Homologs in group_2388

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19000 FBDBKF_19000 100.0 Morganella morganii S1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
EHELCC_18745 EHELCC_18745 100.0 Morganella morganii S2 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
LHKJJB_18615 LHKJJB_18615 100.0 Morganella morganii S3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
HKOGLL_18350 HKOGLL_18350 100.0 Morganella morganii S5 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
F4V73_RS13910 F4V73_RS13910 89.1 Morganella psychrotolerans ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
PMI_RS11045 PMI_RS11045 57.4 Proteus mirabilis HI4320 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

Distribution of the homologs in the orthogroup group_2388

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2388

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8K7 1.29e-105 308 67 2 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A9N2D3 1.3e-97 288 63 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BEY4 1.44e-97 288 61 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PEG1 1.44e-97 288 61 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C0PXA7 2.41e-97 287 63 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella paratyphi C (strain RKS4594)
Q57KJ4 2.41e-97 287 63 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella choleraesuis (strain SC-B67)
B4T457 1.06e-96 286 63 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella newport (strain SL254)
Q8Z471 2.05e-96 285 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella typhi
B4TTW1 2.05e-96 285 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella schwarzengrund (strain CVM19633)
Q8ZMF6 3.17e-96 285 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MF28 1.3e-95 283 60 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TFW7 1.33e-95 283 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella heidelberg (strain SL476)
B5RDQ3 1.33e-95 283 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW18 1.33e-95 283 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FTS5 1.33e-95 283 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella dublin (strain CT_02021853)
A8ANW1 1.57e-95 283 61 3 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A8G9Z2 2.95e-95 282 60 3 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Serratia proteamaculans (strain 568)
B5F411 7.3e-95 281 62 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salmonella agona (strain SL483)
Q1R7U4 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain UTI89 / UPEC)
Q8FEJ5 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEB1 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEU1 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O1:K1 / APEC
B7MYQ2 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O81 (strain ED1a)
B7MKM1 1.42e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LQ67 1.54e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
A6TD39 1.87e-94 280 60 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q66EC3 2.36e-94 280 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7C093 2.57e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella flexneri
Q0T1H8 2.57e-94 280 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella flexneri serotype 5b (strain 8401)
B7LWK8 4.94e-94 279 59 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7UHG6 5.76e-94 279 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XV34 6.15e-94 279 62 5 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Klebsiella pneumoniae (strain 342)
B5Z3A9 8.26e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7Y4 8.26e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O157:H7
Q3YYB5 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella sonnei (strain Ss046)
Q32CI3 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q31XA9 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TZI4 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I6D7 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain SE11)
Q46893 8.54e-94 278 60 3 240 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain K12)
B1IUT2 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3M6 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O9:H4 (strain HS)
B1XCS3 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain K12 / DH10B)
C4ZZQ1 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXF9 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O8 (strain IAI1)
B7LEG5 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZQJ1 8.54e-94 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
A7MJ57 9.52e-94 278 59 3 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
B7NT91 1.11e-93 278 60 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A4TPZ7 1.45e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pestis (strain Pestoides F)
Q1CLR6 1.45e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R119 1.45e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBP6 1.45e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pestis
B1JJF8 1.46e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B2K577 1.46e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FLX8 1.46e-93 278 59 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6LMT3 2.99e-93 277 60 4 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Photobacterium profundum (strain SS9)
B7N6X7 3.94e-93 276 59 3 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A4WDV2 1.54e-92 275 60 5 245 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Enterobacter sp. (strain 638)
Q6D1B3 6.51e-87 261 57 5 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NVM4 3e-85 257 58 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Sodalis glossinidius (strain morsitans)
C6DDG2 1.86e-83 252 57 5 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q9KUJ2 2.33e-83 252 56 4 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EBR2 6.04e-83 251 57 3 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q086A8 2.54e-82 249 55 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q1LTP8 3.73e-82 249 55 2 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
