Homologs in group_2091

Help

6 homologs were identified in 4 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15710 FBDBKF_15710 100.0 Morganella morganii S1 merA mercury(II) reductase
FBDBKF_20225 FBDBKF_20225 92.2 Morganella morganii S1 merA MerA
EHELCC_16065 EHELCC_16065 100.0 Morganella morganii S2 merA mercury(II) reductase
EHELCC_19590 EHELCC_19590 92.2 Morganella morganii S2 merA MerA
LHKJJB_16500 LHKJJB_16500 100.0 Morganella morganii S3 merA mercury(II) reductase
HKOGLL_16270 HKOGLL_16270 100.0 Morganella morganii S5 merA mercury(II) reductase

Distribution of the homologs in the orthogroup group_2091

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2091

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q51772 0.0 1100 99 0 548 3 merA Mercuric reductase Pseudomonas fluorescens
P00392 0.0 920 85 2 561 1 merA Mercuric reductase Pseudomonas aeruginosa
Q52109 0.0 909 83 2 561 3 merA Mercuric reductase Acinetobacter calcoaceticus
P94188 0.0 905 84 4 563 3 merA Mercuric reductase Alcaligenes sp.
P94702 0.0 891 82 2 561 3 merA Mercuric reductase Enterobacter agglomerans
P08332 0.0 879 81 3 564 3 merA Mercuric reductase Shigella flexneri
P17239 0.0 863 80 1 547 1 merA Mercuric reductase Acidithiobacillus ferrooxidans
Q54465 0.0 637 57 3 558 3 merA Mercuric reductase Shewanella putrefaciens
P08662 2.69e-168 488 70 6 378 3 merA Mercuric reductase (Fragments) Serratia marcescens
P08662 5.61e-72 240 98 0 118 3 merA Mercuric reductase (Fragments) Serratia marcescens
P0A0E4 3.77e-133 401 42 13 558 3 merA Mercuric reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P0A0E5 3.77e-133 401 42 13 558 3 merA Mercuric reductase Staphylococcus aureus
D9J041 1.5e-132 399 41 11 554 1 merA Mercuric reductase Lysinibacillus sphaericus
P16171 3.77e-126 386 41 10 555 1 merA Mercuric reductase Bacillus cereus
P30341 1.08e-118 361 46 4 470 2 merA Mercuric reductase Streptomyces lividans
Q04829 4.54e-69 233 33 11 464 1 lpdA Dihydrolipoyl dehydrogenase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
G0SB20 2.79e-67 229 32 9 469 1 CTHT_0048590 Dihydrolipoamide dehydrogenase Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
P11959 8.25e-67 227 34 10 447 1 pdhD Dihydrolipoyl dehydrogenase Geobacillus stearothermophilus
P21880 1.19e-61 213 32 11 467 3 pdhD Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
P0A0E7 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MW2)
P0A0E8 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus
Q6GAB8 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MSSA476)
Q6GHY9 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain MRSA252)
P99084 1.27e-61 213 34 10 445 1 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain N315)
P0A0E6 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY8 1.27e-61 213 34 10 445 3 pdhD Dihydrolipoyl dehydrogenase Staphylococcus aureus (strain COL)
P77212 2.54e-61 211 31 9 447 1 rclA Probable pyridine nucleotide-disulfide oxidoreductase RclA Escherichia coli (strain K12)
P57303 2.67e-61 212 30 11 463 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P85207 6.33e-61 211 34 14 468 1 lpd Dihydrolipoyl dehydrogenase Thermus scotoductus (strain ATCC 700910 / SA-01)
Q5UWH2 8.14e-61 211 31 8 463 3 lpdA3 Dihydrolipoyl dehydrogenase 3 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q9HN74 2.22e-58 204 31 9 461 3 lpdA Dihydrolipoyl dehydrogenase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9PJI3 7.33e-57 200 31 8 442 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia muridarum (strain MoPn / Nigg)
P43784 5.69e-56 198 29 9 470 3 lpdA Dihydrolipoyl dehydrogenase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O00087 1.39e-55 198 29 12 464 2 dld1 Dihydrolipoyl dehydrogenase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Z773 1.44e-55 196 31 8 441 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia pneumoniae
P31052 1.57e-55 197 29 9 466 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas putida
O84561 5.37e-55 195 30 8 442 3 lpdA Dihydrolipoyl dehydrogenase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9M5K3 8.18e-55 196 30 8 464 1 LPD1 Dihydrolipoyl dehydrogenase 1, mitochondrial Arabidopsis thaliana
P0A9P3 1.04e-54 194 29 13 470 3 lpdA Dihydrolipoyl dehydrogenase Shigella flexneri
P0A9P0 1.04e-54 194 29 13 470 1 lpdA Dihydrolipoyl dehydrogenase Escherichia coli (strain K12)
P0A9P1 1.04e-54 194 29 13 470 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9P2 1.04e-54 194 29 13 470 3 lpdA Dihydrolipoyl dehydrogenase Escherichia coli O157:H7
O50286 1.94e-54 194 29 13 473 3 lpd Dihydrolipoyl dehydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5UYG6 4.49e-54 193 32 9 460 3 lpdA2 Dihydrolipoyl dehydrogenase 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P31023 6.2e-54 193 29 10 509 1 LPD Dihydrolipoyl dehydrogenase, mitochondrial Pisum sativum
P18925 6.28e-54 192 29 8 464 1 None Dihydrolipoyl dehydrogenase Azotobacter vinelandii
P14218 1.32e-53 192 28 8 463 1 lpd Dihydrolipoyl dehydrogenase Pseudomonas fluorescens
