Homologs in group_3712
2 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| EHELCC_19150 | EHELCC_19150 | 100.0 | Morganella morganii S2 | - | Transposase |
| LHKJJB_19010 | LHKJJB_19010 | 100.0 | Morganella morganii S3 | - | Transposase |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella morganii S4 |
|---|---|
| Locus tag | NLDBIP_19120 |
| Feature type | CDS |
| Gene | - |
| Product | Transposase |
| Location | 10970 - 11218 (strand: -1) |
| Length | 249 (nucleotides) / 82 (amino acids) |
| Accession | ZDB_545 |
|---|---|
| Length | 23384 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3712 | |
|---|---|---|
| Orthogroup size | 3 | |
| N. genomes | 3 |
MNMRSESKEIYGVSVFPVLAVLHQIRRWWVLRDLKGHWNSRHKVIRICRSRGWDEHIRFKNIERQYSMTRATAKRYQRKGVI
GGGTACTGGAAACAGGCCACAGAGCAGGCCGCAAAAGAACGGGAGGCTGCATGAACATGCGCTCAGAAAGCAAAGAGATTTACGGCGTGAGTGTGTTCCCGGTGCTGGCAGTCCTGCATCAAATCCGCCGGTGGTGGGTACTGCGTGATCTGAAGGGCCACTGGAACAGCCGCCATAAGGTGATCCGCATTTGCCGAAGCCGTGGCTGGGATGAGCATATCCGGTTTAAGAATATCGAACGGCAGTATTCCATGACCCGCGCCACAGCTAAACGCTACCAGCGCAAGGGGGTTATCTGATGGCCGGATATGCGAGCAAAACAGCCCCTGAGCACAAAGACAGTTGGCAA
