Homologs in group_3797
1 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product | |
|---|---|---|---|---|---|
| LHKJJB_18935 | LHKJJB_18935 | 100.0 | Morganella morganii S3 | - | Lipoprotein |
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|
| Source | Morganella morganii S4 |
|---|---|
| Locus tag | NLDBIP_19045 |
| Feature type | CDS |
| Gene | - |
| Product | Lipoprotein |
| Location | 2324 - 2464 (strand: -1) |
| Length | 141 (nucleotides) / 46 (amino acids) |
| Accession | ZDB_545 |
|---|---|
| Length | 23384 nucleotides |
| Topology | linear |
| Plasmid | False |
| Orthogroup | group_3797 | |
|---|---|---|
| Orthogroup size | 2 | |
| N. genomes | 2 |
MLIIIAIILLTTALLAGCYLYSLPNHCKPLPGNPLDGVIHYECEAL
CTGATCAACCGGCGCGAGACGGAGAAAGCGGTATGCCACGGAACCCTTTAATGCTGATCATCATTGCTATCATTCTGCTGACTACTGCTCTGTTGGCGGGTTGTTATCTGTATTCACTCCCGAATCACTGTAAGCCGCTGCCGGGTAACCCGCTGGACGGCGTGATCCATTATGAGTGTGAAGCGCTATGAAAAGGGTAATCACTGTATTACTCAACGGCTGGGTGTGGGCTGTCGTGTTC