Q9I3D1 1.74e-53 191 28 8 463 1 lpdG Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8K9T7 1.81e-53 191 28 10 462 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9KPF6 1.54e-52 189 29 13 473 3 lpd Dihydrolipoyl dehydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P9WHH9 1.62e-52 188 30 9 457 1 lpdC Dihydrolipoyl dehydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH8 1.62e-52 188 30 9 457 3 lpdC Dihydrolipoyl dehydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66005 1.62e-52 188 30 9 457 3 lpd Dihydrolipoyl dehydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q50068 2.33e-52 188 29 12 467 3 lpd Dihydrolipoyl dehydrogenase Mycobacterium leprae (strain TN)
D0VWY5 1.29e-51 186 33 11 423 1 garB Glutathione amide reductase Marichromatium gracile
P90597 2.95e-51 185 30 11 460 1 LPD Dihydrolipoyl dehydrogenase Trypanosoma cruzi
Q54EW8 4.63e-51 185 28 6 444 3 lpd Dihydrolipoyl dehydrogenase, mitochondrial Dictyostelium discoideum
Q41219 6.77e-51 185 29 9 450 1 FLBR Leghemoglobin reductase Glycine max
Q04933 8.05e-51 184 31 13 463 3 None Dihydrolipoyl dehydrogenase Trypanosoma brucei brucei
Q9M5K2 6.66e-50 182 29 11 469 1 LPD2 Dihydrolipoyl dehydrogenase 2, mitochondrial Arabidopsis thaliana
Q60HG3 1.25e-49 182 28 12 472 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Macaca fascicularis
P09622 1.29e-49 182 27 12 472 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Homo sapiens
P09624 1.84e-49 181 29 9 469 1 LPD1 Dihydrolipoyl dehydrogenase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SPB1 2.19e-49 181 29 10 451 1 FLBR Leghemoglobin reductase Vigna unguiculata
Q8NTE1 3.62e-49 179 27 11 463 1 lpd Dihydrolipoyl dehydrogenase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
F1N206 7.31e-49 179 27 12 472 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Bos taurus
P49819 7.61e-49 179 27 12 472 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Canis lupus familiaris
P09623 1.11e-48 179 28 11 470 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial Sus scrofa
Q8CIZ7 1.28e-48 179 27 14 501 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Cricetulus griseus
Q811C4 1.31e-48 178 27 12 500 1 DLD Dihydrolipoyl dehydrogenase, mitochondrial (Fragment) Mesocricetus auratus
O34324 1.69e-48 177 31 8 432 3 acoL Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
Q5R4B1 2.57e-48 178 27 12 472 2 DLD Dihydrolipoyl dehydrogenase, mitochondrial Pongo abelii
O17953 2.77e-48 177 27 10 463 3 dld-1 Dihydrolipoyl dehydrogenase, mitochondrial Caenorhabditis elegans
Q6P6R2 6.8e-48 177 27 14 501 1 Dld Dihydrolipoyl dehydrogenase, mitochondrial Rattus norvegicus
O08749 1.04e-47 176 27 14 501 1 Dld Dihydrolipoyl dehydrogenase, mitochondrial Mus musculus
P75393 1.12e-47 175 30 13 452 1 pdhD Dihydrolipoyl dehydrogenase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P06715 4.99e-47 173 31 13 425 1 gor Glutathione reductase Escherichia coli (strain K12)
Q9I1L9 1.4e-46 172 29 8 454 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43783 8.66e-46 170 29 10 415 3 gor Glutathione reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HUY1 1.82e-45 169 29 11 469 3 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P23189 1.82e-45 169 30 12 438 3 gor Glutathione reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q873E8 2.03e-45 169 32 12 367 3 gtr-1 Glutathione reductase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P50970 8.55e-45 167 27 8 450 3 lpd Dihydrolipoyl dehydrogenase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q89AQ8 1.14e-44 167 27 13 486 3 lpdA Dihydrolipoyl dehydrogenase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P09063 4.71e-44 165 30 9 452 1 lpdV Dihydrolipoyl dehydrogenase Pseudomonas putida
P47513 5.12e-44 165 29 12 456 3 pdhD Dihydrolipoyl dehydrogenase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q7MBG9 8.29e-44 165 26 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P52992 2.35e-43 164 27 10 478 3 odhL Dihydrolipoyl dehydrogenase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P9WHH3 2.81e-43 163 30 12 442 1 mtr Mycothione reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH2 2.81e-43 163 30 12 442 3 mtr Mycothione reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P78965 1.2e-42 161 32 12 370 1 pgr1 Glutathione reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P80461 3.14e-42 162 28 12 450 1 GOR Glutathione reductase, chloroplastic (Fragment) Nicotiana tabacum
P31046 6.83e-42 159 27 10 466 1 lpd3 Dihydrolipoyl dehydrogenase 3 Pseudomonas putida
Q43621 8.46e-42 160 28 12 455 2 None Glutathione reductase, cytosolic Pisum sativum
Q43154 9.37e-42 159 28 9 440 2 None Glutathione reductase, chloroplastic (Fragment) Spinacia oleracea
Q1QX78 1.05e-41 159 26 11 461 3 sthA Soluble pyridine nucleotide transhydrogenase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P48639 1.09e-41 159 30 10 447 3 gor Glutathione reductase Burkholderia cepacia
O04955 2.1e-41 159 29 10 438 2 GR1 Glutathione reductase, cytosolic Brassica rapa subsp. pekinensis
O18480 2.44e-41 159 26 9 476 2 None Dihydrolipoyl dehydrogenase Manduca sexta
