Homologs in group_3044

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18180 FBDBKF_18180 100.0 Morganella morganii S1 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
EHELCC_18215 EHELCC_18215 100.0 Morganella morganii S2 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
LHKJJB_18335 LHKJJB_18335 100.0 Morganella morganii S3 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
HKOGLL_18070 HKOGLL_18070 100.0 Morganella morganii S5 - Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
F4V73_RS01725 F4V73_RS01725 82.3 Morganella psychrotolerans - methyl-accepting chemotaxis protein

Distribution of the homologs in the orthogroup group_3044

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3044

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P21823 1.43e-101 318 55 2 328 3 tas Methyl-accepting chemotaxis aspartate transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
P05704 1.29e-98 311 46 6 416 1 trg Methyl-accepting chemotaxis protein III Escherichia coli (strain K12)
P02941 1e-97 309 41 9 528 1 tar Methyl-accepting chemotaxis protein II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P07017 3.29e-97 308 57 1 307 1 tar Methyl-accepting chemotaxis protein II Escherichia coli (strain K12)
P21822 4.61e-97 307 55 2 327 3 tse Methyl-accepting chemotaxis serine transducer Klebsiella aerogenes (strain ATCC 13048 / DSM 30053 / CCUG 1429 / JCM 1235 / KCTC 2190 / NBRC 13534 / NCIMB 10102 / NCTC 10006 / CDC 819-56)
Q02755 5.54e-95 301 55 1 306 3 tcp Methyl-accepting chemotaxis citrate transducer Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P02942 5.49e-90 289 55 2 295 1 tsr Methyl-accepting chemotaxis protein I Escherichia coli (strain K12)
P07018 2.36e-87 281 45 6 410 1 tap Methyl-accepting chemotaxis protein IV Escherichia coli (strain K12)
Q9I6V6 9.54e-79 263 52 1 306 1 mcpB Methyl-accepting chemotaxis protein McpB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q00986 1.1e-58 209 42 1 298 3 mcpA Chemoreceptor McpA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P50466 1.07e-52 189 36 4 324 1 aer Aerotaxis receptor Escherichia coli (strain K12)
Q02929 6.35e-52 188 32 7 399 3 Cthe_0039 Putative sensory transducer protein Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P55439 2.22e-40 159 38 1 288 3 NGR_a03800 Probable chemoreceptor y4fA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A5W2C8 7.44e-32 132 31 5 341 2 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P55652 2.03e-31 132 36 1 267 3 NGR_a01640 Probable chemoreceptor y4sI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q88JK6 3.18e-31 130 31 5 341 1 pcaY Methyl-accepting chemotaxis protein PcaY Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88D09 1.25e-29 126 31 6 334 1 mcpQ Methyl-accepting chemotaxis protein McpQ Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9X0M7 3.29e-28 121 30 10 362 1 mcp2 Methyl-accepting chemotaxis protein 2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P39215 1.07e-27 120 32 5 277 1 mcpB Methyl-accepting chemotaxis protein McpB Bacillus subtilis (strain 168)
Q9HW93 4.17e-27 119 30 14 371 1 pctC Methyl-accepting chemotaxis protein PctC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
G3XDA3 2.07e-26 116 29 7 352 1 ctpH Methyl-accepting chemotaxis protein CtpH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HW91 2.35e-26 116 30 15 372 1 pctB Methyl-accepting chemotaxis protein PctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q882Z2 2.63e-25 113 30 7 340 3 pscA Methyl-accepting chemotaxis protein PscA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9HUB1 3.18e-25 113 32 9 349 1 mcpK Methyl-accepting chemotaxis protein McpK Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
G3XD24 3.82e-25 112 29 14 373 1 pctA Methyl-accepting chemotaxis protein PctA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P39217 5.06e-25 112 28 5 321 3 tlpB Methyl-accepting chemotaxis protein TlpB Bacillus subtilis (strain 168)
Q88E10 1.84e-24 110 34 2 226 1 mcpS Methyl-accepting chemotaxis protein McpS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O32239 2.52e-24 110 26 8 380 3 yvaQ Putative sensory transducer protein YvaQ Bacillus subtilis (strain 168)
Q88KP1 3.26e-24 110 29 8 344 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P39214 5.91e-24 109 33 5 248 1 mcpA Methyl-accepting chemotaxis protein McpA Bacillus subtilis (strain 168)
Q9X1E2 7.89e-24 108 31 6 266 1 mcp4 Methyl-accepting chemotaxis protein 4 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WYR0 3.61e-23 107 28 7 332 1 mcp1 Methyl-accepting chemotaxis protein 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P39216 5.89e-23 106 30 7 312 3 tlpA Methyl-accepting chemotaxis protein TlpA Bacillus subtilis (strain 168)
Q9Z429 7.03e-23 105 29 9 345 3 nahY Methyl-accepting chemotaxis protein NahY Pseudomonas putida
Q55445 2.82e-22 104 28 2 285 3 sll0041 Putative methyl-accepting chemotaxis protein sll0041 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P42257 7.22e-22 103 26 7 414 1 pilJ Protein PilJ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B0R9Z1 9.85e-22 101 35 3 234 1 car Transducer protein Car Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P39209 1.1e-21 102 28 10 359 3 tlpC Methyl-accepting chemotaxis protein TlpC Bacillus subtilis (strain 168)
