Homologs in group_2396

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19230 FBDBKF_19230 100.0 Morganella morganii S1 rplB 50S ribosomal protein L2
EHELCC_18975 EHELCC_18975 100.0 Morganella morganii S2 rplB 50S ribosomal protein L2
LHKJJB_18845 LHKJJB_18845 100.0 Morganella morganii S3 rplB 50S ribosomal protein L2
HKOGLL_18580 HKOGLL_18580 100.0 Morganella morganii S5 rplB 50S ribosomal protein L2
F4V73_RS18935 F4V73_RS18935 99.3 Morganella psychrotolerans rplB 50S ribosomal protein L2
PMI_RS16165 PMI_RS16165 96.0 Proteus mirabilis HI4320 rplB 50S ribosomal protein L2

Distribution of the homologs in the orthogroup group_2396

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2396

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1I7 0.0 541 95 0 274 3 rplB Large ribosomal subunit protein uL2 Proteus mirabilis (strain HI4320)
Q7MYF4 0.0 530 94 0 274 3 rplB Large ribosomal subunit protein uL2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DG71 0.0 530 93 0 273 3 rplB Large ribosomal subunit protein uL2 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6CZX3 0.0 530 94 0 273 3 rplB Large ribosomal subunit protein uL2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P60428 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60427 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella typhi
B4TXD9 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella schwarzengrund (strain CVM19633)
B5BGY3 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella paratyphi A (strain AKU_12601)
A9MSZ5 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIV5 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SUT7 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella newport (strain SL254)
B4TKL2 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella heidelberg (strain SL476)
B5RH18 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R288 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella enteritidis PT4 (strain P125109)
B5FJL1 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella dublin (strain CT_02021853)
Q57J35 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella choleraesuis (strain SC-B67)
A9MN51 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F8E9 0.0 529 94 0 273 3 rplB Large ribosomal subunit protein uL2 Salmonella agona (strain SL483)
C5BGM2 0.0 529 93 0 274 3 rplB Large ribosomal subunit protein uL2 Edwardsiella ictaluri (strain 93-146)
B1JIW4 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
P60437 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TGZ5 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pestis (strain Pestoides F)
Q1CCU7 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8Z9 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pestis bv. Antiqua (strain Angola)
P60436 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pestis
B2K5M7 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C2V0 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pestis bv. Antiqua (strain Antiqua)
A7FNN2 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P49239 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia enterocolitica
A1JS34 0.0 528 94 0 274 3 rplB Large ribosomal subunit protein uL2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A6TEW9 0.0 528 93 0 273 3 rplB Large ribosomal subunit protein uL2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XN97 0.0 528 93 0 273 3 rplB Large ribosomal subunit protein uL2 Klebsiella pneumoniae (strain 342)
A4WFC5 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Enterobacter sp. (strain 638)
Q3YWU2 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella sonnei (strain Ss046)
P60429 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella flexneri
Q0SZY6 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella flexneri serotype 5b (strain 8401)
Q31VV9 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella boydii serotype 4 (strain Sb227)
B2U2T5 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LRT3 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R607 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain UTI89 / UPEC)
B1LHD1 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain SMS-3-5 / SECEC)
B6I231 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain SE11)
B7NDT8 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60422 0.0 528 94 0 273 1 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain K12)
B1IPY2 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60423 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TCE4 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AGK5 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O1:K1 / APEC
A8A5C2 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O9:H4 (strain HS)
B1X6G8 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain K12 / DH10B)
C4ZUH2 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain K12 / MC4100 / BW2952)
B7M1N1 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O8 (strain IAI1)
B7N1A1 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O81 (strain ED1a)
B7NLN6 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YTN8 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60424 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O157:H7
B7L4K6 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli (strain 55989 / EAEC)
B7MCT2 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UK41 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZSK6 0.0 528 94 0 273 3 rplB Large ribosomal subunit protein uL2 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32B34 0.0 526 94 0 273 3 rplB Large ribosomal subunit protein uL2 Shigella dysenteriae serotype 1 (strain Sd197)
Q2NQM5 0.0 525 93 0 273 3 rplB Large ribosomal subunit protein uL2 Sodalis glossinidius (strain morsitans)
A8GKJ4 0.0 521 92 0 274 3 rplB Large ribosomal subunit protein uL2 Serratia proteamaculans (strain 568)
B2VK61 0.0 520 92 0 273 3 rplB Large ribosomal subunit protein uL2 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9CL35 2.35e-174 484 86 0 273 3 rplB Large ribosomal subunit protein uL2 Pasteurella multocida (strain Pm70)
Q65QV8 3.26e-174 484 85 0 273 3 rplB Large ribosomal subunit protein uL2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0UX16 1.07e-173 483 85 0 273 3 rplB Large ribosomal subunit protein uL2 Histophilus somni (strain 2336)
Q0I160 2.92e-173 481 85 0 273 3 rplB Large ribosomal subunit protein uL2 Histophilus somni (strain 129Pt)
P44343 6.66e-173 481 84 0 273 3 rplB Large ribosomal subunit protein uL2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHT3 6.66e-173 481 84 0 273 3 rplB Large ribosomal subunit protein uL2 Haemophilus influenzae (strain PittGG)
A5UDU4 6.66e-173 481 84 0 273 3 rplB Large ribosomal subunit protein uL2 Haemophilus influenzae (strain PittEE)