P95596 4.9e-41 157 27 8 457 3 lpd Dihydrolipoyl dehydrogenase Rhodobacter capsulatus
Q8KCW2 5.54e-41 157 30 10 460 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P48638 5.92e-41 157 28 12 452 3 gor Glutathione reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O05940 7.07e-41 157 27 12 474 3 lpdA Dihydrolipoyl dehydrogenase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6C5H4 8.08e-41 157 28 11 439 3 GLR1 Glutathione reductase Yarrowia lipolytica (strain CLIB 122 / E 150)
P42770 1.91e-40 157 29 12 437 2 EMB2360 Glutathione reductase, chloroplastic Arabidopsis thaliana
P48641 2.29e-40 156 29 10 438 1 At3g24170 Glutathione reductase, cytosolic Arabidopsis thaliana
Q60151 3.37e-40 154 30 11 414 3 gor Glutathione reductase Streptococcus thermophilus
P72740 4.95e-40 154 29 12 482 1 lpdA Dihydrolipoyl dehydrogenase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P48640 7.05e-40 155 29 11 440 2 GR Glutathione reductase, chloroplastic Glycine max
P48642 8.67e-40 154 28 12 436 2 GRC2 Glutathione reductase, cytosolic Oryza sativa subsp. japonica
O50311 1.46e-39 153 30 10 460 3 lpd Dihydrolipoyl dehydrogenase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
A6VW16 3.38e-39 152 25 9 464 3 sthA Soluble pyridine nucleotide transhydrogenase Marinomonas sp. (strain MWYL1)
P47791 4.27e-39 152 28 11 436 1 Gsr Glutathione reductase, mitochondrial Mus musculus
P00390 6.04e-39 152 29 13 437 1 GSR Glutathione reductase, mitochondrial Homo sapiens
A2TIL1 1.33e-38 151 27 11 437 2 GSR Glutathione reductase, mitochondrial Callithrix jacchus
P27456 2.78e-38 151 28 11 442 2 GR Glutathione reductase, chloroplastic/mitochondrial Pisum sativum
P39051 6.24e-38 149 27 11 425 1 TPR Trypanothione reductase Trypanosoma brucei brucei
A1U1Y5 9.03e-38 148 26 9 455 3 sthA Soluble pyridine nucleotide transhydrogenase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
P57112 1.06e-37 148 25 7 453 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02PF5 1.06e-37 148 25 7 453 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UZU5 1.06e-37 148 25 7 453 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain LESB58)
Q6FRV2 1.76e-37 147 28 15 432 3 GLR1 Glutathione reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A6V3A6 2.02e-37 147 25 7 453 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas aeruginosa (strain PA7)
B2VGA0 2.81e-37 147 25 9 451 3 sthA Soluble pyridine nucleotide transhydrogenase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q1I7F0 3.19e-37 146 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas entomophila (strain L48)
A4VMU6 5.11e-37 146 24 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Stutzerimonas stutzeri (strain A1501)
B4F1H1 5.51e-37 146 25 9 457 3 sthA Soluble pyridine nucleotide transhydrogenase Proteus mirabilis (strain HI4320)
Q88KY8 1.75e-36 144 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6F5 1.75e-36 144 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KH90 1.82e-36 144 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain GB-1)
Q4KFA6 2.01e-36 144 25 9 458 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A4WG49 3.63e-36 144 24 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Enterobacter sp. (strain 638)
B1J606 5.22e-36 143 24 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas putida (strain W619)
Q3K9F5 5.22e-36 143 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain Pf0-1)
Q87KN5 5.54e-36 143 26 13 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q93379 1.05e-35 142 31 12 350 1 gsr-1 Glutathione reductase, mitochondrial Caenorhabditis elegans
Q8T137 1.21e-35 142 27 15 451 1 gsr Glutathione reductase Dictyostelium discoideum
Q2SIP2 1.41e-35 142 27 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Hahella chejuensis (strain KCTC 2396)
A4XSQ1 3.93e-35 140 25 9 459 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas mendocina (strain ymp)
A6TGE6 4.25e-35 140 23 8 451 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9XBQ9 5.27e-35 140 25 9 456 1 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii
C1DR10 5.27e-35 140 25 9 456 3 sthA Soluble pyridine nucleotide transhydrogenase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1JI37 7.57e-35 140 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O05139 8.6e-35 139 24 9 459 1 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens
B2TWF7 8.86e-35 139 24 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P9WHH5 9.76e-35 139 27 7 466 1 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH4 9.76e-35 139 27 7 466 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U665 9.76e-35 139 27 7 466 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFH2 9.76e-35 139 27 7 466 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KM51 9.76e-35 139 27 7 466 3 sthA Soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P66007 9.76e-35 139 27 7 466 3 sthA Probable soluble pyridine nucleotide transhydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P91938 1.24e-34 141 29 14 489 1 Trxr1 Thioredoxin reductase 1, mitochondrial Drosophila melanogaster
