVAYKSLLTGWEEAEETYDKWTKKGQLSDFKTAHRVGLGGFPSLRQVREGAEYKYVTTGDKGQTIALATYGELFSITRQAIINDDMNALTDIPNKLGRAAKATIGDLVYAVLTENGKLSDGKALFSADHKNTLSGGMDVETISKGRTLMRQQKEGERTLNIRPAFMLVPAALETHALQVVGSGSVKGADVNANIINPIRNIAEIITEPRLDDNSEKDWYMAASQGSDTIEVAYLNGIDTPYIDQQEGFTSDGVTTKIRIDAGVAPLDYRGMIQVKGQ

Flanking regions ( +/- flanking 50bp)

GGGGCTGGTGTTTGACACCGATCCGGCGAATGACAAAGGAGCGCCTGACGATGCCAAATCCCGGGACGATGACAAGTAACCCGAAAGCATCCGCACCGGTTAAAAGCTGGTTCCGCATGAAAGCCGCGGCGGATACCCAATCGGCGGACATTTATATTTATGACGAGATCGGCGGCTGGGGGATCTCGGCAAAGCAGTTTTCAAAAGAGCTGCTGGCGCTGGGTGATGTCAGTCAGATTAACCTGCATATTCACTCCCCCGGCGGCGAGGTGTTTGACGGGATCGCCATTTATAACCAGCTGAAAGGCCATGATGCAAAGATCACCGTCTATATCGACGGACTGGCAGCCTCGATGGCCTCTGTTATTGCCATGGTCGGTGACACCGTGATTATGCCGGAAAACGCAATGATGATGATCCACAAACCGTGGGGAATTGCCTGGGGTGATGCGGATGAAATGCGGGATTACGCCGACCTGCTGGATAAGCTGGAAAATGTGCTGATCCCGGCGTATGTCGCCAAAACCGGCAAAACGGCGGAAGAGATTGCCGCCATGTTAGAAGAGGAAACCTGGATGAACGGCGACGAATGTCTGTCACACGGGTTTGCTGATCAACTTACTGACCCGGTACAGGCGATGGCCTGTATCACATCCAAACGTATCGAGGACTTTACTGCTATGCCACAGGCTATTAAAAACCAGGTATCACCGAAAAATACCGCTCAGACCACACCGGTTTCCGTGCCGAATCCGGCACCGGTGACGCAGCCCGCCGCAACCGTGACTCAGCCTCAGCCGGTCGCGCAGCCGGATAATGCAGATGTACAGAATCAGATCCGCGCTCAGGAACAAGCCCGTCTGAACGGCATTAAGGACTTGTTCGCCATGTTCGGCGGCAAACATAATGATCTGATGGTGGATTGCGTGACTGACACGCAGTGCTCACTGGAAGACGCCCGTGCGAAACTGCTGGAAAAACTGGGGGCTGAATCCACACCAAGCAACAAAAATAATGCTCATATCTATGCCGGGAACGGTAATTTCACCGGTGACGGTATCCGTGCATCGGTCATGACCCGTGCCGGGCACGAAGAAGCACAGCCGGATAACCCGTATAACAGCATGACACTGCGTGAACTGGCGCGTATGTCGCTGACGGAGCGCGGTATTGGTATCAGCACCCTGAACCCGATGCAGATGGTCGCTGCGGCATTCACACACAGCACTTCGGATTTCGGCAATATCCTGATGGATGTGGCTTATAAATCCCTGCTGACGGGCTGGGAAGAGGCGGAAGAAACCTATGATAAGTGGACGAAGAAAGGTCAGCTCAGTGACTTTAAAACCGCTCACCGTGTCGGCCTCGGTGGTTTCCCGTCACTGCGTCAGGTGCGCGAAGGGGCAGAATATAAATACGTCACCACAGGTGACAAGGGGCAGACCATTGCGCTGGCAACGTACGGGGAACTGTTCAGTATCACCCGCCAGGCCATTATCAACGATGATATGAATGCGCTGACCGATATCCCGAACAAACTCGGCCGGGCAGCCAAAGCCACCATTGGTGACCTGGTGTATGCCGTGCTGACAGAGAACGGGAAACTGAGTGACGGCAAAGCCCTGTTCAGTGCAGATCATAAAAATACGCTGTCCGGCGGTATGGATGTGGAGACCATCAGCAAAGGCCGCACCCTGATGCGCCAGCAGAAAGAGGGCGAACGTACGCTGAATATCCGTCCGGCCTTTATGCTGGTACCGGCGGCACTGGAAACACACGCACTTCAGGTTGTCGGTTCCGGCAGTGTGAAAGGGGCTGATGTGAATGCCAATATCATCAACCCGATCCGCAATATTGCGGAAATTATCACTGAGCCGCGTCTGGATGATAACAGTGAAAAAGACTGGTACATGGCCGCTTCTCAGGGCAGTGACACCATTGAAGTTGCCTACCTTAACGGTATCGATACCCCGTATATTGACCAGCAGGAAGGGTTCACCTCAGATGGTGTAACCACGAAAATCCGTATTGATGCCGGTGTGGCACCGCTGGATTATCGCGGAATGATCCAGGTGAAAGGCCAGTAATCCGGCTGAGAATCACATCATAAACGCCCGTGAGGGCTTTTTTTATACCT