Q4QMB9 6.66e-173 481 84 0 273 3 rplB Large ribosomal subunit protein uL2 Haemophilus influenzae (strain 86-028NP)
A6VLJ1 6.8e-173 481 85 0 273 3 rplB Large ribosomal subunit protein uL2 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BST4 1.6e-172 480 85 0 273 3 rplB Large ribosomal subunit protein uL2 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZ14 1.6e-172 480 85 0 273 3 rplB Large ribosomal subunit protein uL2 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N361 1.6e-172 480 85 0 273 3 rplB Large ribosomal subunit protein uL2 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C4K7B5 3.03e-172 479 84 0 274 3 rplB Large ribosomal subunit protein uL2 Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
P55835 1.36e-171 477 84 0 273 3 rplB Large ribosomal subunit protein uL2 Aggregatibacter actinomycetemcomitans
Q7VKD5 5.46e-171 476 84 0 273 3 rplB Large ribosomal subunit protein uL2 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F758 1.1e-170 475 84 0 273 3 rplB Large ribosomal subunit protein uL2 Glaesserella parasuis serovar 5 (strain SH0165)
A0KF24 4.28e-166 463 82 0 273 3 rplB Large ribosomal subunit protein uL2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4ST03 7.74e-166 463 82 0 273 3 rplB Large ribosomal subunit protein uL2 Aeromonas salmonicida (strain A449)
C4L7T3 7.82e-164 457 82 0 273 3 rplB Large ribosomal subunit protein uL2 Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B8D846 2.12e-163 457 80 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57588 2.12e-163 457 80 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D9U4 2.12e-163 457 80 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q3IF22 3.8e-163 456 82 1 274 3 rplB Large ribosomal subunit protein uL2 Pseudoalteromonas translucida (strain TAC 125)
A7MWI6 8.94e-163 455 83 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio campbellii (strain ATCC BAA-1116)
Q89A71 9.31e-163 455 78 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B7VLF4 1.99e-162 454 83 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio atlanticus (strain LGP32)
Q87T10 2.74e-162 454 83 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8K953 3.51e-161 451 78 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A3Q985 4.85e-161 451 81 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B6EPS8 1.09e-159 447 80 1 274 3 rplB Large ribosomal subunit protein uL2 Aliivibrio salmonicida (strain LFI1238)
Q9HWD8 2.46e-159 446 78 1 272 1 rplB Large ribosomal subunit protein uL2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02T77 2.46e-159 446 78 1 272 3 rplB Large ribosomal subunit protein uL2 Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V647 2.46e-159 446 78 1 272 3 rplB Large ribosomal subunit protein uL2 Pseudomonas aeruginosa (strain LESB58)
A6UZJ1 2.46e-159 446 78 1 272 3 rplB Large ribosomal subunit protein uL2 Pseudomonas aeruginosa (strain PA7)
B4S094 4.62e-159 446 81 1 274 3 rplB Large ribosomal subunit protein uL2 Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q6LVB3 5.17e-159 446 81 1 275 3 rplB Large ribosomal subunit protein uL2 Photobacterium profundum (strain SS9)
B8CND6 1.3e-158 444 78 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella piezotolerans (strain WP3 / JCM 13877)
B5FG12 1.51e-158 444 79 1 274 3 rplB Large ribosomal subunit protein uL2 Aliivibrio fischeri (strain MJ11)
Q5E8B2 1.51e-158 444 79 1 274 3 rplB Large ribosomal subunit protein uL2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LRQ5 1.56e-158 444 81 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio cholerae serotype O1 (strain M66-2)
Q9KNY7 1.56e-158 444 81 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F546 1.56e-158 444 81 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MPI5 3.39e-158 444 81 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio vulnificus (strain YJ016)
Q8DE42 3.39e-158 444 81 1 274 3 rplB Large ribosomal subunit protein uL2 Vibrio vulnificus (strain CMCP6)
A8GYX9 3.44e-158 444 78 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1T0D9 6.15e-158 443 80 1 275 3 rplB Large ribosomal subunit protein uL2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0TM09 7.01e-158 443 78 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella halifaxensis (strain HAW-EB4)
Q1LTD5 9.98e-158 442 80 0 272 3 rplB Large ribosomal subunit protein uL2 Baumannia cicadellinicola subsp. Homalodisca coagulata
A1REB7 3.1e-157 441 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella sp. (strain W3-18-1)
A4YBY0 3.1e-157 441 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q487Z6 4.22e-157 441 79 1 274 3 rplB Large ribosomal subunit protein uL2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8GV55 5.2e-157 441 77 0 274 3 rplB Large ribosomal subunit protein uL2 Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A9KWA5 7.97e-157 440 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella baltica (strain OS195)
A6WHT1 7.97e-157 440 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella baltica (strain OS185)
A3DA69 7.97e-157 440 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EBK2 7.97e-157 440 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella baltica (strain OS223)
B1KMY0 9.42e-157 440 78 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella woodyi (strain ATCC 51908 / MS32)
Q15YN6 1.39e-156 439 78 1 274 3 rplB Large ribosomal subunit protein uL2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8EK65 1.87e-156 439 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0I0A2 3.57e-156 438 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella sp. (strain MR-7)
Q0HNT4 3.57e-156 438 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella sp. (strain MR-4)
A0KRM7 3.57e-156 438 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella sp. (strain ANA-3)
Q089Q1 3.74e-156 438 79 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella frigidimarina (strain NCIMB 400)
A1S221 1.36e-155 437 78 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8G1E5 7.14e-155 435 79 1 275 3 rplB Large ribosomal subunit protein uL2 Shewanella sediminis (strain HAW-EB3)
Q5QXY0 9.16e-155 435 79 1 274 3 rplB Large ribosomal subunit protein uL2 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7VQE5 9.22e-155 435 75 1 276 3 rplB Large ribosomal subunit protein uL2 Blochmanniella floridana
Q493K5 3.14e-154 434 74 1 275 3 rplB Large ribosomal subunit protein uL2 Blochmanniella pennsylvanica (strain BPEN)
Q12SV6 3.23e-154 433 77 1 274 3 rplB Large ribosomal subunit protein uL2 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
C1DKL6 1.02e-150 424 77 1 272 3 rplB Large ribosomal subunit protein uL2 Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q2S915 5.86e-150 422 75 0 274 3 rplB Large ribosomal subunit protein uL2 Hahella chejuensis (strain KCTC 2396)