B7VK66 8.36e-82 248 53 4 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vibrio atlanticus (strain LGP32)
Q15P31 2.04e-81 247 57 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q12PZ2 2.18e-81 247 56 4 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0KGH5 4.25e-81 246 57 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8DC60 4.48e-80 243 55 2 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vibrio vulnificus (strain CMCP6)
Q7MHQ4 5.82e-80 243 55 2 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vibrio vulnificus (strain YJ016)
Q87LQ2 6.08e-80 243 56 3 230 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B8CJP8 1.34e-78 239 54 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
B6EKL6 2.24e-78 239 51 4 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aliivibrio salmonicida (strain LFI1238)
C4LBQ9 2.67e-78 239 54 4 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B3H1E1 6.33e-78 238 51 4 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q5E328 1.42e-77 237 51 3 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FAF7 2.64e-77 236 51 3 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aliivibrio fischeri (strain MJ11)
A5UE59 4.81e-77 235 51 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Haemophilus influenzae (strain PittEE)
O05029 5.42e-77 235 51 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHG1 5.42e-77 235 51 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Haemophilus influenzae (strain PittGG)
Q4QMP4 6.25e-77 235 51 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Haemophilus influenzae (strain 86-028NP)
A3N0G2 7.52e-77 235 50 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VLT5 1.2e-76 234 51 3 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BP82 1.58e-76 234 50 3 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P57953 2.9e-76 234 51 3 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pasteurella multocida (strain Pm70)
A3QC79 4.33e-76 233 54 4 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B0TK06 5.51e-75 230 52 4 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella halifaxensis (strain HAW-EB4)
A8H1S7 8.24e-75 230 51 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8K9D6 1.29e-74 229 49 3 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A8FST0 1.34e-74 229 55 4 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella sediminis (strain HAW-EB3)
B4RZG5 2.83e-73 226 52 4 238 3 ispD1 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
P57495 1.39e-72 224 48 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q65Q78 3.72e-72 223 49 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1S4D9 2.18e-71 221 51 4 244 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q494E8 7.56e-71 220 46 3 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q8D223 8.42e-70 217 42 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Wigglesworthia glossinidia brevipalpis
Q487E9 1.03e-69 217 50 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IDQ6 3.96e-68 213 48 4 246 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudoalteromonas translucida (strain TAC 125)
A4XWR9 8.11e-67 210 52 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas mendocina (strain ymp)
Q3JCS9 5.21e-66 207 46 2 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A6VQY1 3.19e-64 203 48 5 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q604M2 3.95e-62 197 46 2 243 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q48F81 1.86e-61 196 48 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZWQ6 1.13e-60 194 47 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas syringae pv. syringae (strain B728a)
B0KSC1 1.31e-60 194 48 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas putida (strain GB-1)
B1JB36 1.33e-60 194 48 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas putida (strain W619)
A5W827 9.07e-60 192 47 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88MF7 1.46e-59 191 47 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q886M1 4.13e-59 190 47 3 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KH90 4.67e-59 190 48 4 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas fluorescens (strain Pf0-1)
C3K6H8 8.2e-59 189 46 3 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas fluorescens (strain SBW25)
Q1I648 1.33e-57 186 47 4 224 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas entomophila (strain L48)
Q4KHF4 6.92e-57 184 45 4 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2SKW7 1.01e-56 184 40 2 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Hahella chejuensis (strain KCTC 2396)
Q1QU73 5.4e-56 182 47 4 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5QUC3 1.1e-52 174 40 7 248 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q02RA5 1.32e-52 173 47 4 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V1F5 2.1e-52 173 46 3 222 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas aeruginosa (strain PA7)
B2I2A2 3.2e-52 172 44 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acinetobacter baumannii (strain ACICU)
P57707 4.63e-52 172 46 3 222 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A3M5X8 2.64e-51 170 44 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0V5E6 2.85e-51 170 44 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acinetobacter baumannii (strain AYE)
B4SR88 9.73e-51 169 44 2 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Stenotrophomonas maltophilia (strain R551-3)
B0VQH8 1.41e-50 168 43 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acinetobacter baumannii (strain SDF)
A1AX25 1.26e-49 166 40 5 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Ruthia magnifica subsp. Calyptogena magnifica
B2FK90 1.78e-49 165 44 2 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Stenotrophomonas maltophilia (strain K279a)