Q9I3F6 1.91e-21 100 30 5 287 1 aer Methyl-accepting chemotaxis protein Aer Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0VTI9 4.71e-21 100 29 2 285 3 ABO_0106 Putative methyl-accepting chemotaxis AlkN Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q88IY8 7.37e-21 99 25 4 390 1 mcpP Methyl-accepting chemotaxis protein McpP Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6HNQ4 8.38e-21 99 26 6 352 3 BT9727_0469 Probable methyl-accepting chemotaxis protein BT9727_0469 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q88N45 1.8e-20 98 31 11 337 1 mcpG Methyl-accepting chemotaxis protein McpG Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P43500 4.76e-20 95 28 2 296 1 frzCD Frizzy aggregation protein FrzCD Myxococcus xanthus
P35841 8.69e-20 96 30 4 262 3 dcrA Chemoreceptor protein A Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q52877 1.55e-19 95 32 7 265 3 mcpE Probable chemoreceptor McpE Rhizobium meliloti (strain 1021)
Q9X0N0 3.79e-19 94 24 17 493 1 mcp3 Methyl-accepting chemotaxis protein 3 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9HP81 8.15e-19 93 27 7 335 3 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6B1 8.15e-19 93 27 7 335 1 htr2 Sensory rhodopsin II transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5V5V4 1.4e-18 92 27 6 333 2 htr2 Sensory rhodopsin II transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9I055 1.43e-18 92 25 11 402 1 mcpN Methyl-accepting chemotaxis protein McpN Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C0SP89 1.88e-18 92 25 10 393 2 yoaH Putative methyl-accepting chemotaxis protein YoaH Bacillus subtilis (strain 168)
Q88R14 2.3e-18 92 27 6 330 1 mcpH Methyl-accepting chemotaxis protein McpH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I0I4 2.96e-18 91 30 11 342 1 tlpQ Methyl-accepting chemotaxis protein TlpQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HP84 3.39e-18 91 26 3 301 3 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A7 3.39e-18 91 26 3 301 1 cosT Transducer protein CosT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI5 6.03e-18 90 33 6 289 3 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R6A6 6.03e-18 90 33 6 289 1 htr7 Transducer protein Htr7 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R474 6.91e-18 90 26 4 300 1 htr18 Transducer protein Htr18 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P15492 6.95e-18 90 27 13 368 3 hlyB Methyl-accepting chemotaxis protein HlyB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P42258 8.8e-18 89 27 6 333 3 htrII Sensory rhodopsin II transducer (Fragment) Haloarcula vallismortis
Q9HUW6 2.33e-17 89 26 4 333 1 ctpL Methyl-accepting chemotaxis protein CtpL Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HPR6 4.58e-17 87 27 3 295 3 hemAT Heme-based aerotactic transducer HemAT Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5T0 5.46e-17 87 25 5 313 1 htr8 Transducer protein Htr8 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q88NI1 6.84e-17 87 29 10 345 1 mcpU Methyl-accepting chemotaxis protein McpU Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6HP15 7.81e-17 87 27 11 386 3 BT9727_0355 Probable methyl-accepting chemotaxis protein BT9727_0355 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P42259 1.23e-16 86 33 3 214 1 htr2 Sensory rhodopsin II transducer Natronomonas pharaonis
Q2W4T8 1.55e-16 86 37 2 169 1 amb2333 Methyl-accepting chemotaxis protein Amb2333 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9I3S1 3.85e-16 84 41 2 130 1 bdlA Biofilm dispersion protein BdlA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54576 4.68e-16 84 25 5 320 1 mcpC Methyl-accepting chemotaxis protein McpC Bacillus subtilis (strain 168)
Q9I0I6 5e-16 84 28 11 340 1 ctpM Methyl-accepting chemotaxis protein CtpM Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9R9U8 1.08e-15 83 25 7 334 3 alkN Putative methyl-accepting chemotaxis AlkN Pseudomonas oleovorans
Q5UXM8 5.45e-15 81 29 13 344 1 htr1 Sensory rhodopsin I transducer Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q2W8M7 7.74e-15 80 34 2 196 1 amb0994 Methyl-accepting chemotaxis protein Amb0994 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P0DMI4 9.07e-15 80 30 4 251 3 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R470 9.07e-15 80 30 4 251 1 htr4 Transducer protein Htr4 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R6I4 1.23e-14 80 27 7 296 1 basT Transducer protein BasT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R367 1.28e-14 80 27 9 335 1 mpcT Transducer protein MpcT Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
P0DMI3 1.96e-14 79 27 11 360 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R632 1.96e-14 79 27 11 360 1 htr1 Sensory rhodopsin I transducer Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A5F389 1.11e-13 77 36 5 150 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0C6D8 1.17e-13 77 36 5 150 3 tcpI Toxin coregulated pilus biosynthesis protein I Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O07621 2.26e-13 75 38 2 116 1 hemAT Heme-based aerotactic transducer HemAT Bacillus subtilis (strain 168)
B0R461 8.48e-13 74 25 7 347 1 htr6 Transducer protein Htr6 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
B0R4N9 1.07e-12 73 29 4 240 1 htr13 Transducer protein Htr13 Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9HQ00 2.42e-12 72 32 2 163 3 htr9 Halobacterial transducer protein 9 Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
O06477 1.38e-10 65 47 0 68 2 yfmS Putative sensory transducer protein YfmS Bacillus subtilis (strain 168)
Q9I6V2 7.76e-10 64 45 0 75 1 mcpA Methyl-accepting chemotaxis protein McpA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_18140
Feature type CDS
Gene -
Product Methyl-accepting chemotaxis protein I (Serine chemoreceptor protein)
Location 1988 - 3547 (strand: 1)
Length 1560 (nucleotides) / 519 (amino acids)