B3PK40 2.82e-149 421 76 1 275 3 rplB Large ribosomal subunit protein uL2 Cellvibrio japonicus (strain Ueda107)
Q0VSK0 3.5e-149 421 77 1 274 3 rplB Large ribosomal subunit protein uL2 Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4VHN3 5.65e-149 420 75 1 272 3 rplB Large ribosomal subunit protein uL2 Stutzerimonas stutzeri (strain A1501)
A1TYK0 7.06e-148 417 76 1 275 3 rplB Large ribosomal subunit protein uL2 Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1R0H2 2.43e-147 416 74 1 275 3 rplB Large ribosomal subunit protein uL2 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A6W389 3.05e-147 416 75 1 274 3 rplB Large ribosomal subunit protein uL2 Marinomonas sp. (strain MWYL1)
Q057A7 1.49e-146 414 71 0 273 3 rplB Large ribosomal subunit protein uL2 Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q21M54 9.55e-146 412 76 1 275 3 rplB Large ribosomal subunit protein uL2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B0KK70 2.58e-145 411 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas putida (strain GB-1)
C5BQ64 4.99e-145 410 74 1 275 3 rplB Large ribosomal subunit protein uL2 Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q4ZMP7 1.29e-144 409 75 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas syringae pv. syringae (strain B728a)
Q48D39 1.29e-144 409 75 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B1JDW1 1.42e-144 409 73 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas putida (strain W619)
Q8D209 1.43e-144 409 68 0 274 3 rplB Large ribosomal subunit protein uL2 Wigglesworthia glossinidia brevipalpis
Q1H4N4 1.95e-144 409 71 1 272 3 rplB Large ribosomal subunit protein uL2 Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1IFW3 2.52e-144 408 73 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas entomophila (strain L48)
Q88QN2 3.82e-144 408 73 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VXQ0 3.82e-144 408 73 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3K5Z1 4.36e-144 408 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas fluorescens (strain Pf0-1)
Q889W8 4.5e-144 408 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K536 4.81e-144 408 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C3K2X3 1.15e-143 407 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas fluorescens (strain SBW25)
A4XZ87 1.18e-143 407 74 2 273 3 rplB Large ribosomal subunit protein uL2 Pseudomonas mendocina (strain ymp)
Q6F7R5 2.13e-143 406 71 0 271 3 rplB Large ribosomal subunit protein uL2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V6X1 2.54e-143 406 71 0 274 3 rplB Large ribosomal subunit protein uL2 Acinetobacter baumannii (strain AYE)
A3M980 2.54e-143 406 71 0 274 3 rplB Large ribosomal subunit protein uL2 Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VQS1 2.54e-143 406 71 0 274 3 rplB Large ribosomal subunit protein uL2 Acinetobacter baumannii (strain SDF)
B7IA36 2.54e-143 406 71 0 274 1 rplB Large ribosomal subunit protein uL2 Acinetobacter baumannii (strain AB0057)
B7GW05 2.54e-143 406 71 0 274 3 rplB Large ribosomal subunit protein uL2 Acinetobacter baumannii (strain AB307-0294)
A6T3K1 7.35e-142 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Janthinobacterium sp. (strain Marseille)
B2JIG3 7.94e-142 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A4G9T5 8.57e-142 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Herminiimonas arsenicoxydans
Q1BRV1 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia orbicola (strain AU 1054)
B1JU25 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia orbicola (strain MC0-3)
Q39KG4 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BJ43 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4E5C3 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1YRD3 1.14e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia ambifaria (strain MC40-6)
B2T748 1.3e-141 402 70 1 275 3 rplB Large ribosomal subunit protein uL2 Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A0K3M8 1.65e-141 401 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia cenocepacia (strain HI2424)
A4JAP3 2.37e-141 401 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q13TH3 3.76e-141 400 70 1 275 3 rplB Large ribosomal subunit protein uL2 Paraburkholderia xenovorans (strain LB400)
Q3SLP6 2.82e-140 398 71 1 272 3 rplB Large ribosomal subunit protein uL2 Thiobacillus denitrificans (strain ATCC 25259)
Q31IX9 6.41e-140 397 72 2 275 3 rplB Large ribosomal subunit protein uL2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2YAZ4 9.88e-140 397 71 1 272 3 rplB Large ribosomal subunit protein uL2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0ABH2 5.28e-138 392 71 1 274 3 rplB Large ribosomal subunit protein uL2 Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8XV15 1.62e-137 391 70 2 276 3 rplB Large ribosomal subunit protein uL2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5WCJ3 1.71e-137 391 67 0 274 3 rplB Large ribosomal subunit protein uL2 Psychrobacter sp. (strain PRwf-1)
B2UEL6 2.06e-137 391 69 2 276 3 rplB Large ribosomal subunit protein uL2 Ralstonia pickettii (strain 12J)
Q3BWY0 2.83e-137 390 71 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PNS1 2.83e-137 390 71 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas axonopodis pv. citri (strain 306)
B3R7S0 9.24e-137 389 69 2 276 3 rplB Large ribosomal subunit protein uL2 Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q5GWT7 6.76e-136 387 71 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NZY8 6.76e-136 387 71 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q63Q14 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia pseudomallei (strain K96243)
A3NEH6 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia pseudomallei (strain 668)
Q3JMR6 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia pseudomallei (strain 1710b)
A3P0B0 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia pseudomallei (strain 1106a)
A1V8A0 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia mallei (strain SAVP1)
Q62GK8 1.12e-135 387 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia mallei (strain ATCC 23344)
Q2SU30 1.91e-135 386 70 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9IIZ6 8.57e-135 384 67 1 275 3 rplB Large ribosomal subunit protein uL2 Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A9ADJ6 8.96e-135 384 69 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia multivorans (strain ATCC 17616 / 249)
Q0K622 8.98e-135 384 68 2 276 3 rplB Large ribosomal subunit protein uL2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A1WVB9 1.45e-134 384 70 1 274 3 rplB Large ribosomal subunit protein uL2 Halorhodospira halophila (strain DSM 244 / SL1)