A1K644 3.07e-48 162 43 7 243 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Azoarcus sp. (strain BH72)
Q6FAU1 4.55e-47 159 42 5 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1KUV0 7.93e-47 158 46 7 224 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A5CW51 8.32e-47 159 37 5 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q8XYW3 1.53e-46 158 45 9 248 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JTM3 1.07e-45 155 45 7 224 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F829 1.21e-45 155 43 7 233 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q2P1L0 1.42e-45 156 42 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4RL14 1.54e-45 155 43 7 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5GYK6 1.65e-45 156 42 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUA8 1.65e-45 156 42 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q8P9Z1 2.78e-45 155 45 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTP4 2.78e-45 155 45 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q5NYJ9 3.55e-45 154 41 6 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3SK38 4.22e-45 154 42 6 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B0RU03 5.3e-45 155 45 3 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas campestris pv. campestris (strain B100)
A9M0U7 7.59e-45 153 43 7 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q9JYM4 1.39e-44 152 44 7 224 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
C1D558 1.64e-44 152 44 6 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Laribacter hongkongensis (strain HLHK9)
Q1BHA5 2.03e-43 150 42 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia orbicola (strain AU 1054)
A0K867 2.03e-43 150 42 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia cenocepacia (strain HI2424)
A4JF20 2.44e-43 150 42 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A9AIT5 4.65e-43 149 42 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q39FB8 7.3e-43 148 40 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2Y751 8.55e-43 148 41 6 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0BED6 1.42e-42 147 40 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B4EC23 1.57e-42 147 42 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q9PDT6 6.62e-42 146 42 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xylella fastidiosa (strain 9a5c)
Q3BUS8 6.9e-42 147 42 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PLR8 7.35e-42 147 42 3 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xanthomonas axonopodis pv. citri (strain 306)
B2JGK2 1.03e-41 145 41 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q47EL2 1.42e-41 145 42 5 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Dechloromonas aromatica (strain RCB)
Q2SWT6 1.68e-41 145 39 3 232 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q472F2 1.95e-41 145 43 8 245 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0AFW3 2.57e-41 144 42 8 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82UR9 3.44e-41 144 41 8 251 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B0U660 5.27e-41 144 41 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xylella fastidiosa (strain M12)
Q87DY4 6.74e-41 143 41 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I939 6.74e-41 143 41 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Xylella fastidiosa (strain M23)
B2T3X2 8.7e-41 143 39 2 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13Z31 1.23e-40 143 39 2 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Paraburkholderia xenovorans (strain LB400)
A1WWZ0 1.28e-40 143 41 5 246 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q63T70 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia pseudomallei (strain K96243)
A3NAL9 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia pseudomallei (strain 668)
Q3JR99 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia pseudomallei (strain 1710b)
A3NWE0 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia pseudomallei (strain 1106a)
A1V500 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia mallei (strain SAVP1)
Q62JI5 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia mallei (strain ATCC 23344)
A2SBD6 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia mallei (strain NCTC 10229)
A3MKM4 2.39e-40 142 39 3 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Burkholderia mallei (strain NCTC 10247)
Q7NYL6 7.94e-40 140 44 8 225 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q21YT7 3.86e-38 140 41 6 226 3 ispDF Bifunctional enzyme IspD/IspF Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q9KGF8 1.33e-37 134 35 5 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B5EMB5 4.04e-36 131 43 5 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4C0 4.04e-36 131 43 5 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A0LIS2 1.9e-35 129 38 5 230 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A5G938 1.61e-34 127 36 8 247 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Geotalea uraniireducens (strain Rf4)
Q7W5C9 3.17e-34 126 40 7 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q2LUS9 3.45e-34 126 34 6 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Syntrophus aciditrophicus (strain SB)
Q6ARN9 1.4e-33 128 37 8 238 3 ispDF Bifunctional enzyme IspD/IspF Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2RFM0 1.57e-33 124 35 6 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q3A8C6 1.81e-33 124 36 6 252 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q2RTS1 2.72e-33 127 37 6 243 3 ispDF Bifunctional enzyme IspD/IspF Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q7VZN2 5.74e-32 120 39 6 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WCW3 5.74e-32 120 39 6 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A6TWL0 6.92e-32 120 34 6 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Alkaliphilus metalliredigens (strain QYMF)
Q18CD1 7.52e-32 120 31 5 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridioides difficile (strain 630)