B5XZ14 1.62e-34 139 23 8 451 3 sthA Soluble pyridine nucleotide transhydrogenase Klebsiella pneumoniae (strain 342)
B1JQ50 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G61 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRG4 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis (strain Pestoides F)
Q1CNP4 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6N5 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZA97 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis
B2JZF3 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBU5 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD10 1.72e-34 139 25 10 457 3 sthA Soluble pyridine nucleotide transhydrogenase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q83MI1 1.74e-34 139 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Shigella flexneri
A8GL77 2.04e-34 139 24 10 455 3 sthA Soluble pyridine nucleotide transhydrogenase Serratia proteamaculans (strain 568)
B1IVB6 2.15e-34 139 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A770 2.15e-34 139 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O9:H4 (strain HS)
B7MR55 2.15e-34 139 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O81 (strain ED1a)
Q0TA96 2.83e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C3K4W1 2.89e-34 138 24 8 458 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas fluorescens (strain SBW25)
P54533 2.96e-34 138 26 12 468 3 bfmBC Dihydrolipoyl dehydrogenase Bacillus subtilis (strain 168)
B7UNU0 3e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LUN3 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R3U7 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain UTI89 / UPEC)
B6I5I0 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SE11)
B7NFR2 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P27306 3.06e-34 138 23 8 456 1 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12)
A1AIE2 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O1:K1 / APEC
B1XBX3 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / DH10B)
C5A0R1 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M718 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O8 (strain IAI1)
B7NU38 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z064 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LA64 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain 55989 / EAEC)
B7MIA0 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZUI2 3.06e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1LNS2 3.64e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FB93 3.64e-34 138 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q48KI8 7.72e-34 137 23 8 458 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q884I6 8.85e-34 137 24 8 458 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B7VM91 9.65e-34 137 24 11 458 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio atlanticus (strain LGP32)
C0Q478 1.02e-33 137 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi C (strain RKS4594)
Q57H91 1.02e-33 137 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella choleraesuis (strain SC-B67)
Q4ZV77 1.27e-33 136 23 8 458 3 sthA Soluble pyridine nucleotide transhydrogenase Pseudomonas syringae pv. syringae (strain B728a)
P66008 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66009 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella typhi
B5BJN6 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain AKU_12601)
A9N0H2 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PK71 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QXQ7 1.34e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella enteritidis PT4 (strain P125109)
B5REZ6 1.36e-33 136 24 10 460 3 sthA Soluble pyridine nucleotide transhydrogenase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q9N2I8 1.67e-33 137 29 16 458 1 TXNRD2 Thioredoxin reductase 2, mitochondrial Bos taurus
Q8X727 1.78e-33 136 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Escherichia coli O157:H7
P13110 3.05e-33 135 24 13 469 1 TPR Trypanothione reductase Trypanosoma congolense
Q7MQ83 3.51e-33 135 25 13 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain YJ016)
Q8DD46 3.51e-33 135 25 13 465 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio vulnificus (strain CMCP6)
A8AKW0 4.02e-33 135 23 8 456 3 sthA Soluble pyridine nucleotide transhydrogenase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C3LPZ2 5.76e-33 134 25 11 458 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain M66-2)
P50529 5.76e-33 134 25 11 458 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4K5 5.76e-33 134 25 11 458 3 sthA Soluble pyridine nucleotide transhydrogenase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8MS68 1.41e-32 135 27 13 457 2 LPD1 Dihydrolipoyl dehydrogenase 1, chloroplastic Arabidopsis thaliana
P9WHH7 1.56e-32 134 29 11 477 1 lpdA NAD(P)H dehydrogenase (quinone) Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHH6 1.56e-32 134 29 11 477 3 lpdA NAD(P)H dehydrogenase (quinone) Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q74ZK4 1.56e-32 133 30 15 370 3 GLR1 Glutathione reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