Q9PE73 1.5e-134 384 68 1 273 3 rplB Large ribosomal subunit protein uL2 Xylella fastidiosa (strain 9a5c)
Q4FUF3 1.89e-134 384 66 0 274 3 rplB Large ribosomal subunit protein uL2 Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A2S7H9 1.91e-134 384 69 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia mallei (strain NCTC 10229)
A3MRV7 1.91e-134 384 69 1 275 3 rplB Large ribosomal subunit protein uL2 Burkholderia mallei (strain NCTC 10247)
Q1QDI3 2.13e-134 383 66 0 274 3 rplB Large ribosomal subunit protein uL2 Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2L2F1 2.3e-134 383 67 1 275 3 rplB Large ribosomal subunit protein uL2 Bordetella avium (strain 197N)
Q87E79 2.53e-134 383 68 1 273 3 rplB Large ribosomal subunit protein uL2 Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B0U5B0 2.53e-134 383 68 1 273 3 rplB Large ribosomal subunit protein uL2 Xylella fastidiosa (strain M12)
B2I8H2 2.53e-134 383 68 1 273 3 rplB Large ribosomal subunit protein uL2 Xylella fastidiosa (strain M23)
Q9K1I5 3.17e-134 383 68 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7VTD0 3.19e-134 383 66 1 275 3 rplB Large ribosomal subunit protein uL2 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W2F3 3.19e-134 383 66 1 275 3 rplB Large ribosomal subunit protein uL2 Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WRC2 3.19e-134 383 66 1 275 3 rplB Large ribosomal subunit protein uL2 Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1KRH6 3.86e-134 383 68 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9JX12 3.86e-134 383 68 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B2FQ48 5.05e-134 382 70 1 273 3 rplB Large ribosomal subunit protein uL2 Stenotrophomonas maltophilia (strain K279a)
B4SKW6 5.05e-134 382 70 1 273 3 rplB Large ribosomal subunit protein uL2 Stenotrophomonas maltophilia (strain R551-3)
Q1LI40 9.87e-134 382 68 2 276 3 rplB Large ribosomal subunit protein uL2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8PC46 1.01e-133 382 70 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RU79 1.01e-133 382 70 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas campestris pv. campestris (strain B100)
Q4URE2 1.01e-133 382 70 1 273 3 rplB Large ribosomal subunit protein uL2 Xanthomonas campestris pv. campestris (strain 8004)
A5EX79 1.22e-133 381 68 1 275 3 rplB Large ribosomal subunit protein uL2 Dichelobacter nodosus (strain VCS1703A)
B4RQY1 1.42e-133 381 68 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria gonorrhoeae (strain NCCP11945)
Q5F5T0 1.42e-133 381 68 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q46WE7 2.37e-133 381 68 2 276 3 rplB Large ribosomal subunit protein uL2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A9M3W3 5.28e-133 380 67 1 272 3 rplB Large ribosomal subunit protein uL2 Neisseria meningitidis serogroup C (strain 053442)
C1DAS0 8.61e-133 379 70 1 275 3 rplB Large ribosomal subunit protein uL2 Laribacter hongkongensis (strain HLHK9)
Q47JA0 3.26e-131 375 70 1 275 3 rplB Large ribosomal subunit protein uL2 Dechloromonas aromatica (strain RCB)
A1KB24 4.48e-131 375 68 1 275 3 rplB Large ribosomal subunit protein uL2 Azoarcus sp. (strain BH72)
Q82X85 8.69e-131 374 65 1 275 3 rplB Large ribosomal subunit protein uL2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7NQF5 4.68e-130 372 69 1 272 3 rplB Large ribosomal subunit protein uL2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q605B5 6.99e-130 372 68 1 272 3 rplB Large ribosomal subunit protein uL2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A4SUW4 3.1e-129 370 68 2 276 3 rplB Large ribosomal subunit protein uL2 Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1Y8I4 1.13e-127 366 68 1 274 3 rplB Large ribosomal subunit protein uL2 Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q5ZYP0 2.97e-127 365 66 1 275 3 rplB Large ribosomal subunit protein uL2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHR1 2.97e-127 365 66 1 275 3 rplB Large ribosomal subunit protein uL2 Legionella pneumophila (strain Corby)
Q5X856 2.97e-127 365 66 1 275 3 rplB Large ribosomal subunit protein uL2 Legionella pneumophila (strain Paris)
B1XSQ4 6.54e-127 364 68 2 276 3 rplB Large ribosomal subunit protein uL2 Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q5WZK9 6.82e-127 364 66 1 275 3 rplB Large ribosomal subunit protein uL2 Legionella pneumophila (strain Lens)
B0U0Y6 1.42e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q0AIJ2 1.77e-126 363 63 1 275 3 rplB Large ribosomal subunit protein uL2 Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0BNS4 1.97e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5G7 1.97e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. holarctica (strain LVS)
A7N9S9 1.97e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A2SLF4 2.48e-126 363 67 1 274 3 rplB Large ribosomal subunit protein uL2 Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A4IZT1 3.08e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NHW5 3.08e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q4I6 3.08e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. novicida (strain U112)
Q14JB7 3.08e-126 363 66 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. tularensis (strain FSC 198)
A1AVK3 4.54e-126 362 65 1 272 3 rplB Large ribosomal subunit protein uL2 Ruthia magnifica subsp. Calyptogena magnifica
B2SDY2 5.15e-126 362 65 1 272 3 rplB Large ribosomal subunit protein uL2 Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5P329 6.72e-126 362 67 1 275 3 rplB Large ribosomal subunit protein uL2 Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q83ES1 2.79e-125 360 65 1 275 3 rplB Large ribosomal subunit protein uL2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NAM7 2.79e-125 360 65 1 275 3 rplB Large ribosomal subunit protein uL2 Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KD28 2.79e-125 360 65 1 275 3 rplB Large ribosomal subunit protein uL2 Coxiella burnetii (strain Dugway 5J108-111)
B6J260 2.79e-125 360 65 1 275 3 rplB Large ribosomal subunit protein uL2 Coxiella burnetii (strain CbuG_Q212)
A1WHC8 1.33e-124 358 64 1 274 3 rplB Large ribosomal subunit protein uL2 Verminephrobacter eiseniae (strain EF01-2)
B6J5D5 3.72e-124 357 65 1 275 3 rplB Large ribosomal subunit protein uL2 Coxiella burnetii (strain CbuK_Q154)
Q21RW1 4.71e-123 355 64 1 274 3 rplB Large ribosomal subunit protein uL2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B5ELY2 6.32e-123 354 64 1 274 3 rplB Large ribosomal subunit protein uL2 Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J470 6.32e-123 354 64 1 274 3 rplB Large ribosomal subunit protein uL2 Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A5CXK7 1.15e-122 353 63 1 272 3 rplB Large ribosomal subunit protein uL2 Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1VIQ3 2.99e-122 352 63 1 274 3 rplB Large ribosomal subunit protein uL2 Polaromonas naphthalenivorans (strain CJ2)