A7Z0L2 7.88e-32 120 34 5 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q98MX9 1.94e-31 122 36 7 237 3 ispDF Bifunctional enzyme IspD/IspF Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A4J0Y3 2.25e-31 119 34 5 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q39ZL5 4.27e-31 118 35 6 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q746Z9 7.02e-31 117 35 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0JUF7 1.56e-30 116 36 9 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q027G1 1.61e-30 117 33 6 250 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Solibacter usitatus (strain Ellin6076)
Q8YAB5 2.09e-30 116 37 5 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A9II44 2.22e-30 115 40 8 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
C1F763 5.91e-30 115 33 4 243 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
C4Z312 6.02e-30 115 30 8 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q724H7 7.63e-30 114 37 5 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Listeria monocytogenes serotype 4b (strain F2365)
Q2K8V5 7.93e-30 118 37 8 241 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2W4Q8 9.21e-30 118 35 5 229 3 ispDF Bifunctional enzyme IspD/IspF Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q92F40 1.26e-29 114 37 5 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A7GJZ7 2.12e-29 113 35 6 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q4FR76 2.69e-29 114 32 6 263 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1MH21 3.86e-29 116 37 9 245 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A0PXS4 4.36e-29 112 31 7 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium novyi (strain NT)
A9KSU6 1.12e-28 112 32 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q65PD2 1.22e-28 111 35 7 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P74323 1.48e-28 111 36 9 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9VN98 1.78e-28 111 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus mycoides (strain KBAB4)
Q8YLX9 4.25e-28 110 34 7 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B3PYS4 4.94e-28 113 38 8 242 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium etli (strain CIAT 652)
Q8UFF4 4.98e-28 113 37 7 236 3 ispDF Bifunctional enzyme IspD/IspF Agrobacterium fabrum (strain C58 / ATCC 33970)
B5ZNB6 5.01e-28 113 38 9 242 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q11HV9 5.08e-28 113 35 5 211 3 ispDF Bifunctional enzyme IspD/IspF Chelativorans sp. (strain BNC1)
Q1Q9K8 5.23e-28 111 33 7 260 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q3MAF5 5.65e-28 109 33 7 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A2BVB5 7.04e-28 109 32 6 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9515)
Q06755 1.17e-27 109 34 6 228 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus subtilis (strain 168)
Q7V2M1 2.84e-27 107 32 6 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q73FC1 3.21e-27 107 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPT2 4.18e-27 107 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63HB4 4.18e-27 107 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus cereus (strain ZK / E33L)
Q81VV5 4.18e-27 107 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus anthracis
A0R8F7 4.18e-27 107 34 7 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus thuringiensis (strain Al Hakam)
A7HXV6 4.51e-27 110 35 7 240 3 ispDF Bifunctional enzyme IspD/IspF Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A5D5L4 6.65e-27 107 35 5 224 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5N4M5 1.4e-26 106 31 8 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DY87 1.4e-26 106 31 8 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium kluyveri (strain NBRC 12016)
Q7UM15 1.55e-26 106 30 6 256 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q5L433 5.84e-26 104 33 6 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Geobacillus kaustophilus (strain HTA426)
B9JW91 8.82e-26 107 38 12 250 3 ispDF Bifunctional enzyme IspD/IspF Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q0BTD5 9.32e-26 107 35 6 226 3 ispDF Bifunctional enzyme IspD/IspF Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q81J63 9.64e-26 103 34 8 244 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A2BPT7 1.29e-25 103 32 7 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain AS9601)
Q92Q90 1.7e-25 107 37 7 230 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium meliloti (strain 1021)
A3PBH7 2.86e-25 102 32 7 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9301)
A1USA2 3.77e-25 105 33 8 235 3 ispDF Bifunctional enzyme IspD/IspF Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A9BHR2 4.62e-25 102 30 4 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Petrotoga mobilis (strain DSM 10674 / SJ95)
A8MLB1 5.02e-25 102 30 6 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Alkaliphilus oremlandii (strain OhILAs)
Q7VDC7 7.1e-25 101 34 9 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B2J1D2 9.05e-25 101 34 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A6LPN9 1.29e-24 100 28 5 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q8R7S6 1.44e-24 100 32 6 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2JUE5 2.71e-24 100 35 9 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain JA-3-3Ab)
A9IS87 4.73e-24 102 32 6 220 3 ispDF Bifunctional enzyme IspD/IspF Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q46GW4 4.83e-24 99 33 6 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain NATL2A)
A5VQP4 4.93e-24 102 32 6 237 3 ispDF Bifunctional enzyme IspD/IspF Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q31C80 5.54e-24 99 31 7 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9312)
A8G3G9 6.81e-24 99 31 7 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9215)