F4JLP5 2.43e-32 134 27 12 455 2 LPD2 Dihydrolipoyl dehydrogenase 2, chloroplastic Arabidopsis thaliana
Q6LLT9 5.28e-32 132 25 10 458 3 sthA Soluble pyridine nucleotide transhydrogenase Photobacterium profundum (strain SS9)
Q5E212 5.91e-32 132 24 10 459 3 sthA Soluble pyridine nucleotide transhydrogenase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6CZB1 8.27e-32 131 23 9 460 3 sthA Soluble pyridine nucleotide transhydrogenase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P39040 8.65e-32 131 26 16 469 1 TPR Trypanothione reductase Crithidia fasciculata
Q6HA23 1.12e-31 131 26 13 435 1 GLR1 Glutathione reductase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2NQZ3 1.42e-31 130 23 9 452 3 sthA Soluble pyridine nucleotide transhydrogenase Sodalis glossinidius (strain morsitans)
P41921 3.86e-31 129 27 13 378 1 GLR1 Glutathione reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P30635 3.96e-31 130 27 18 476 3 trxr-2 Probable glutathione reductase 2 Caenorhabditis elegans
Q9JLT4 1.75e-30 128 28 17 446 1 Txnrd2 Thioredoxin reductase 2, mitochondrial Mus musculus
P39050 2.05e-30 127 27 14 409 3 TPR Trypanothione reductase Leishmania donovani
P70619 2.57e-30 126 26 11 428 2 Gsr Glutathione reductase (Fragment) Rattus norvegicus
Q25861 2.69e-30 128 26 15 461 1 TRXR Thioredoxin reductase Plasmodium falciparum (isolate FCH-5)
Q6BPI1 3.32e-30 127 29 18 390 3 GLR1 Glutathione reductase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q9NNW7 9.59e-30 126 29 15 434 1 TXNRD2 Thioredoxin reductase 2, mitochondrial Homo sapiens
P61076 1.03e-29 127 26 15 461 1 TRXR Thioredoxin reductase Plasmodium falciparum (isolate 3D7)
Q9VNT5 1.16e-29 125 28 14 489 2 Trxr2 Thioredoxin reductase 2, mitochondrial Drosophila melanogaster
Q9JMH6 2.54e-29 125 27 14 423 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Mus musculus
Q9Z0J5 3.58e-29 124 27 15 445 1 Txnrd2 Thioredoxin reductase 2, mitochondrial Rattus norvegicus
O89049 5.28e-29 123 26 11 418 1 Txnrd1 Thioredoxin reductase 1, cytoplasmic Rattus norvegicus
Q94655 4.19e-28 121 24 16 477 1 GR Glutathione reductase Plasmodium falciparum (isolate K1 / Thailand)
P28593 4.43e-28 120 24 15 471 1 TPR Trypanothione reductase Trypanosoma cruzi
O15770 9.04e-28 120 25 16 475 1 GR Glutathione reductase Plasmodium falciparum (isolate 3D7)
Q02733 1.45e-27 119 26 18 476 1 IRC15 Increased recombination centers protein 15 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9A1H3 1.61e-27 119 27 19 496 1 SEP1 Thioredoxin reductase SEP1 Emiliania huxleyi
Q48A14 1.85e-27 119 23 11 464 3 sthA Soluble pyridine nucleotide transhydrogenase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
O62768 2.12e-27 119 26 10 423 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Bos taurus
C4K3I8 4.21e-27 117 24 11 461 3 sthA Soluble pyridine nucleotide transhydrogenase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q5NVA2 2.45e-26 115 25 10 423 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Pongo abelii
Q16881 8.8e-26 115 25 10 423 1 TXNRD1 Thioredoxin reductase 1, cytoplasmic Homo sapiens
Q9MYY8 1.5e-25 113 25 10 423 2 TXNRD1 Thioredoxin reductase 1, cytoplasmic Sus scrofa
P35484 8.02e-24 105 27 9 320 3 pdhD Dihydrolipoyl dehydrogenase (Fragment) Acholeplasma laidlawii
Q99MD6 1.24e-23 108 25 13 450 1 Txnrd3 Thioredoxin reductase 3 Mus musculus
Q86VQ6 1.39e-22 105 25 13 450 1 TXNRD3 Thioredoxin reductase 3 Homo sapiens
Q8U1M0 5.5e-22 102 28 10 345 1 nsr NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5JGP4 5.79e-21 99 29 10 345 1 TK1299 NAD(P)H sulfur oxidoreductase (CoA-dependent) Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9UYU5 2.69e-18 91 27 10 337 3 PYRAB14120 NAD(P)H sulfur oxidoreductase (CoA-dependent) Pyrococcus abyssi (strain GE5 / Orsay)
Q17745 4.4e-16 85 23 15 432 1 trxr-1 Thioredoxin reductase 1 Caenorhabditis elegans
Q5XC60 7.35e-16 83 24 12 367 1 M6_Spy0868 NADH oxidase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q56839 1.02e-15 83 23 19 486 1 xecC 2-oxopropyl-CoM reductase, carboxylating Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q58065 4.8e-15 81 28 17 357 3 MJ0649 NADH oxidase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O58308 8.53e-15 80 26 11 342 1 PH0572 NAD(P)H coenzyme A polysulfide/persulfide reductase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P37062 5.32e-14 77 27 14 354 1 npr NADH peroxidase Enterococcus faecalis (strain ATCC 700802 / V583)
P59403 7.01e-14 77 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri
Q0T1D6 7.01e-14 77 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella flexneri serotype 5b (strain 8401)
B5Z372 2e-13 75 28 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X850 2e-13 75 28 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O157:H7
Q3YYF3 3.98e-13 74 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella sonnei (strain Ss046)