Q12GW8 1.1e-121 351 63 1 274 3 rplB Large ribosomal subunit protein uL2 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3J8R7 2.88e-121 350 65 1 274 3 rplB Large ribosomal subunit protein uL2 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A1TJ10 4.46e-121 350 63 1 274 3 rplB Large ribosomal subunit protein uL2 Paracidovorax citrulli (strain AAC00-1)
C5CP50 3.93e-120 347 63 1 274 3 rplB Large ribosomal subunit protein uL2 Variovorax paradoxus (strain S110)
A9BPS1 7.33e-120 347 63 1 274 3 rplB Large ribosomal subunit protein uL2 Delftia acidovorans (strain DSM 14801 / SPH-1)
B9MB76 5.25e-119 344 62 1 274 3 rplB Large ribosomal subunit protein uL2 Acidovorax ebreus (strain TPSY)
A1W2R0 5.61e-119 344 62 1 274 3 rplB Large ribosomal subunit protein uL2 Acidovorax sp. (strain JS42)
B2V7L0 1.64e-116 338 62 1 274 3 rplB Large ribosomal subunit protein uL2 Sulfurihydrogenibium sp. (strain YO3AOP1)
C0ZII3 2.5e-115 335 61 3 276 3 rplB Large ribosomal subunit protein uL2 Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q3A9R9 1.08e-114 333 61 2 273 3 rplB Large ribosomal subunit protein uL2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9Z9L1 9.42e-114 331 61 3 276 3 rplB Large ribosomal subunit protein uL2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q4L8B1 1.03e-113 331 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus haemolyticus (strain JCSC1435)
Q2RFQ0 1.51e-113 330 61 3 276 3 rplB Large ribosomal subunit protein uL2 Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B1YGV3 1.59e-113 330 61 4 277 3 rplB Large ribosomal subunit protein uL2 Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q65PA4 2.34e-113 330 61 3 277 3 rplB Large ribosomal subunit protein uL2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C0QQM6 3.3e-113 330 60 1 274 3 rplB Large ribosomal subunit protein uL2 Persephonella marina (strain DSM 14350 / EX-H1)
P42919 4.08e-113 330 60 3 277 1 rplB Large ribosomal subunit protein uL2 Bacillus subtilis (strain 168)
Q5WLQ9 5.54e-113 329 61 3 276 3 rplB Large ribosomal subunit protein uL2 Shouchella clausii (strain KSM-K16)
A4J114 5.9e-113 329 60 1 275 3 rplB Large ribosomal subunit protein uL2 Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
P60433 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain MW2)
Q6G774 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain MSSA476)
Q6GEI6 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain MRSA252)
P60432 6.32e-113 329 59 3 277 1 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain N315)
P60431 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJ89 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain Newman)
Q5HDW1 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain COL)
Q2YYP9 6.32e-113 329 59 3 277 1 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IV31 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain JH9)
P60430 6.32e-113 329 59 3 277 1 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEP2 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain USA300)
A6U3X2 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain JH1)
A7X5G0 6.32e-113 329 59 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
C4KZP3 7.44e-113 329 61 3 276 3 rplB Large ribosomal subunit protein uL2 Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A8F988 9.07e-113 328 60 3 277 3 rplB Large ribosomal subunit protein uL2 Bacillus pumilus (strain SAFR-032)
B8D0C7 1.93e-112 328 59 1 272 3 rplB Large ribosomal subunit protein uL2 Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
C5D3S0 2.17e-112 328 60 3 276 3 rplB Large ribosomal subunit protein uL2 Geobacillus sp. (strain WCH70)
B0TC59 2.19e-112 328 59 2 275 3 rplB Large ribosomal subunit protein uL2 Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q5L3Z4 2.45e-112 327 60 3 276 1 rplB Large ribosomal subunit protein uL2 Geobacillus kaustophilus (strain HTA426)
Q8CRG3 2.53e-112 327 58 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM02 2.53e-112 327 58 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A4IJJ2 2.73e-112 327 60 3 276 3 rplB Large ribosomal subunit protein uL2 Geobacillus thermodenitrificans (strain NG80-2)
A7Z0P1 3.33e-112 327 60 3 277 3 rplB Large ribosomal subunit protein uL2 Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P04257 3.92e-112 327 60 3 276 1 rplB Large ribosomal subunit protein uL2 Geobacillus stearothermophilus
B1MW11 1.91e-111 325 61 3 277 3 rplB Large ribosomal subunit protein uL2 Leuconostoc citreum (strain KM20)
A5D5J3 2.3e-111 325 59 1 274 3 rplB Large ribosomal subunit protein uL2 Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B9DM16 2.6e-111 325 57 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus carnosus (strain TM300)
Q6HPQ5 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63H87 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain ZK / E33L)
B7HQU7 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain AH187)
C1ET42 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain 03BB102)
Q73F93 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JKC2 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain AH820)
Q81VS7 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus anthracis
A0R8I3 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus thuringiensis (strain Al Hakam)
C3LJ85 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9Q8 3.68e-111 325 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus anthracis (strain A0248)
B9MKH8 5.96e-111 324 60 3 275 3 rplB Large ribosomal subunit protein uL2 Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A0ALW5 1.61e-110 323 59 3 277 3 rplB Large ribosomal subunit protein uL2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P60426 1.67e-110 323 59 3 277 1 rplB Large ribosomal subunit protein uL2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WE9 1.67e-110 323 59 3 277 3 rplB Large ribosomal subunit protein uL2 Listeria monocytogenes serotype 4b (strain F2365)
C1KZH7 1.67e-110 323 59 3 277 3 rplB Large ribosomal subunit protein uL2 Listeria monocytogenes serotype 4b (strain CLIP80459)
P60425 1.67e-110 323 59 3 277 3 rplB Large ribosomal subunit protein uL2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q81J39 1.78e-110 323 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HJ51 1.78e-110 323 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain B4264)
B7IT22 1.78e-110 323 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain G9842)