Q67JP5 7.96e-24 99 34 7 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q6G3Z8 9.36e-24 102 31 8 238 3 ispDF Bifunctional enzyme IspD/IspF Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P69834 1.05e-23 100 28 4 233 1 ISPD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic Arabidopsis thaliana
Q6G164 1.21e-23 101 31 7 232 3 ispDF Bifunctional enzyme IspD/IspF Bartonella quintana (strain Toulouse)
O67343 1.57e-23 97 34 8 225 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Aquifex aeolicus (strain VF5)
Q3ALY8 2.45e-23 97 34 6 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain CC9605)
A8F958 2.61e-23 97 32 8 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacillus pumilus (strain SAFR-032)
A5EIY9 2.79e-23 100 34 5 226 3 ispDF Bifunctional enzyme IspD/IspF Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q6MEE8 2.9e-23 97 31 4 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Protochlamydia amoebophila (strain UWE25)
Q8YHD8 3.12e-23 100 31 6 233 3 ispDF Bifunctional enzyme IspD/IspF Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57D18 3.12e-23 100 31 6 233 3 ispDF Bifunctional enzyme IspD/IspF Brucella abortus biovar 1 (strain 9-941)
Q2YPW1 3.12e-23 100 31 6 233 3 ispDF Bifunctional enzyme IspD/IspF Brucella abortus (strain 2308)
Q8FMI3 3.6e-23 97 33 7 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q0C0N0 4.67e-23 99 33 6 230 3 ispDF Bifunctional enzyme IspD/IspF Hyphomonas neptunium (strain ATCC 15444)
Q31QF6 5.84e-23 96 34 6 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8G0H4 6.1e-23 99 31 6 233 3 ispDF Bifunctional enzyme IspD/IspF Brucella suis biovar 1 (strain 1330)
A6X0N1 7.77e-23 99 30 7 253 3 ispDF Bifunctional enzyme IspD/IspF Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9Z7X5 1.95e-22 94 31 6 223 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia pneumoniae
A4YUQ7 2.33e-22 98 35 6 210 3 ispDF Bifunctional enzyme IspD/IspF Bradyrhizobium sp. (strain ORS 278)
A4QH60 2.56e-22 95 34 7 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Corynebacterium glutamicum (strain R)
A4IJG4 2.81e-22 94 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Geobacillus thermodenitrificans (strain NG80-2)
B2TIF4 3.15e-22 94 29 8 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Eklund 17B / Type B)
Q5N3T2 3.26e-22 94 33 6 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q97EC9 4.54e-22 94 27 6 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6U8F8 4.68e-22 97 36 8 231 3 ispDF Bifunctional enzyme IspD/IspF Sinorhizobium medicae (strain WSM419)
B9KSH8 5.09e-22 94 32 5 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A5I7N1 5.54e-22 94 31 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FZ94 5.54e-22 94 31 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
Q8NMB8 5.79e-22 94 33 8 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1KTA8 6.14e-22 94 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
Q9RR90 6.81e-22 94 37 7 225 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
C3KVS6 7.33e-22 94 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q0S890 7.81e-22 93 36 9 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Rhodococcus jostii (strain RHA1)
A3PJQ3 9.22e-22 93 32 5 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
C1BAC2 1.02e-21 93 36 9 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Rhodococcus opacus (strain B4)
B1I0S9 1.03e-21 96 33 6 229 3 ispDF Bifunctional enzyme IspD/IspF Desulforudis audaxviator (strain MP104C)
A7GJ99 1.03e-21 93 31 7 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q3J2K9 1.04e-21 93 32 5 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
C1FMX6 1.38e-21 93 30 6 230 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A8IBL6 1.53e-21 95 37 6 232 3 ispDF Bifunctional enzyme IspD/IspF Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A9BE76 1.89e-21 92 34 8 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9211)
Q0SQB9 1.91e-21 92 30 10 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium perfringens (strain SM101 / Type A)
B9JF01 2.15e-21 95 33 6 235 3 ispDF Bifunctional enzyme IspD/IspF Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C4XSW4 2.4e-21 95 35 8 229 3 ispDF Bifunctional enzyme IspD/IspF Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B1IGH9 2.58e-21 92 30 6 230 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium botulinum (strain Okra / Type B1)
Q8XHQ3 2.75e-21 92 30 10 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium perfringens (strain 13 / Type A)
Q0TMM2 2.75e-21 92 30 10 242 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A4WSL5 3.83e-21 91 31 5 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q1QM99 6.23e-21 94 34 5 223 3 ispDF Bifunctional enzyme IspD/IspF Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q3ZWE1 6.85e-21 91 29 8 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Dehalococcoides mccartyi (strain CBDB1)
A5FP88 6.85e-21 91 29 8 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B0C9F6 7.3e-21 91 34 8 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Acaryochloris marina (strain MBIC 11017)
B9MJW2 7.68e-21 90 32 7 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
C0ZPR7 1.17e-20 90 33 5 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q73G24 1.2e-20 93 29 6 231 3 ispDF Bifunctional enzyme IspD/IspF Wolbachia pipientis wMel
Q88W46 1.44e-20 90 31 10 238 3 tarI Ribitol-5-phosphate cytidylyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q48230 1.63e-20 93 31 8 234 1 bcs1 Bifunctional ribulose 5-phosphate reductase/CDP-ribitol pyrophosphorylase Bcs1 Haemophilus influenzae
Q5L6V2 1.71e-20 89 28 4 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
B5YF77 1.88e-20 90 27 5 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q7U559 2.3e-20 89 33 6 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Parasynechococcus marenigrum (strain WH8102)
Q4JXJ7 2.99e-20 90 32 9 276 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Corynebacterium jeikeium (strain K411)