B7UHC3 7.21e-13 73 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N6U1 8.56e-13 73 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8ANR8 9.8e-13 73 28 8 223 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7MYL1 1.68e-12 72 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O81 (strain ED1a)
A0A0H2UQZ4 2.43e-12 72 23 14 380 3 nox NADH oxidase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B7NSJ1 2.44e-12 72 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8A3I8 3.4e-12 71 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O9:H4 (strain HS)
B7M9E8 3.49e-12 71 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O8 (strain IAI1)
B7LEC2 3.49e-12 71 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain 55989 / EAEC)
P42433 3.72e-12 72 30 10 220 2 nasB Assimilatory nitrate reductase electron transfer subunit Bacillus subtilis (strain 168)
Q0TEG9 4.29e-12 71 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R7Y9 4.83e-12 71 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain UTI89 / UPEC)
A1AEQ1 4.83e-12 71 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O1:K1 / APEC
B7MKI0 4.83e-12 71 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LW23 6.85e-12 70 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
O84925 7.61e-12 71 23 14 380 1 nox NADH oxidase Streptococcus pneumoniae
P37596 7.91e-12 70 27 9 230 1 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12)
B1IUW8 7.91e-12 70 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XCN8 7.91e-12 70 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / DH10B)
C4ZYV6 7.91e-12 70 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain K12 / MC4100 / BW2952)
Q8DP70 1.17e-11 70 23 14 371 1 nox NADH oxidase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B1LQ29 1.27e-11 70 28 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SMS-3-5 / SECEC)
B6I697 1.27e-11 70 27 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli (strain SE11)
B2U036 2.59e-11 68 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32CL7 3.18e-11 68 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella dysenteriae serotype 1 (strain Sd197)
C0PWN3 3.33e-11 68 29 9 234 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi C (strain RKS4594)
A9N0E0 3.33e-11 68 30 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57KT2 3.33e-11 68 29 9 234 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella choleraesuis (strain SC-B67)
A7ZQE0 3.77e-11 68 27 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31X75 3.91e-11 68 27 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Shigella boydii serotype 4 (strain Sb227)
B5FSZ2 4.98e-11 68 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella dublin (strain CT_02021853)
B4T3B2 5.21e-11 68 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella newport (strain SL254)
Q8ZMJ6 5.3e-11 68 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5F365 5.7e-11 68 28 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella agona (strain SL483)
B5BEP9 6.34e-11 67 28 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain AKU_12601)
Q5PF36 6.34e-11 67 28 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8L3B0 7.34e-11 67 32 8 184 1 padH NADH-dependent phenylglyoxylate dehydrogenase subunit epsilon Aromatoleum evansii
Q8FEN4 7.59e-11 67 27 8 221 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B5QV90 8.6e-11 67 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella enteritidis PT4 (strain P125109)
B4TT18 9.16e-11 67 28 8 229 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella schwarzengrund (strain CVM19633)
B4TF25 1.26e-10 67 29 11 251 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella heidelberg (strain SL476)
Q8Z4C4 2.8e-10 65 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella typhi
B5RDG6 4.88e-10 65 29 10 236 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5XVA0 5.57e-10 65 26 7 194 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae (strain 342)
A2RIB7 6.71e-10 65 25 14 341 1 noxE NADH oxidase Lactococcus lactis subsp. cremoris (strain MG1363)
A6TCX6 1.14e-09 63 27 7 194 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MFX5 1.24e-09 63 26 9 230 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P08655 1.29e-09 61 30 5 173 4 None Uncharacterized 19.7 kDa protein in mercuric resistance operon Staphylococcus aureus
Q6D8S1 9.3e-09 61 28 10 232 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P42435 1.04e-08 62 26 5 189 2 nasD Nitrite reductase [NAD(P)H] Bacillus subtilis (strain 168)
P37061 1.51e-08 60 24 14 345 1 nox NADH oxidase Enterococcus faecalis (strain ATCC 700802 / V583)
A8GG95 2.26e-08 60 27 10 241 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Serratia proteamaculans (strain 568)
P75389 5.62e-08 58 22 13 365 3 nox NADH oxidase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8CPT6 5.68e-08 58 21 15 370 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQI9 5.68e-08 58 21 15 370 3 cdr Coenzyme A disulfide reductase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9PKT7 5.74e-08 58 27 7 197 3 trxB Thioredoxin reductase Chlamydia muridarum (strain MoPn / Nigg)