A7GK23 1.98e-110 323 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q1AU32 3.48e-110 322 61 2 275 3 rplB Large ribosomal subunit protein uL2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q49ZG5 3.74e-110 322 58 3 277 3 rplB Large ribosomal subunit protein uL2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B0K5P6 4.3e-110 322 59 2 274 3 rplB Large ribosomal subunit protein uL2 Thermoanaerobacter sp. (strain X514)
B0KCK3 4.3e-110 322 59 2 274 3 rplB Large ribosomal subunit protein uL2 Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B8G1W9 5.48e-110 322 59 2 276 3 rplB Large ribosomal subunit protein uL2 Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q250M9 6.25e-110 322 59 2 276 3 rplB Large ribosomal subunit protein uL2 Desulfitobacterium hafniense (strain Y51)
B9IZJ7 6.46e-110 321 60 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus cereus (strain Q1)
C5CGR1 6.73e-110 321 58 1 275 3 rplB Large ribosomal subunit protein uL2 Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
A9VP80 8.12e-110 321 59 3 276 3 rplB Large ribosomal subunit protein uL2 Bacillus mycoides (strain KBAB4)
Q8ETX9 1.03e-109 321 59 3 276 3 rplB Large ribosomal subunit protein uL2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A4XLS7 2.29e-109 320 60 3 275 3 rplB Large ribosomal subunit protein uL2 Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B5EFQ3 8.58e-109 318 59 1 274 3 rplB Large ribosomal subunit protein uL2 Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q3A6P4 1.65e-108 318 60 1 272 3 rplB Large ribosomal subunit protein uL2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q03ZP2 2.07e-108 318 59 3 277 3 rplB Large ribosomal subunit protein uL2 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B9E9J4 2.35e-108 317 58 3 276 3 rplB Large ribosomal subunit protein uL2 Macrococcus caseolyticus (strain JCSC5402)
Q74L86 3.31e-108 317 58 3 274 3 rplB Large ribosomal subunit protein uL2 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A9B415 3.56e-108 317 59 1 275 3 rplB Large ribosomal subunit protein uL2 Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
C6E4Q4 4.01e-108 317 59 1 274 3 rplB Large ribosomal subunit protein uL2 Geobacter sp. (strain M21)
B3E7T8 6.14e-108 316 58 1 274 3 rplB Large ribosomal subunit protein uL2 Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B1I1J1 1.02e-107 316 59 2 275 3 rplB Large ribosomal subunit protein uL2 Desulforudis audaxviator (strain MP104C)
B2A4E2 1.09e-107 316 57 2 276 3 rplB Large ribosomal subunit protein uL2 Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A8MLE3 1.21e-107 315 58 3 276 3 rplB Large ribosomal subunit protein uL2 Alkaliphilus oremlandii (strain OhILAs)
A8GPE7 1.3e-107 315 59 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia akari (strain Hartford)
A8EZL3 1.97e-107 315 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia canadensis (strain McKiel)
A5GAW8 2.02e-107 315 59 1 274 3 rplB Large ribosomal subunit protein uL2 Geotalea uraniireducens (strain Rf4)
B4R8M0 2.19e-107 315 59 1 272 3 rplB Large ribosomal subunit protein uL2 Phenylobacterium zucineum (strain HLK1)
Q92GW9 2.4e-107 315 59 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PPA4 2.4e-107 315 59 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia africae (strain ESF-5)
Q04C12 2.94e-107 315 57 4 278 3 rplB Large ribosomal subunit protein uL2 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBL5 2.94e-107 315 57 4 278 3 rplB Large ribosomal subunit protein uL2 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q2LQ98 3.16e-107 314 59 1 272 3 rplB Large ribosomal subunit protein uL2 Syntrophus aciditrophicus (strain SB)
Q39Y03 3.49e-107 314 59 1 274 3 rplB Large ribosomal subunit protein uL2 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A8GT66 3.8e-107 314 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia rickettsii (strain Sheila Smith)
B0BUQ7 3.8e-107 314 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia rickettsii (strain Iowa)
Q4UMS6 4.29e-107 314 59 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A7HWR4 5.67e-107 314 60 1 275 3 rplB Large ribosomal subunit protein uL2 Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A1ALU4 6.57e-107 313 59 1 274 3 rplB Large ribosomal subunit protein uL2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
C4K2H6 9.01e-107 313 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia peacockii (strain Rustic)
A5N4Q0 9.88e-107 313 58 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYB2 9.88e-107 313 58 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium kluyveri (strain NBRC 12016)
Q034Y6 1.26e-106 313 57 4 278 3 rplB Large ribosomal subunit protein uL2 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WAL4 1.26e-106 313 57 4 278 3 rplB Large ribosomal subunit protein uL2 Lacticaseibacillus casei (strain BL23)
Q2W2J4 1.65e-106 313 59 1 272 3 rplB Large ribosomal subunit protein uL2 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B9M6U2 1.74e-106 313 58 1 274 3 rplB Large ribosomal subunit protein uL2 Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q2IJ88 2.09e-106 313 57 1 273 3 rplB Large ribosomal subunit protein uL2 Anaeromyxobacter dehalogenans (strain 2CP-C)
B4UBA2 2.25e-106 313 57 1 273 3 rplB Large ribosomal subunit protein uL2 Anaeromyxobacter sp. (strain K)
B8J863 2.25e-106 313 57 1 273 3 rplB Large ribosomal subunit protein uL2 Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A9BHA2 2.55e-106 312 55 1 274 3 rplB Large ribosomal subunit protein uL2 Petrotoga mobilis (strain DSM 10674 / SJ95)
A3DJH5 3.78e-106 312 58 3 274 3 rplB Large ribosomal subunit protein uL2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B3QY27 3.97e-106 312 58 2 279 3 rplB Large ribosomal subunit protein uL2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A6TWH9 4.17e-106 311 59 3 276 3 rplB Large ribosomal subunit protein uL2 Alkaliphilus metalliredigens (strain QYMF)
A8F2E4 4.35e-106 311 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia massiliae (strain Mtu5)
Q1RHM4 5.47e-106 311 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia bellii (strain RML369-C)
A8GVB7 5.47e-106 311 58 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia bellii (strain OSU 85-389)
Q04G82 6.41e-106 311 59 3 279 3 rplB Large ribosomal subunit protein uL2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P60401 6.66e-106 311 58 1 274 3 rplB Large ribosomal subunit protein uL2 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q046C2 8.14e-106 311 57 3 274 3 rplB Large ribosomal subunit protein uL2 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q88XY3 2.25e-105 310 57 2 274 3 rplB Large ribosomal subunit protein uL2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P60402 2.45e-105 310 58 3 276 3 rplB Large ribosomal subunit protein uL2 Onion yellows phytoplasma (strain OY-M)