Q310X3 5.56e-20 91 34 11 240 3 ispDF Bifunctional enzyme IspD/IspF Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q89LQ8 9.03e-20 90 33 4 207 3 ispDF Bifunctional enzyme IspD/IspF Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7V647 1.07e-19 87 33 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prochlorococcus marinus (strain MIT 9313)
Q8DL91 1.11e-19 88 35 9 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A4F6W3 1.92e-19 87 34 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A6LPA6 2.12e-19 87 28 4 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5GMW9 2.85e-19 86 34 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain WH7803)
Q890M1 3.75e-19 87 26 7 255 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Clostridium tetani (strain Massachusetts / E88)
B1WSY4 4.69e-19 86 35 8 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q03A83 5.25e-19 86 28 7 238 3 tarI Ribitol-5-phosphate cytidylyltransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q0I880 7.56e-19 85 36 8 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain CC9311)
Q2IQG8 9.55e-19 87 31 4 225 3 ispDF Bifunctional enzyme IspD/IspF Anaeromyxobacter dehalogenans (strain 2CP-C)
Q118M1 1.09e-18 85 35 7 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Trichodesmium erythraeum (strain IMS101)
Q824I4 1.15e-18 84 30 6 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9RNZ1 2.02e-18 87 35 4 225 3 ispDF Bifunctional enzyme IspD/IspF Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A4XLJ3 2.92e-18 84 27 7 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q5Z2R3 3.36e-18 84 32 7 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Nocardia farcinica (strain IFM 10152)
Q5N8G1 4.56e-18 84 30 6 229 2 ISPD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic Oryza sativa subsp. japonica
B1GYT4 5.28e-18 83 30 7 219 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Endomicrobium trichonymphae
Q5WLT7 5.51e-18 83 31 6 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Shouchella clausii (strain KSM-K16)
Q3ZAD7 5.65e-18 83 30 9 239 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q2G708 7.4e-18 85 34 7 235 3 ispDF Bifunctional enzyme IspD/IspF Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8R6H2 7.85e-18 83 27 6 232 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q04XR1 8.88e-18 82 31 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VR0 8.88e-18 82 31 7 234 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B7IF61 1.21e-17 82 23 4 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermosipho africanus (strain TCF52B)
Q28Q60 1.4e-17 84 32 7 239 3 ispDF Bifunctional enzyme IspD/IspF Jannaschia sp. (strain CCS1)
Q253C1 1.4e-17 82 31 6 222 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia felis (strain Fe/C-56)
Q3A9N7 1.44e-17 82 29 4 218 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
B9K8U1 1.71e-17 82 30 7 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q3AWK9 1.78e-17 82 34 8 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Synechococcus sp. (strain CC9902)
Q6NFC1 1.82e-17 82 32 6 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q3SSN8 1.99e-17 84 30 5 207 3 ispDF Bifunctional enzyme IspD/IspF Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2GEM3 2.36e-17 81 31 7 222 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q5FQD6 3.26e-17 83 32 7 240 3 ispDF Bifunctional enzyme IspD/IspF Gluconobacter oxydans (strain 621H)
B1LBT2 4.25e-17 80 30 5 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermotoga sp. (strain RQ2)
Q82GC8 4.52e-17 81 32 8 243 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9X1B3 4.91e-17 80 30 5 226 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5V2U9 5.17e-17 82 37 6 180 3 ispDF Bifunctional enzyme IspD/IspF Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A0A0Q3NN41 7.51e-17 80 27 5 230 1 HS5.18 D-fructose-6-phosphate cytidylyltransferase Campylobacter jejuni
Q9L0Q8 1.11e-16 80 34 11 245 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B6YQA2 1.11e-16 79 28 9 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q1AU08 1.14e-16 79 32 9 248 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A5IMI1 1.22e-16 79 29 4 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q8Y832 1.33e-16 79 26 8 236 3 tarI Ribitol-5-phosphate cytidylyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8RKI9 1.52e-16 79 28 8 238 1 tarI Ribitol-5-phosphate cytidylyltransferase Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
B1HNM7 1.53e-16 79 31 6 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Lysinibacillus sphaericus (strain C3-41)
Q8A0U8 1.83e-16 79 29 8 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6ADI0 2.6e-16 80 32 8 227 3 ispDF Bifunctional enzyme IspD/IspF Leifsonia xyli subsp. xyli (strain CTCB07)
A0JPF9 2.9e-16 81 29 7 238 2 crppa D-ribitol-5-phosphate cytidylyltransferase Danio rerio
B4S8U7 3.49e-16 79 28 8 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q8CQ77 4.12e-16 78 27 8 237 3 tarI Ribitol-5-phosphate cytidylyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q92CV0 4.49e-16 78 26 8 238 3 tarI Ribitol-5-phosphate cytidylyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8NYI0 5.1e-16 78 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain MW2)
Q6GCM3 5.1e-16 78 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain MSSA476)
Q165P6 5.14e-16 77 30 5 210 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2IW23 5.35e-16 80 33 6 208 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain HaA2)
Q1J200 5.36e-16 77 35 6 221 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q2YV76 5.7e-16 78 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6N6M5 6.98e-16 79 33 6 208 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q5HRJ7 9.45e-16 77 26 8 237 3 tarI Ribitol-5-phosphate cytidylyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2HJ23 1.56e-15 76 35 7 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q7A1W0 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain MW2)
Q6GCL7 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain MSSA476)