Q9Z8M4 7.14e-08 57 28 7 197 3 trxB Thioredoxin reductase Chlamydia pneumoniae
B5FG80 3.19e-07 56 28 10 235 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain MJ11)
O84101 4.55e-07 55 27 7 197 3 trxB Thioredoxin reductase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
A4STH3 6.26e-07 55 28 6 184 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas salmonicida (strain A449)
Q51973 9.94e-07 55 28 10 207 1 cmtAa p-cumate 2,3-dioxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas putida
A0KEJ2 2.63e-06 53 28 7 196 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P43494 3.05e-06 53 27 11 222 1 thcD Rhodocoxin reductase Rhodococcus erythropolis
Q8U1K9 3.37e-06 53 25 13 277 1 PF1197 NAD(P)H:rubredoxin oxidoreductase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q7N4V5 3.58e-06 53 27 6 198 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P08201 5.39e-06 53 27 8 237 3 nirB Nitrite reductase (NADH) large subunit Escherichia coli (strain K12)
Q58053 6.55e-06 52 22 8 227 4 MJ0636 Uncharacterized protein MJ0636 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
W8X9R5 6.68e-06 52 27 8 202 1 ctmF Probable ferredoxin reductase CtmF Castellaniella defragrans (strain DSM 12143 / CCUG 39792 / 65Phen)
G2ITT5 6.84e-06 52 31 4 146 1 ligXd 5,5'-dehydrodivanillate O-demethylase ferredoxin reductase subunit Sphingobium sp. (strain NBRC 103272 / SYK-6)
P80647 7.14e-06 46 47 1 46 1 None Dihydrolipoyl dehydrogenase (Fragment) Hymenolepis diminuta
Q5E3X0 7.36e-06 52 24 12 285 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A4WDR7 1.37e-05 51 24 9 233 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Enterobacter sp. (strain 638)
Q92375 1.43e-05 50 31 10 204 1 trr1 Thioredoxin reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O32823 1.66e-05 50 23 13 336 3 trxB Thioredoxin reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6FR39 1.71e-05 50 29 12 242 3 TRR1 Thioredoxin reductase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q06458 2.57e-05 50 28 11 271 3 nasB Nitrite reductase [NAD(P)H] large subunit Klebsiella oxytoca
Q928B5 3.24e-05 49 23 13 336 3 trxB Thioredoxin reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P17052 3.62e-05 50 33 5 126 1 alkT Rubredoxin-NAD(+) reductase Pseudomonas oleovorans
B1LNJ8 4.23e-05 49 31 10 182 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli (strain SMS-3-5 / SECEC)
Q3TY86 5.23e-05 49 22 6 246 1 Aifm3 Apoptosis-inducing factor 3 Mus musculus
P42454 5.77e-05 49 27 11 246 1 rubB Rubredoxin-NAD(+) reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9HTK9 6.91e-05 48 27 11 240 1 alkT Rubredoxin-NAD(+) reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29509 7.47e-05 48 29 11 231 1 TRR1 Thioredoxin reductase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6HA24 8.58e-05 48 28 11 227 3 TRR1 Thioredoxin reductase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
B3QPZ8 8.91e-05 48 26 18 343 3 Cpar_1603 Ferredoxin--NADP reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q96NN9 0.00014 48 21 6 246 1 AIFM3 Apoptosis-inducing factor 3 Homo sapiens
Q58931 0.000143 47 23 6 186 3 MJ1536 Putative thioredoxin reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P16640 0.00018 47 28 10 209 1 camA Putidaredoxin reductase CamA Pseudomonas putida
B7NRJ1 0.000187 47 29 11 201 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7N6C9 0.000246 47 29 11 201 3 hcaD 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin--NAD(+) reductase component Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P58341 0.000267 47 34 0 73 3 actP1 Copper-transporting ATPase 1 Rhizobium meliloti (strain 1021)
Q9L4M8 0.000327 47 31 5 126 3 alkT Rubredoxin-NAD(+) reductase Pseudomonas putida
Q8D4F7 0.000384 46 27 8 187 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain CMCP6)
Q9S7J8 0.000401 47 31 1 77 1 RAN1 Copper-transporting ATPase RAN1 Arabidopsis thaliana
Q7MFY7 0.00054 46 28 9 188 3 norW Nitric oxide reductase FlRd-NAD(+) reductase Vibrio vulnificus (strain YJ016)
Q39243 0.00064 45 26 4 153 1 NTR1 Thioredoxin reductase 1, mitochondrial Arabidopsis thaliana
P19410 0.000652 46 32 1 75 1 baiCD 3-oxocholoyl-CoA 4-desaturase Clostridium scindens (strain JCM 10418 / VPI 12708)
P76440 0.000704 45 28 5 158 1 preT NAD-dependent dihydropyrimidine dehydrogenase subunit PreT Escherichia coli (strain K12)
Q8KCB2 0.000731 45 26 11 257 1 CT1512 Ferredoxin--NADP reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P66013 0.000787 45 48 2 56 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MW2)
P99118 0.000787 45 48 2 56 1 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain N315)
P66012 0.000787 45 48 2 56 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GJR8 0.000836 45 48 2 56 3 ahpF Alkyl hydroperoxide reductase subunit F Staphylococcus aureus (strain MRSA252)
Q75CM8 0.000849 45 30 12 226 3 TRR1 Thioredoxin reductase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_16300
Feature type CDS
Gene merA
Product mercury(II) reductase
Location 3944 - 5590 (strand: 1)
Length 1647 (nucleotides) / 548 (amino acids)