A5ELM4 2.53e-105 310 59 1 275 3 rplB Large ribosomal subunit protein uL2 Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B5XJ39 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M49 (strain NZ131)
P0DE35 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VU6 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RC17 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JJ59 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JP14 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JE55 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M12 (strain MGAS2096)
P60435 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XED2 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DE34 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P60434 2.56e-105 310 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M1
Q5FM87 2.62e-105 310 57 4 278 3 rplB Large ribosomal subunit protein uL2 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B6IRQ9 2.64e-105 310 58 2 275 3 rplB Large ribosomal subunit protein uL2 Rhodospirillum centenum (strain ATCC 51521 / SW)
A4VSF7 3.8e-105 309 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus suis (strain 05ZYH33)
A4VYP6 3.8e-105 309 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus suis (strain 98HAH33)
Q9ZCQ8 4.22e-105 309 57 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia prowazekii (strain Madrid E)
A8YXK8 4.73e-105 309 57 3 274 3 rplB Large ribosomal subunit protein uL2 Lactobacillus helveticus (strain DPC 4571)
Q1J911 5.1e-105 309 56 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pyogenes serotype M4 (strain MGAS10750)
A4YSJ5 6.34e-105 309 58 1 275 3 rplB Large ribosomal subunit protein uL2 Bradyrhizobium sp. (strain ORS 278)
B0RZU3 6.99e-105 308 58 3 276 3 rplB Large ribosomal subunit protein uL2 Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q68W81 7.52e-105 308 57 1 272 3 rplB Large ribosomal subunit protein uL2 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1WS93 7.98e-105 308 56 3 277 3 rplB Large ribosomal subunit protein uL2 Ligilactobacillus salivarius (strain UCC118)
Q8R7V7 1.02e-104 308 58 2 274 3 rplB Large ribosomal subunit protein uL2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2NIV7 1.25e-104 308 57 2 276 3 rplB Large ribosomal subunit protein uL2 Aster yellows witches'-broom phytoplasma (strain AYWB)
C0MCB3 1.39e-104 308 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus equi subsp. zooepidemicus (strain H70)
B4U503 1.39e-104 308 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
A8IAR8 1.59e-104 308 58 1 275 3 rplB Large ribosomal subunit protein uL2 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P60405 1.97e-104 307 59 3 276 1 rplB Large ribosomal subunit protein uL2 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72I07 1.97e-104 307 59 3 276 1 rplB Large ribosomal subunit protein uL2 Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6AP68 2.5e-104 307 57 1 273 3 rplB Large ribosomal subunit protein uL2 Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q03PW0 2.69e-104 307 58 6 281 3 rplB Large ribosomal subunit protein uL2 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
C0M6X2 3.23e-104 307 56 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus equi subsp. equi (strain 4047)
Q1ISB9 4.28e-104 306 56 1 275 3 rplB Large ribosomal subunit protein uL2 Koribacter versatilis (strain Ellin345)
Q38UR5 7.09e-104 306 55 4 277 3 rplB Large ribosomal subunit protein uL2 Latilactobacillus sakei subsp. sakei (strain 23K)
Q03IF4 7.65e-104 306 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M2B6 7.65e-104 306 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXR4 7.65e-104 306 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus thermophilus (strain CNRZ 1066)
A7IFY4 8.92e-104 306 58 1 275 3 rplB Large ribosomal subunit protein uL2 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q3APH6 9.97e-104 306 58 1 274 3 rplB Large ribosomal subunit protein uL2 Chlorobium chlorochromatii (strain CaD3)
A8AZM2 1.09e-103 306 56 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A3CK66 1.2e-103 305 56 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus sanguinis (strain SK36)
A0LIJ3 1.57e-103 305 56 1 272 3 rplB Large ribosomal subunit protein uL2 Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
C1CP91 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain Taiwan19F-14)
C1CIA0 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain P1031)
C1CC09 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain JJA)
Q8CWV5 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IS43 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain CGSP14)
Q97SV2 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZKG0 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I8K1 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain Hungary19A-6)
C1CAL5 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae (strain 70585)
B5E6F8 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae serotype 19F (strain G54)
Q04MN3 1.72e-103 305 57 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B6JET6 1.72e-103 305 58 2 278 3 rplB Large ribosomal subunit protein uL2 Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A8ZV60 1.77e-103 305 57 2 275 3 rplB Large ribosomal subunit protein uL2 Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B8I7Y2 1.77e-103 305 56 3 277 3 rplB Large ribosomal subunit protein uL2 Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B3EP58 1.84e-103 305 56 1 274 3 rplB Large ribosomal subunit protein uL2 Chlorobium phaeobacteroides (strain BS1)
B3QR83 2.66e-103 305 57 1 274 3 rplB Large ribosomal subunit protein uL2 Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1VAE5 2.74e-103 305 57 3 276 3 rplB Large ribosomal subunit protein uL2 Phytoplasma australiense
Q18CG3 3.23e-103 304 57 3 276 3 rplB Large ribosomal subunit protein uL2 Clostridioides difficile (strain 630)
Q50264 4.58e-103 304 57 3 276 3 rplB Large ribosomal subunit protein uL2 Aster yellows phytoplasma
Q0AUI3 4.89e-103 304 56 2 273 3 rplB Large ribosomal subunit protein uL2 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q0SQE7 4.9e-103 304 57 3 277 3 rplB Large ribosomal subunit protein uL2 Clostridium perfringens (strain SM101 / Type A)
Q8XHS6 4.9e-103 304 57 3 277 3 rplB Large ribosomal subunit protein uL2 Clostridium perfringens (strain 13 / Type A)
Q0TMP9 4.9e-103 304 57 3 277 3 rplB Large ribosomal subunit protein uL2 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B9DSV3 7.18e-103 303 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q6F1Z1 8.49e-103 303 58 5 280 3 rplB Large ribosomal subunit protein uL2 Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q134T2 8.65e-103 303 57 2 278 3 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain BisB5)