Q6GK57 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain MRSA252)
Q7A7V0 1.84e-15 76 28 8 238 1 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain N315)
Q99WW8 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJC1 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain COL)
Q2G1C0 1.84e-15 76 28 8 238 1 tarI Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK15 1.84e-15 76 28 8 238 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain USA300)
Q8F7A0 1.92e-15 76 31 9 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72P59 1.92e-15 76 31 9 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2YV73 2.3e-15 76 27 9 239 3 tarI1 Ribitol-5-phosphate cytidylyltransferase 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
P65177 2.42e-15 76 28 9 239 1 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain N315)
P65176 2.42e-15 76 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJC5 2.42e-15 76 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain COL)
Q2G2C4 2.42e-15 76 28 9 239 1 tarI' Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GK63 2.65e-15 76 28 9 239 3 tarI2 Ribitol-5-phosphate cytidylyltransferase 2 Staphylococcus aureus (strain MRSA252)
A4SF04 2.69e-15 76 28 8 248 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q137C3 3.57e-15 77 31 6 207 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain BisB5)
Q47LV0 4.62e-15 75 31 8 235 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermobifida fusca (strain YX)
Q4A0A8 5.42e-15 75 29 10 238 3 tarI Ribitol-5-phosphate cytidylyltransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q07MZ2 6.04e-15 77 30 5 207 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain BisA53)
B3QIL5 6.71e-15 77 32 6 208 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain TIE-1)
Q48154 7.51e-15 77 28 8 224 1 acs1 Bifunctional ribulose 5-phosphate reductase/CDP-ribitol pyrophosphorylase Acs1 Haemophilus influenzae
A6KXL8 1.47e-14 73 30 9 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q7NGU6 2.56e-14 73 30 5 238 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q1MR76 2.64e-14 75 30 8 233 3 ispDF Bifunctional enzyme IspD/IspF Lawsonia intracellularis (strain PHE/MN1-00)
Q64P77 2.67e-14 73 30 7 231 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacteroides fragilis (strain YCH46)
Q5SLX2 3.01e-14 72 33 8 227 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GN3 3.01e-14 72 33 8 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
E1BCH6 3.31e-14 75 27 6 238 3 CRPPA D-ribitol-5-phosphate cytidylyltransferase Bos taurus
Q5L917 3.99e-14 72 31 8 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A1VDX6 4.31e-14 74 30 7 237 3 ispDF Bifunctional enzyme IspD/IspF Nitratidesulfovibrio vulgaris (strain DP4)
Q72C30 4.31e-14 74 30 7 237 3 ispDF Bifunctional enzyme IspD/IspF Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DYQ7 5.61e-14 72 27 7 231 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q4FM31 5.7e-14 73 26 7 223 3 ispDF Bifunctional enzyme IspD/IspF Pelagibacter ubique (strain HTCC1062)
Q3K093 6.56e-14 72 27 7 231 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E4B4 7.77e-14 72 28 8 231 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus agalactiae serotype III (strain NEM316)
A8LKV5 7.84e-14 73 31 7 217 3 ispDF Bifunctional enzyme IspD/IspF Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q1GGW9 8.95e-14 73 29 7 234 3 ispDF Bifunctional enzyme IspD/IspF Ruegeria sp. (strain TM1040)
B3EQ34 1.09e-13 72 29 11 250 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobium phaeobacteroides (strain BS1)
Q08113 1.14e-13 73 30 6 227 3 ispDF Bifunctional enzyme IspD/IspF Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P9WKG9 1.49e-13 71 32 6 229 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKG8 1.49e-13 71 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U8Q7 1.49e-13 71 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AI41 1.49e-13 71 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KPR8 1.49e-13 71 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TW54 1.84e-13 70 32 6 229 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q720Y7 1.87e-13 71 25 7 238 1 tarI Ribitol-5-phosphate cytidylyltransferase Listeria monocytogenes serotype 4b (strain F2365)
A4D126 3.4e-13 72 28 6 236 1 CRPPA D-ribitol-5-phosphate cytidylyltransferase Homo sapiens
B8ZJT5 4.09e-13 70 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q8DPI2 5.62e-13 69 28 9 239 1 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QE5 5.62e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04K52 5.62e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2S210 5.63e-13 69 32 8 228 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Salinibacter ruber (strain DSM 13855 / M31)
C1CR35 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CL05 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain P1031)
C1CEM5 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain JJA)
B1IC62 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
C1C7P9 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain 70585)
B5E508 5.73e-13 69 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
B4SAG7 5.84e-13 69 27 10 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A1B890 7.06e-13 70 31 8 225 3 ispDF Bifunctional enzyme IspD/IspF Paracoccus denitrificans (strain Pd 1222)
B3QXK8 7.24e-13 69 24 6 237 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q87Q30 1.15e-12 68 29 8 232 3 VP1320 Ribitol-5-phosphate cytidylyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7HDA2 1.2e-12 70 31 7 241 3 ispDF Bifunctional enzyme IspD/IspF Anaeromyxobacter sp. (strain Fw109-5)
B3QP85 1.63e-12 68 27 10 240 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B2IQ63 2e-12 68 28 9 239 3 tarI Ribitol-5-phosphate cytidylyltransferase Streptococcus pneumoniae (strain CGSP14)
Q5S6T3 2.05e-12 69 25 6 252 2 Crppa D-ribitol-5-phosphate cytidylyltransferase Rattus norvegicus