Contig

Accession ZDB_540
Length 35191 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3044
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00015 Methyl-accepting chemotaxis protein (MCP) signalling domain
PF00672 HAMP domain
PF02203 Tar ligand binding domain homologue

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0840 Signal transduction mechanisms (T) T Methyl-accepting chemotaxis protein (MCP)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03406 methyl-accepting chemotaxis protein Two-component system
Bacterial chemotaxis		 -

Protein Sequence

MQLLRNLSIRFVMLSILGILCLTLGCVSFYSDWSLSRVSDGNATDRQLVRQLTVLNQGNDQYFRFISRLNREMQKKAEGEEPDLKPSAEAMENMGLHLAEMKRISPGPMDVQMSEKVIARWQALYDEGVKIQMQLAEQGDQAGYRKQSHDVTPQLSKEFGAASLEFTQVAETRIEQTRTLVDGLMTTTRIVIISGTLFGLLILIFADRYLVKMMQRPLNNVRQHFRRIAGGDLSQPVESDAAGRNCVGKLFPLLSEMQDSLRDAVSSIREGSDTLRDSASEIARGNTDLSSRTEQQAAALEETAASMEEITATVKLNADHAHHASELAEVTSSTAHQGHEMIAAVIRTMDEISESSRKIAEITNVINSIAFQTNILALNASIEAARAGVHGRGFMVVAGEVRTLASNSADAAKEIERLIANAVSRVDQGIKLVAGGGETMEEIVRASGEVTEIMKEIAIASEEQTKGILQVGTAITQMDTVTQQNASLVSNVSETAAGLELQTQALQNSVQKFRLSAAD