B9K889 1.1e-102 303 60 2 275 3 rplB Large ribosomal subunit protein uL2 Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q890P1 1.24e-102 303 56 3 274 3 rplB Large ribosomal subunit protein uL2 Clostridium tetani (strain Massachusetts / E88)
A1BJ31 1.24e-102 303 57 2 279 3 rplB Large ribosomal subunit protein uL2 Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q0ANQ3 1.38e-102 303 58 1 272 3 rplB Large ribosomal subunit protein uL2 Maricaulis maris (strain MCS10)
A1B030 1.46e-102 303 56 1 275 3 rplB Large ribosomal subunit protein uL2 Paracoccus denitrificans (strain Pd 1222)
Q211F1 1.56e-102 303 57 1 275 3 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain BisB18)
Q8E2C8 1.59e-102 303 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E7T5 1.59e-102 303 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus agalactiae serotype III (strain NEM316)
Q3K3W6 1.59e-102 303 55 3 277 3 rplB Large ribosomal subunit protein uL2 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q2IXQ7 1.63e-102 303 57 2 278 3 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain HaA2)
B8FET2 2.6e-102 302 57 1 275 3 rplB Large ribosomal subunit protein uL2 Desulfatibacillum aliphaticivorans
Q07KM1 3.07e-102 302 57 1 275 3 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain BisA53)
Q03EB9 3.15e-102 302 55 3 276 3 rplB Large ribosomal subunit protein uL2 Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q1QN27 4.31e-102 301 58 1 275 3 rplB Large ribosomal subunit protein uL2 Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B9KL94 6.25e-102 301 57 1 275 3 rplB Large ribosomal subunit protein uL2 Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J5R9 6.25e-102 301 57 1 275 3 rplB Large ribosomal subunit protein uL2 Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PGL4 6.25e-102 301 57 1 275 3 rplB Large ribosomal subunit protein uL2 Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B9L6N0 6.43e-102 301 55 2 276 3 rplB Large ribosomal subunit protein uL2 Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A7HBM1 7.06e-102 301 56 1 273 3 rplB Large ribosomal subunit protein uL2 Anaeromyxobacter sp. (strain Fw109-5)
Q97EI1 8.57e-102 301 56 3 277 3 rplB Large ribosomal subunit protein uL2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B3QBX7 1.07e-101 300 57 2 278 3 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain TIE-1)
P60403 1.07e-101 300 57 2 278 1 rplB Large ribosomal subunit protein uL2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
C1F639 1.12e-101 300 55 1 275 3 rplB Large ribosomal subunit protein uL2 Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q01W95 1.27e-101 300 56 1 275 3 rplB Large ribosomal subunit protein uL2 Solibacter usitatus (strain Ellin6076)
A5USI6 1.28e-101 300 56 1 275 3 rplB Large ribosomal subunit protein uL2 Roseiflexus sp. (strain RS-1)
A0PXU9 1.72e-101 300 54 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium novyi (strain NT)
A9H3Q5 2.21e-101 300 58 1 272 3 rplB Large ribosomal subunit protein uL2 Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3SSW3 2.21e-101 300 58 1 275 3 rplB Large ribosomal subunit protein uL2 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A4WVK5 2.5e-101 300 56 1 275 3 rplB Large ribosomal subunit protein uL2 Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
C3KVP8 2.52e-101 300 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain 657 / Type Ba4)
B1KSM2 2.94e-101 299 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain Loch Maree / Type A3)
A7GJ71 2.94e-101 299 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FMU8 2.94e-101 299 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain Kyoto / Type A2)
A5I7K3 2.94e-101 299 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ66 2.94e-101 299 55 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain ATCC 19397 / Type A)
A9NED6 3.21e-101 299 55 3 274 3 rplB Large ribosomal subunit protein uL2 Acholeplasma laidlawii (strain PG-8A)
B8ELG0 3.59e-101 299 56 1 274 3 rplB Large ribosomal subunit protein uL2 Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q89J87 3.62e-101 299 57 1 275 3 rplB Large ribosomal subunit protein uL2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q67JU6 3.91e-101 299 58 4 277 3 rplB Large ribosomal subunit protein uL2 Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q839G1 4.5e-101 299 59 3 276 1 rplB Large ribosomal subunit protein uL2 Enterococcus faecalis (strain ATCC 700802 / V583)
B4S5M4 5.14e-101 299 57 2 279 3 rplB Large ribosomal subunit protein uL2 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B1IGF1 9.36e-101 298 54 2 277 3 rplB Large ribosomal subunit protein uL2 Clostridium botulinum (strain Okra / Type B1)
Q30TW1 9.48e-101 298 56 3 275 3 rplB Large ribosomal subunit protein uL2 Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_18990
Feature type CDS
Gene rplB
Product 50S ribosomal protein L2
Location 20695 - 21519 (strand: -1)
Length 825 (nucleotides) / 274 (amino acids)

Contig

Accession ZDB_544
Length 24827 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2396
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00181 Ribosomal Proteins L2, RNA binding domain
PF03947 Ribosomal Proteins L2, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0090 Translation, ribosomal structure and biogenesis (J) J Ribosomal protein L2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02886 large subunit ribosomal protein L2 Ribosome -

Protein Sequence

MAIVKCKPTSPGRRHVVKVVNPELHKGKPYAPLLEKNNKSGGRNNNGRITTRHIGGGHKQNYRIVDFKRNKDGIPAVVERLEYDPNRSANIALVLYKDGERRYILAPKGLKAGDQIQSGVDAAIKAGNALPMRNIPVGSTVHNVEMKPGKGGQLARSAGTYVQIVARDGAYVTIRLRSGEMRKVPSDCRATLGEVGNAEHMLRVLGKAGASRWRGIRPTVRGTAMNPVDHPHGGGEGRNFGKHPVTPWGVQTKGKKTRKNKRTEHFIVHRRTKK

Flanking regions ( +/- flanking 50bp)

GAATCTGGACTTCGTCGGCGGCGCTGAGTAAGTCGGAGGAGTAAAGAACAATGGCAATTGTTAAATGTAAACCTACGTCTCCGGGCCGTCGCCACGTCGTTAAAGTGGTTAACCCTGAGCTTCACAAGGGCAAACCTTACGCACCACTGCTTGAGAAAAACAACAAGTCTGGTGGTCGTAACAACAATGGCCGTATCACTACCCGTCATATTGGTGGTGGTCACAAGCAAAATTACCGTATTGTTGACTTTAAACGTAACAAAGACGGTATCCCGGCTGTTGTAGAACGTCTGGAATATGATCCAAACCGTTCAGCAAATATTGCTCTGGTATTATACAAAGACGGTGAACGCCGTTACATCCTGGCTCCTAAAGGCCTGAAAGCTGGTGATCAAATCCAGTCTGGTGTTGATGCTGCAATCAAAGCGGGTAACGCTCTGCCAATGCGCAACATCCCGGTTGGTTCTACTGTTCATAACGTAGAAATGAAACCAGGTAAAGGCGGCCAGCTGGCACGTTCTGCCGGTACTTACGTTCAGATCGTTGCGCGCGATGGTGCTTATGTCACTATTCGTCTGCGTTCCGGTGAAATGCGTAAAGTTCCTTCAGACTGCCGCGCGACTTTAGGTGAAGTGGGTAACGCTGAACACATGCTGCGCGTTCTGGGTAAAGCTGGTGCAAGCCGCTGGCGTGGTATTCGCCCTACCGTTCGCGGTACTGCGATGAACCCGGTAGACCACCCACATGGTGGTGGTGAAGGTCGTAACTTTGGTAAACACCCTGTAACACCATGGGGCGTTCAGACCAAAGGTAAGAAGACTCGTAAAAACAAACGCACTGAACACTTCATCGTTCATCGTCGTACTAAGAAATAATTAGAGGATAAGCCATGCCACGTTCTCTCAAGAAAGGTCCTTTTATTGAC