Q7MUQ9 2.72e-12 67 28 9 225 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RJ15 2.75e-12 67 28 9 225 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q214R1 3.49e-12 68 30 5 207 3 ispDF Bifunctional enzyme IspD/IspF Rhodopseudomonas palustris (strain BisB18)
Q3B3A7 4.32e-12 67 30 9 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A5CTY4 4.47e-12 68 34 9 242 3 ispDF Bifunctional enzyme IspD/IspF Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B8GW85 6.38e-12 68 31 7 236 3 ispDF Bifunctional enzyme IspD/IspF Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A7I5 6.38e-12 68 31 7 236 3 ispDF Bifunctional enzyme IspD/IspF Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8KCU3 8.14e-12 66 29 11 246 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q5RJG7 8.33e-12 68 25 5 236 2 Crppa D-ribitol-5-phosphate cytidylyltransferase Mus musculus
Q0APQ6 9.33e-12 67 32 5 225 3 ispDF Bifunctional enzyme IspD/IspF Maricaulis maris (strain MCS10)
Q3AS33 2.51e-11 65 29 10 243 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlorobium chlorochromatii (strain CaD3)
Q28CZ7 2.84e-11 66 26 6 234 2 crppa D-ribitol-5-phosphate cytidylyltransferase Xenopus tropicalis
A0PV29 3.17e-11 64 34 7 201 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium ulcerans (strain Agy99)
Q9PJT1 3.19e-11 64 28 7 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia muridarum (strain MoPn / Nigg)
O84468 4.4e-11 64 28 6 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLN6 4.4e-11 64 28 6 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B3DTQ9 5.07e-11 65 24 7 241 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bifidobacterium longum (strain DJO10A)
B0BCA0 7.64e-11 63 28 6 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B835 7.64e-11 63 28 6 227 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q743W5 9.44e-11 63 33 9 231 1 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B7GMX1 1.76e-10 63 24 6 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q8G7E2 1.81e-10 63 24 6 226 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Bifidobacterium longum (strain NCC 2705)
Q6AAV8 2.25e-10 62 27 3 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q2J542 4.26e-10 62 33 9 236 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q5LRN5 4.29e-10 62 33 9 239 3 ispDF Bifunctional enzyme IspD/IspF Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O83525 8.26e-10 62 32 4 170 3 ispDF Bifunctional enzyme IspD/IspF Treponema pallidum (strain Nichols)
Q83MX3 1.74e-09 61 25 6 246 3 ispDF Bifunctional enzyme IspD/IspF Tropheryma whipplei (strain Twist)
Q83NK3 1.74e-09 61 25 6 246 3 ispDF Bifunctional enzyme IspD/IspF Tropheryma whipplei (strain TW08/27)
Q2NAE1 5.45e-09 59 31 8 224 3 ispDF Bifunctional enzyme IspD/IspF Erythrobacter litoralis (strain HTCC2594)
A6Q2K0 8.83e-09 58 24 8 230 3 ispDF Bifunctional enzyme IspD/IspF Nitratiruptor sp. (strain SB155-2)
Q1GTN0 1.08e-07 55 31 7 240 3 ispDF Bifunctional enzyme IspD/IspF Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A7GZI1 1.86e-07 54 25 7 226 3 ispDF Bifunctional enzyme IspD/IspF Campylobacter curvus (strain 525.92)
A7ZCQ2 4.56e-06 50 24 8 225 3 ispDF Bifunctional enzyme IspD/IspF Campylobacter concisus (strain 13826)
Q30QG7 9.18e-06 49 24 7 225 3 ispDF Bifunctional enzyme IspD/IspF Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9CCW6 1.23e-05 48 31 8 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium leprae (strain TN)
B8ZUA7 1.23e-05 48 31 8 233 3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase Mycobacterium leprae (strain Br4923)
A7I1V2 1.44e-05 49 22 7 225 3 ispDF Bifunctional enzyme IspD/IspF Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q9CEF8 4.89e-05 47 41 0 60 3 glmU Bifunctional protein GlmU Lactococcus lactis subsp. lactis (strain IL1403)
Q02WW6 5.07e-05 47 41 0 60 3 glmU Bifunctional protein GlmU Lactococcus lactis subsp. cremoris (strain SK11)
A2RMV7 5.26e-05 47 41 0 60 3 glmU Bifunctional protein GlmU Lactococcus lactis subsp. cremoris (strain MG1363)
Q7MQW9 0.000102 46 25 9 228 3 ispDF Bifunctional enzyme IspD/IspF Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_18560
Feature type CDS
Gene ispD
Product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
Location 7807 - 8583 (strand: 1)
Length 777 (nucleotides) / 258 (amino acids)
In genomic island -

Contig

Accession ZDB_542
Length 25512 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2388
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01128 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1211 Lipid transport and metabolism (I) I 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00991 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [EC:2.7.7.60] Terpenoid backbone biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
C5 isoprenoid biosynthesis, non-mevalonate pathway

Protein Sequence

MTGAQPAPDLSGISDDAPVTALIPAAGTGTRMQCECPKQYLIIAGKTILEHTLAILLEHPRITQVVVALHPQDTVFSTLPVARHPRIRTVTGGGERADSVLAGLDYLADHTPENSWVLVHDAARPCLQLTDLNRLLAVMSDTQTGNRVQGAILASPVRDTMKRGVASAGYTGIDHTVERTQLWHALTPQFFPLHLLRTCLQQALSQQAVITDEASALEFCGYQPLLVPGRADNIKVTQPEDLALAGFYLSNNNKEQTT

Flanking regions ( +/- flanking 50bp)

CAGTCACAAAGTCGCAGTAACTAATCCCTATGACAATACTTTCTTCCGCAATGACCGGCGCACAACCGGCACCGGACTTATCCGGTATTTCTGATGATGCTCCGGTTACGGCGCTGATCCCGGCCGCCGGTACCGGTACCCGCATGCAGTGCGAATGCCCCAAGCAATACCTGATTATTGCCGGAAAAACCATTCTGGAACATACCCTCGCTATTCTGCTGGAACACCCGCGCATCACACAGGTGGTCGTGGCGCTGCATCCGCAGGATACGGTTTTCAGTACATTACCGGTCGCGCGGCATCCCCGTATCCGCACTGTCACCGGCGGTGGTGAGCGGGCAGATTCTGTCCTGGCGGGTCTCGATTATCTTGCTGATCATACTCCGGAAAACAGCTGGGTGCTGGTACATGATGCTGCGCGTCCCTGTCTGCAACTGACAGATCTGAACCGGCTGCTGGCCGTGATGTCAGACACACAAACCGGTAACCGCGTGCAGGGGGCGATTCTGGCCTCACCGGTACGTGATACCATGAAGCGGGGTGTGGCATCTGCCGGATATACCGGTATTGATCACACTGTTGAGCGCACACAGTTGTGGCACGCCCTGACCCCGCAATTTTTCCCGCTTCATCTGCTGCGCACCTGTCTGCAGCAGGCGCTGTCTCAGCAGGCAGTGATCACTGATGAAGCCTCCGCGCTGGAGTTTTGCGGCTATCAGCCGTTGCTGGTGCCCGGCCGCGCGGACAATATTAAAGTCACACAGCCGGAAGATCTCGCACTTGCCGGGTTCTACCTGTCCAATAACAATAAGGAACAGACAACATGATGAGAATCGGACACGGTTTTGATGTTCATGCCTTCGGCGGCGAAGGCCCG