Contig

Accession ZDB_533
Length 80662 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2091
Orthogroup size 7
N. genomes 5

Actions

Genomic region

Domains

PF00403 Heavy-metal-associated domain
PF02852 Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain
PF07992 Pyridine nucleotide-disulphide oxidoreductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1249 Energy production and conversion (C) C Dihydrolipoamide dehydrogenase (E3) component of pyruvate/2-oxoglutarate dehydrogenase complex or glutathione oxidoreductase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00520 mercuric reductase [EC:1.16.1.1] - -

AMR gene Annotation(s)

Gene Description Scope Type Class Subclass HMM
merA mercury(II) reductase plus STRESS MERCURY MERCURY TIGR02053 

Protein Sequence

MTEITVNGMTCTSCASHVKDALEKIPGVNAAVVSYPESRAQVMADTAVSHNQLLAAIAALGYQGSIRVGDFKDEPKIRDALEGAGLHIAIIGSGGAAMAAALKAVEQGATVTLIERGTIGGTCVNIGCVPSKIMIRAAHIAHLRRESPFDGGIAATVPAIDRCKLLAQQQARVDELRHAKYEGILDGNPAITVLHGEARFKDDQSLVVRLNEGGEREVTFDRCLVATGASPAVPPIPGLKESPYWTSTEALVSDTIPARLAVIGSSVVALELAQAFARLGSQVTILARSTLFFREDPAIGEAVTAAFRAEGIEVLEHTQASQVAHVNGEFVLTTGHGELRADKLLVATGRAPNTRSLALDAAGVTVNAQGAIVIDQGMRTSNPNIYAAGDCTDQPQFVYVAAAAGTRAAINMTGGDAALNLTAMPAVVFTDPQVATVGYSEAEAHHDGIETDSRTLTLDNVPRALANFDTRGFIKLVIEEGSGRLIGVQAVAPEAGELIQTAVLAIRNRMTVQELADQLFPYLTMVEGLKLAAQTFNKDVKQLSCCAG

Flanking regions ( +/- flanking 50bp)

AAACGCCAAGCCGATGCCTGCTGCACCCCGAAATTCAATGGAGTAAAAAAATGACCGAAATCACCGTGAATGGCATGACCTGCACATCCTGCGCCTCCCATGTCAAAGATGCTTTGGAAAAGATTCCCGGCGTGAATGCCGCTGTGGTGTCCTATCCAGAAAGCCGCGCGCAAGTCATGGCAGACACCGCCGTGAGCCACAACCAACTGCTGGCCGCCATCGCCGCATTGGGTTATCAAGGCTCGATCCGGGTTGGTGATTTCAAAGATGAACCAAAAATCCGTGATGCACTTGAGGGCGCCGGTTTGCATATCGCCATCATTGGCAGCGGCGGGGCCGCGATGGCGGCGGCGCTGAAGGCCGTCGAGCAAGGCGCGACGGTCACGCTGATCGAACGCGGCACCATCGGCGGCACCTGCGTCAATATCGGCTGTGTGCCGTCCAAGATCATGATCCGCGCTGCCCATATTGCCCATCTGCGCCGGGAAAGTCCGTTCGACGGCGGTATTGCGGCAACTGTGCCTGCGATTGACCGCTGCAAACTGCTGGCCCAGCAGCAGGCCCGTGTCGATGAACTGCGGCACGCCAAATACGAAGGCATCCTGGACGGCAATCCAGCCATCACCGTTTTGCACGGTGAAGCGCGTTTCAAGGACGACCAGAGCCTGGTCGTCCGTTTGAACGAGGGTGGCGAGCGCGAGGTAACGTTCGACCGCTGCCTGGTCGCCACCGGTGCCAGTCCGGCCGTGCCGCCGATTCCGGGCCTGAAAGAGTCACCCTACTGGACTTCCACCGAAGCGCTTGTCAGCGACACCATTCCCGCACGCCTGGCCGTGATCGGTTCGTCGGTGGTGGCGTTGGAACTGGCGCAAGCCTTTGCCCGGCTCGGCAGCCAGGTCACGATCCTGGCACGCAGCACCTTGTTCTTCCGGGAAGACCCGGCCATCGGCGAGGCCGTGACAGCCGCTTTCCGCGCCGAGGGCATCGAGGTGCTGGAGCACACGCAAGCCAGCCAGGTCGCCCATGTGAACGGCGAATTCGTGCTGACCACCGGACACGGTGAATTGCGCGCTGACAAGTTGCTGGTTGCCACCGGTCGGGCACCGAATACGCGCAGCCTCGCGCTGGACGCGGCGGGGGTCACTGTCAATGCGCAAGGGGCCATCGTTATCGACCAAGGCATGCGCACGAGCAACCCGAACATCTACGCGGCCGGCGACTGCACCGACCAGCCGCAGTTCGTCTACGTGGCAGCGGCCGCCGGCACCCGTGCCGCGATCAACATGACCGGCGGCGACGCAGCCCTCAATCTGACCGCGATGCCGGCAGTGGTGTTCACCGACCCGCAAGTCGCCACCGTGGGCTACAGCGAGGCGGAAGCGCACCACGATGGCATCGAGACCGACAGTCGCACGCTGACACTCGACAACGTTCCGCGAGCGCTTGCCAACTTCGACACACGCGGCTTCATCAAGCTGGTCATCGAGGAAGGTAGCGGACGGCTCATCGGCGTGCAGGCGGTGGCCCCGGAAGCGGGCGAACTGATCCAGACGGCGGTGCTCGCCATCCGCAACCGCATGACGGTGCAGGAACTGGCCGACCAGTTGTTCCCCTACCTGACAATGGTCGAGGGGTTGAAGCTTGCGGCGCAGACCTTCAACAAGGACGTGAAGCAGCTTTCCTGCTGCGCTGGATAAAAAAAGGAGGTTTTCAATGAGCGCCTACACCGTGTCCCGGCTGGCCCTTG