Flanking regions ( +/- flanking 50bp)

TATCCGTATGGCCCTGCCAGATCATTTTATCGTCCCTTAAAGGAAACTGTATGCAGTTACTTCGAAACTTATCCATCCGGTTCGTCATGCTGTCGATACTCGGTATTTTGTGTCTGACACTCGGATGTGTCAGTTTTTACAGTGACTGGTCACTGTCGAGAGTGTCTGACGGCAATGCGACCGATCGTCAGCTAGTCCGGCAGCTGACGGTACTGAATCAGGGAAATGACCAGTATTTCCGGTTTATTTCCCGGCTGAACCGCGAAATGCAGAAAAAAGCGGAAGGGGAAGAACCGGATTTAAAACCGTCTGCGGAAGCGATGGAGAATATGGGGCTGCACCTGGCGGAGATGAAACGGATTTCCCCGGGACCGATGGATGTGCAGATGTCAGAAAAGGTGATTGCCCGCTGGCAGGCACTCTATGATGAAGGGGTTAAAATTCAGATGCAGCTGGCGGAGCAGGGGGATCAGGCGGGTTACCGTAAGCAGTCCCATGATGTCACACCGCAGCTGAGCAAAGAATTTGGTGCTGCCAGCCTTGAATTTACGCAGGTGGCGGAGACGCGGATCGAACAGACCCGTACCCTGGTGGACGGCCTGATGACCACCACACGGATTGTGATTATCAGCGGCACACTGTTTGGTCTGCTGATCCTGATTTTTGCTGACCGCTATCTGGTGAAGATGATGCAGCGCCCGCTGAACAATGTCCGTCAGCATTTCCGCCGTATTGCCGGGGGGGACCTCAGCCAGCCGGTGGAAAGTGACGCAGCCGGGCGTAACTGTGTCGGTAAATTGTTCCCGCTGCTCAGTGAGATGCAGGACAGTCTGCGGGATGCGGTCAGTTCTATCCGTGAAGGCAGTGATACCCTGCGCGACAGTGCTTCTGAGATTGCGCGCGGCAATACGGATCTCTCCTCGCGTACCGAGCAGCAGGCGGCGGCGCTGGAAGAGACAGCGGCGAGTATGGAAGAGATCACCGCGACAGTGAAACTGAATGCGGATCATGCGCATCATGCCAGCGAACTGGCGGAAGTAACGTCCTCAACGGCACATCAGGGCCATGAGATGATCGCTGCGGTTATCCGCACAATGGACGAAATTTCCGAGAGTTCACGCAAAATTGCTGAAATCACCAATGTGATTAACAGTATCGCTTTCCAGACTAACATTCTGGCGCTGAATGCCTCGATAGAAGCGGCGCGGGCCGGTGTCCACGGACGCGGCTTTATGGTGGTGGCCGGTGAGGTGCGGACACTGGCCAGCAACAGTGCGGATGCCGCCAAAGAGATTGAACGGCTGATAGCCAATGCGGTGTCCCGTGTTGATCAGGGCATTAAACTGGTCGCCGGCGGCGGGGAAACGATGGAGGAGATTGTCCGTGCCTCCGGTGAAGTCACGGAGATCATGAAAGAAATTGCCATTGCGTCAGAGGAGCAAACCAAAGGGATCTTACAGGTCGGCACTGCAATCACCCAGATGGACACTGTGACCCAGCAGAATGCCTCGCTGGTCAGCAATGTCTCTGAAACCGCCGCCGGGCTGGAATTACAGACACAGGCGCTGCAGAACTCCGTACAGAAATTCCGCCTCAGTGCTGCGGACTGACGCGGCTCAGATTGCTGCCGTGGCCAGTAAATCGCGGTAGTAATCTATCT